Chimeric Nanobody, Single-Molecule Localization Imaging Probe and Imaging Method
By designing chimeric nano-antibodies and combining click chemical modification technology, the problems of label size and label ratio in single-molecular localization super-resolution imaging technology are solved, and high-quality intracellular fine structure imaging and quantitative analysis are achieved.
Patent Information
- Application Number
- CN202411072634.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-06
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2044-08-06
AI Technical Summary
In the existing single-molecule localization super-resolution imaging technology, the problem of mark size and mark ratio makes quantitative analysis difficult, especially in the high-resolution quantitative analysis of fine structures in cells.
A chimeric nanoantibody was designed to link NbGFPe and Nb2 nanoantibodies through gene recombination technology, and combined with click chemical modification technology to form a probe for DNA-PAINT super-resolution imaging to achieve 1:1 high affinity labeling and quantitative analysis.
High-quality intracellular fine structure imaging and quantitative analysis are achieved, avoiding the problems of low affinity of single antibodies and multi-site labeling, and significantly improving the imaging resolution and quantitative analysis accuracy.
Smart Images

Figure CN119019552B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of fluorescence imaging, and particularly to a chimeric nanobody, a single-molecule localization imaging probe, and a single-molecule localization imaging method. Background Art
[0002] As a non-invasive means, fluorescence microscopy can directly obtain in-situ information of biological samples by labeling proteins of interest with fluorescent molecules. However, due to the existence of the optical diffraction limit, the resolution of ordinary fluorescence microscopes is about 200 nm, and molecular information cannot be resolved with high resolution. With the development of super-resolution fluorescence imaging technology, research work related to subcellular-scale life activities carried out around super-resolution imaging has received extensive attention today.
[0003] The super-resolution fluorescence imaging technology born in the early 21st century has rapidly developed into an indispensable technical means in life science research due to its advantages of nanoscale spatial resolution and has great potential as a structural biology research method. In 2014, three scientists from the United States and Germany were awarded the "Nobel Prize in Chemistry" for super-resolution optical microscopy.
[0004] Super-resolution imaging technologies can be classified into stimulated emission depletion microscopy (STED), structured illumination microscopy (SIM), and single-molecule localization microscopy (SMLM) according to their working principles. In 2019, the famous Chinese scientist Zhuang Xiaowei won the "Breakthrough Prize in Science" for developing SMLM and revealing the precise structures hidden inside cells. According to recent developments, it is found that the most promising technology for subcellular structure analysis is SMLM.
[0005] Single-molecule localization microscopy (SMLM) technology is widely favored by scientific researchers due to its simple imaging principle and extremely high spatial resolution (generally 20 - 30 nm). SMLM generally includes three types: photoactivated localization microscopy (PALM), stochastic optical reconstruction microscopy (STORM), and DNA-point accumulation for imaging in nanoscale topography (DNA-PAINT) that utilizes the reversible binding of fluorescent molecules to targets. Generally speaking, the principle of SMLM technology is to use wide-field illumination, utilize the blinking properties of fluorescent molecules, activate only part of the fluorescent molecules in each frame of imaging, collect images at different time points, and reconstruct a super-resolution image that breaks the optical diffraction limit through algorithms.
[0006] At present, researchers have improved and optimized SMLM in many aspects, such as instrument hardware, image processing algorithms, and sample preparation, and gradually applied this technology to the field of biology. For example, using imaging techniques such as STORM and PALM, fine observations of many subcellular structures such as chromatin, centrioles, nuclear pore complexes, mitochondria, endoplasmic reticulum, and cytoskeleton have been successively achieved; in addition, using these technologies, the nano-scale spatial distribution and tissue characteristics of important biological macromolecules such as genomic DNA and proteins in cells can be visually obtained, so as to conduct more accurate and comprehensive analysis of the co-localization relationship and interaction network between molecules.
[0007] SMLM data not only contains the spatial position information of fluorophores, but also includes the quantity information of fluorophores (such as the number of localizations and blinking kinetics). To achieve the goal of quantitative analysis, researchers use the spatio-temporal information of single-molecule localization data to establish a complex photophysical model of dye molecules for visual quantitative analysis. It can be known from the literature reports that the STORM / PALM technology based on conventional dyes or fluorescent protein molecules has certain limitations: First, the blinking and reactivation mechanisms of conventional dye molecules are not yet clear, and there is a problem of photobleaching, which will lead to inaccurate counting. At present, there is no good solution, which hinders protein quantitative analysis; Second, the distribution of proteins in cells is heterogeneous, with a wide scale range (from dozens of nanometers to hundreds of nanometers) and various distribution patterns. It is difficult to achieve high-precision and high-density localization imaging on a large scale, and there is an urgent need to develop diverse quantitative evaluation criteria. The in-situ high-resolution quantitative analysis of target proteins is still in its infancy, and better analysis methods are urgently needed to fill this gap.
[0008] The conventional labeling method is the immunofluorescence strategy using antibodies (150 kDa). The size of the antibody is about 10 nm and it cannot freely enter the cell membrane. Therefore, membrane disruption treatment is required to label intracellular proteins, which will affect the physiological structure of the sample and cannot achieve high-efficiency labeling. In addition, conventional immunofluorescence uses a labeling strategy of primary antibody plus secondary antibody. The distance between the dye molecules on the antibody and the target protein molecules is relatively large, which will bring relatively large connection errors and reduce the resolution of single-molecule localization. At present, in order to reduce the labeling size, a variety of labeling technologies have been developed, including Fab fragment antibodies, nanobodies, fluorescent proteins, short peptide tags, SNAP-tag tags, and HaloTag tags, etc., all of which can control the labeling size below 5 nm.
[0009] Benefiting from gene recombination technology, various labeling methods mediated by nanobodies provide a simple and general method to label numerous GFP- and RFP-derived fusion constructs, which can be used in advanced single-molecule imaging applications. With the increasing update of single-molecule localization super-resolution imaging technology, researchers have put forward higher requirements for using nanobodies for labeling, not only requiring antibodies with high specificity and high affinity, but also quantitative probes that can achieve 1:1 labeling.
[0010] In view of the development of technology and the needs of applications, it is very important to develop new and effective nanobody probes and establish single-molecule localization super-resolution imaging analysis methods based on them. Summary of the Invention
[0011] One of the technical objectives of the present invention is to provide a chimeric nanobody that can be used for single-molecule imaging, which can achieve high-affinity binding while achieving 1:1 labeling, with a small labeling connection error, and is conducive to a single-molecule localization super-resolution imaging method for quantitative analysis.
[0012] Another technical objective of the present invention is to provide a chimeric nanobody single-molecule localization imaging probe.
[0013] Another technical objective of the present invention is to provide a preparation method for the above-mentioned chimeric nanobody single-molecule localization imaging probe.
[0014] Another technical objective of the present invention is to provide a kit for single-molecule localization imaging.
[0015] Another technical objective of the present invention is to provide a single-molecule localization super-resolution fluorescence imaging method.
[0016] On the one hand, the present invention provides a chimeric nanobody that can be used for single-molecule imaging, which sequentially includes the following sequences from the N-terminus to the C-terminus:
[0017] NbGFPe nanobody sequence;
[0018] A linker with a length of 36 amino acids;
[0019] Nb2 nanobody sequence; and
[0020] A C-terminal linker containing cysteine.
[0021] In a specific embodiment, the amino acid sequence of the NbGFPe nanobody is: SEQ ID No:1.
[0022] In a specific embodiment, the amino acid sequence of the linker with a length of 36 amino acids is: SEQ ID No:2.
[0023] In a specific embodiment, the amino acid sequence of the Nb2 nanobody is: SEQ ID No:3.
[0024] In a specific embodiment, the amino acid sequence of the C-terminal linker containing cysteine is: SEQ ID No:4 or SEQ ID No:5, or the C-terminal linker containing cysteine is only a single cysteine.
[0025] In a specific embodiment, the amino acid sequence of the chimeric nanobody is SEQ ID No:6.
[0026] On the other hand, the present invention provides a recombinant protein, which comprises: the above-mentioned chimeric nanobody; and optionally a tag sequence for assisting expression and / or purification.
[0027] In yet another aspect, the present invention provides a polynucleotide encoding the above-mentioned chimeric nanobody or the above-mentioned recombinant protein.
[0028] In a specific embodiment, the nucleotide sequence of the polynucleotide is SEQ ID No:9.
[0029] In yet another aspect, the present invention provides a recombinant expression vector comprising the above-mentioned polynucleotide.
[0030] In yet another aspect, the present invention provides a transformant comprising the above-mentioned polynucleotide or the above-mentioned recombinant expression vector.
[0031] In yet another aspect, the present invention provides a chimeric nanobody single molecule localization imaging probe, which comprises:
[0032] the above-mentioned chimeric nanobody;
[0033] a DNA sequence for DNA-PAINT imaging, the nucleotide sequence of which is SEQ ID No:7 or SEQ ID No:8; and
[0034] a linking group for linking the chimeric nanobody and the DNA sequence for DNA-PAINT imaging.
[0035] In the chimeric nanobody single molecule localization imaging probe according to the present invention, the chimeric nanobody and the DNA sequence for DNA-PAINT imaging can be linked by any suitable linking group without particular limitation. For example, one end of the linking group can be linked to the chimeric nanobody through the thiol group at the end of the chimeric nanobody, and the other end can be linked to the 3'-end of the DNA sequence for DNA-PAINT imaging.
[0036] In a specific embodiment, the linking group has the structure shown in Formula I:
[0037] *-R-linker1-Mal’-**
[0038] I
[0039] Among them, R represents a linking group formed by an amino-reactive group or click chemistry, and examples thereof can be a group formed by the reaction of DBCO and azide, a group formed by the reaction of TCO and Tz, an amide group formed by the reaction of NHS ester and amino; Linker1 represents a C2-C10 alkylene group, and the C2-C10 alkylene group may optionally further contain an ester group, an amide group and / or a PEG chain represented by -(CH2CH2O)n- in its main chain, where n is an integer selected from 1 to 10, for example, n is 3 or 4.
[0040] Mal’ represents
[0041] * represents the position connected to the 3' end of the DNA sequence, and ** represents the position connected to the chimeric nanobody.
[0042] In a specific embodiment, the linking group is selected from
[0043]
[0044] In a specific embodiment, the chimeric nanobody single-molecule localization imaging probe has the following structure:
[0045]
[0046] In the above structures, represents the chimeric nanobody part, represents the DNA sequence part.
[0047] In another aspect, the present invention provides a method for preparing the above-mentioned chimeric nanobody single-molecule localization imaging probe. The method can be carried out in any suitable manner. For example, the chimeric nanobody according to the present invention can first be reacted with a linker to obtain a chimeric nanobody with a linker, and then the chimeric nanobody with a linker is reacted with a DNA sequence for DNA-PAINT imaging to obtain the chimeric nanobody single-molecule localization imaging probe according to the present invention; or the DNA sequence for DNA-PAINT imaging can first be reacted with a linker to obtain a DNA sequence with a linker, and then the DNA sequence with a linker is reacted with the chimeric nanobody according to the present invention to obtain the chimeric nanobody single-molecule localization imaging probe according to the present invention, or the chimeric nanobody according to the present invention and the DNA sequence for DNA-PAINT imaging can be reacted with a linker simultaneously to obtain the chimeric nanobody single-molecule localization imaging probe according to the present invention. Therefore, the linker has a first reactive group for reacting with the chimeric nanobody according to the present invention and a second reactive group for reacting with the DNA sequence for DNA-PAINT imaging. The first reactive group and the second reactive group can be designed and selected with reference to the reactive groups that the chimeric nanobody according to the present invention has or can form and the reactive groups that the DNA sequence for DNA-PAINT imaging has or can form.
[0048] In some embodiments, the first reactive group of the linker is a succinimidyl group, and the second reactive group is selected from the functional groups commonly used in click chemistry, such as an azide group, an alkyne group, a dibenzocyclooctyne (DBCO) group, a trans-cyclooctene (TCO) group, a tetrazine (Tz) group, a bicyclo[6,1,0]nonyne group, an N-hydroxysuccinimide (NHS) group, etc., but not limited thereto.
[0049] In a specific embodiment, the method includes the following steps:
[0050] S1: Reducing the above-mentioned chimeric nanobody to obtain a chimeric nanobody with a free thiol group;
[0051] S2: Reacting the chimeric nanobody obtained in S1 with a cross-linker shown in Formula II to obtain a chimeric nanobody linked with a cross-linker, wherein a specific reaction occurs between the thiol group on the chimeric nanobody and the maleimide group in the cross-linker to form an irreversible thioether bond:
[0052] R2-linker1-Mal
[0053] II
[0054] In Formula II, R2 represents a reactive group, such as an amino-reactive group or a click-chemistry reactive group;
[0055] Linker1 is defined as in Formula I above,
[0056] Mal represents
[0057] Step S3: React the reaction product of S2 with a nucleic acid sequence for DNA-PAINT imaging having a reactive group R3 of the following formula II to obtain a chimeric nanobody probe modified with DNA, that is, the above-mentioned chimeric nanobody single-molecule localization imaging probe.
[0058] R3-DNA
[0059] II
[0060] In Formula II, R3 represents a group that can react with the above-mentioned R2 to produce a linkage; the DNA sequence is selected from SEQ ID No:7 or SEQ ID No:8, wherein the nucleotides in the above-mentioned DNA sequence can be L-nucleotides or D-nucleotides.
[0061] In a specific embodiment, R2 is a dibenzocyclooctyne (DBCO) group, and R3 is an azide group; or R2 is a trans-cyclooctene (TCO) group, and R3 is a tetrazine (Tz) group; or R2 is an N-hydroxysuccinimide (NHS) group, and R3 is an amino group.
[0062] In a specific embodiment, the crosslinking agent used in S2 is DBCO-PEG4-Maleimide; the nucleic acid sequence for DNA-PAINT imaging used in S3 is SEQ ID No:7.
[0063] In a specific embodiment, the reaction in S2 can be as shown in the following Reaction Formula 1 or 2,
[0064] Reaction Formula 1:
[0065]
[0066] Reaction Formula 2:
[0067]
[0068] The reaction in S3 can be as shown in the following Reaction Formula 3 or 4. Reaction Formula 3:
[0069]
[0070] Reaction Formula 4:
[0071]
[0072] In each of the above reaction formulas, represents the chimeric nanobody part, represents the nucleic acid sequence part.
[0073] In a specific embodiment, the reducing agent used in S1 is selected from tris(2-carboxyethyl)phosphine hydrochloride (TCEP) solution.
[0074] In a specific embodiment, in S2, the molar ratio of the crosslinking agent to the reduced chimeric nanobody is about 5-20.
[0075] In a specific embodiment, in S3, the molar ratio of the nucleic acid sequence for DNA-PAINT imaging to the chimeric nanobody linked with the crosslinking agent is 3-10.
[0076] In a specific embodiment, the above preparation method may further include a purification step S4 to purify the chimeric nanobody probe modified with DNA in S3. In S4, the chimeric nanobody probe modified with DNA in S3 can be purified by using molecular sieve and ion exchange techniques.
[0077] In a specific embodiment, in S1-S3, the reaction temperature is 4°C; the reaction time of S1 is 0.5 h-2 h; the reaction time of S2 is 2 h-16 h; the reaction time of S3 is 1 h-16 h.
[0078] On the other hand, the present invention provides a kit, which includes: the above chimeric nanobody single molecule localization imaging probe, and a DNA imaging strand with a fluorescent dye.
[0079] In a specific embodiment, the DNA imaging strand refers to a DNA sequence with a fluorescent dye and a quenching group at both ends respectively, and its sequence can be SEQ ID No:10 or SEQ ID No:11; the fluorescent dye can be Cy3B, ATO643, and the quenching group can be BHQ2, BBQ650. The DNA imaging strand with a fluorescent dye can be customized by a primer synthesis company and can be synthesized from right-handed base raw materials or left-handed base raw materials.
[0080] In a specific embodiment, the sequence of the DNA imaging strand with a fluorescent dye is SEQ IDNo:10. This sequence is specially designed for the DNA-PAINT imaging method, that is, the imaging sequence and the docking sequence are not completely complementary paired, realizing the rapid binding and dissociation between sequences, achieving rapid reaction kinetics, which can effectively realize fast and low-background single molecule localization super-resolution imaging.
[0081] On yet another aspect, the present invention provides a method for DNA-PAINT super-resolution imaging, and the method includes the following steps:
[0082] S1’: Fix the biological sample containing green fluorescent protein;
[0083] S2’: Perform blocking and permeabilization treatment on the fixed biological sample of S1’;
[0084] S3’: Add the above-mentioned chimeric nanobody single-molecule localization imaging probe to incubate the biological sample of S2’;
[0085] S4’: Wash the biological sample of S3’ with PBS buffer; and
[0086] S5’: Add the above-mentioned DNA imaging strand with fluorescent dye to the biological sample of S4’ for single-molecule localization super-resolution imaging.
[0087] The labeling method of the present application is not restricted by cell lines. In theory, good labeling can be achieved for biological samples with green fluorescent protein tags. There is no restriction on the fixation method for different biological samples, and those skilled in the art can select the optimal structure fixation scheme for different biological samples. There is no restriction on the blocking and permeabilization treatment method for different biological samples, and those skilled in the art can select the optimal blocking and permeabilization treatment method for different biological samples.
[0088] In the specific embodiment, the biological sample is a cell, and the method is used for DNA-PAINT super-resolution imaging of intracellular organelles, and the organelles include: endoplasmic reticulum, nuclear pore complex, microtubule, Golgi apparatus, clathrin, and mitochondrion, etc.
[0089] The present invention can not only be used for the labeling imaging of conventional organelles expressing green fluorescent protein, but also for biological tissue samples with green fluorescent protein.
[0090] Beneficial effects
[0091] The present invention designs two single nanobodies into a novel chimeric nanobody through genetic recombination technology, effectively avoiding the problems of low affinity and multi-site labeling of single antibodies, and capable of achieving high-affinity labeling of 1:1. The gene sequence modified by the method of the present invention can obtain a chimeric nanobody corresponding to the molecular weight after induced expression. Further, a probe for DNA-PAINT super-resolution imaging can be obtained through site-specific and click chemistry modification methods, and high-quality images can be obtained for the imaging of various fine structures in cells. Description of the drawings
[0092] Figure 1 : Schematic diagram of the construction of the chimeric nanobody single-molecule localization imaging probe of the present invention and single-molecule localization super-resolution fluorescence imaging for quantitative analysis.
[0093] Figure 2 : Schematic diagram of site-specific modification of chimeric nanobodies.
[0094] Figure 3 : Chromatographic purification diagram of chimeric nanobody-modified DNA (size exclusion chromatography SEC and ion exchange chromatography IEX) and SDS-PAGE verification diagram.
[0095] Figure 4 : Schematic diagram of super-resolution imaging of endoplasmic reticulum of two different chimeric nanobodies.
[0096] Figure 5 : Super-resolution imaging diagram of different antibodies in labeling the nuclear pore complex structure. Detailed implementation manners
[0097] To better understand the present invention, the content of the present invention will be further clarified below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0098] Material information:
[0099]
[0100] DBCO-PEG4-Maleimide, dibenzocyclooctyne-tetraethylene glycol-maleimide, the structural formula is as follows:
[0101]
[0102] TCEP, the full name is Tris(2-carboxyethyl)phosphine, the structural formula is as follows: It is usually used in the form of hydrochloride.
[0103] TCO-PEG3-Maleimide, trans-cyclooctene-polyethylene glycol-maleimide, the structural formula is as follows:
[0104]
[0105] Single-molecule localization super-resolution imaging technology has problems with probe labeling size and labeling ratio when quantitatively analyzing the fine in-situ structure within cells. For the common fusion protein GFP, Ziyue Zhang et al. (Zhang, Z., Wang, Y., Ding, Y. et al. Structure-based engineering of anti-GFP nanobody tandems as ultra-high-affinity reagents for purification. Sci Rep 10, 6239 (2020). https: / / doi.org / 10.1038 / s41598-020-62606-7) disclosed that a novel chimeric nanobody (NbGFPe-LaG16) formed by linking two different nanobodies has high affinity and the characteristics of one-to-one labeling. However, this nanobody has not been implemented in the field of super-resolution imaging. Starting from the super-resolution imaging probe, the present invention designed and purified a brand-new chimeric nanobody such as NbGFP-36AAlinker-Nb2-Cys, which can be used for subsequent site-specific modification of the probe for super-resolution imaging, thereby realizing in-situ imaging analysis and quantitative analysis of the fine structure within cells. The chimeric nanobody (NbGFPe-Nb2) of the present application is substantially different from the reported antibody (NbGFPe-LaG16) in the literature in that it has a better imaging effect in the field of super-resolution imaging and has the characteristics of one-to-one labeling while showing better specificity.
[0106] Figure 1 The figure shows a schematic diagram of the construction of the chimeric nanobody single-molecule localization imaging probe of the present invention and the single-molecule localization super-resolution fluorescence imaging for quantitative analysis. As shown in the figure, the present application first constructed a chimeric nanobody, which includes the NbGFPe nanobody sequence, a linker with a length of 36 amino acids, the Nb2 nanobody sequence, and a C-terminal linker containing cysteine for site-specific modification. On this basis, the chimeric nanobody was connected with the nucleic acid sequence for DNA-PAINT imaging by click chemistry to form a chimeric nanobody single-molecule localization imaging probe. Then, the chimeric nanobody single-molecule localization imaging probe and the designed DNA imaging strand with a fluorescent dye were used for DNA-PAINT super-resolution imaging of different organelles within cells to quantitatively analyze the target.
[0107] Example 1: Design, expression, and purification of chimeric nanobody
[0108] In this embodiment, a target protein gene fragment was designed, and then the target gene fragment was constructed into the pET26b expression vector and transformed into Escherichia coli Rosetta(DE3) for induced protein expression, and the target protein was purified.
[0109] The specific operation steps are as follows:
[0110] Step 1: The nucleotide sequence information of two separate NbGFPe and Nb2 nanobodies is SEQ ID No:12 and 13 respectively;
[0111] NbGFPe: (SEQ ID No:12)
[0112] CAGGTCCAACTGGTTGAGTCTGGAGGGGCGTTGGTGCAGCCCGGTGGGAGCCTTCGTCTTTCCTGTGCGGCCAGTGGATTCCCTGTTAACCGTTATAGTATGCGTTGGTATCGTCAAGCTCCTGGCAAAGAGCGTGAATGGGTGGCCGGAATGTCATCGGCCGGCGATCGCAGTAGTTACGAAGATTCGGTTAAAGGCCGTTTCACCATTAGTCGTGACGACGCCCGTAACACGGTTTATCTGCAGATGAATAGTTTAAAACCTGAAGACACAGCAGTATATTATTGCAATGTAAACGTAGGATTCGAATATTGGGGTCAGGGTACACAGGTAACAGTGTCGTCA
[0113] Nb2: (SEQ ID No:13)
[0114] CAGGTTCAGTTGCAGGAATCGGGAGGTGGTAGTGTTCAGGCTGGCGGATCGCTGCGCCTTTCCTGCGCGGCCTCCGGGCCCACGTATAGTTCATATTTCATGGCATGGTTCCGTCAAGCCCCCGGTATGGAACGTGAAGGCGTGGCTGCAAGCAGTTACGACGGGAGCACGACATTGTATGCGGACTCAGTAAAGGGCCGCTTCACCATTAGTCAAGGTAATGCTAAGAACACAAAGTTCTTGTTGTTGAATAATCTTGAGCCCGAAGATACGGCGATCTACTATTGTGCTTTACGCCGTCGTGGCTGGTCAAATACGTCGGGCTGGAAACAGCCAGGTTGGTACGACTATTGGGGTCAAGGCACGCAAGTAACCGTCAGTTCT
[0115] Step 2: Design the nucleotide sequence of a 36 - amino - acid - length linker for connecting two nanobodies, namely 36AAlinker: SEQ ID No:14.
[0116] 36AAlinker: (SEQ ID No:14)
[0117] GGCGGTAGTGCTGCTTCCGGTGGAGCATCAGCTAGTGGAGGTACGGGCGGATCCGGAGGGACTTCGGCTTCCGGTGCTTCTGCCGGCGGATCCGGTGGAGCTGGTACT
[0118] The finally formed target nucleotide sequence is NbGFPe - 36linker - Nb2 - Cys (SEQ ID No:9).
[0119] CAGGTCCAACTGGTTGAGTCTGGAGGGGCGTTGGTGCAGCCCGGTGGGAGCCTTCGTCTTTCCTGTGCGGCCAGTGGATTCCCTGTTAACCGTTATAGTATGCGTTGGTATCGTCAAGCTCCTGGCAAAGAGCGTGAATGGGTGGCCGGAATGTCATCGGCCGGCGATCGCAGTAGTTACGAAGATTCGGTTAAAGGCCGTTTCACCATTAGTCGTGACGACGCCCGTAACACGGTTTATCTGCAGATGAATAGTTTAAAACCTGAAGACACAGCAGTATATTATTGCAATGTAAACGTAGGATTCGAATATTGGGGTCAGGGTACACAGGTAACAGTGTCGTCAGGCGGTAGTGCTGCTTCCGGTGGAGCATCAGCTAGTGGAGGTACGGGCGGATCCGGAGGGACTTCGGCTTCCGGTGCTTCTGCCGGCGGATCCGGTGGAGCTGGTACTCAGGTTCAGTTGCAGGAATCGGGAGGTGGTAGTGTTCAGGCTGGCGGATCGCTGCGCCTTTCCTGCGCGGCCTCCGGGCCCACGTATAGTTCATATTTCATGGCATGGTTCCGTCAAGCCCCCGGTATGGAACGTGAAGGCGTGGCTGCAAGCAGTTACGACGGGAGCACGACATTGTATGCGGACTCAGTAAAGGGCCGCTTCACCATTAGTCAAGGTAATGCTAAGAACACAAAGTTCTTGTTGTTGAATAATCTTGAGCCCGAAGATACGGCGATCTACTATTGTGCTTTACGCCGTCGTGGCTGGTCAAATACGTCGGGCTGGAAACAGCCAGGTTGGTACGACTATTGGGGTCAAGGCACGCAAGTAACCGTCAGTTCTAAGGATGACAAATCCTGCGGCAAAGACAAAGAT
[0120] The nucleotide sequences of the relevant antibodies used in the control experiment are as follows:
[0121] NbGFPe-Cys: (SEQ ID No:15)
[0122] CAGGTCCAACTGGTTGAGTCTGGAGGGGCGTTGGTGCAGCCCGGTGGGAGCCTTCGTCTTTCCTGTGCGGCCAGTGGATTCCCTGTTAACCGTTATAGTATGCGTTGGTATCGTCAAGCTCCTGGCAAAGAGCGTGAATGGGTGGCCGGAATGTCATCGGCCGGCGATCGCAGTAGTTACGAAGATTCGGTTAAAGGCCGTTTCACCATTAGTCGTGACGACGCCCGTAACACGGTTTATCTGCAGATGAATAGTTTAAAACCTGAAGACACAGCAGTATATTATTGCAATGTAAACGTAGGATTCGAATATTGGGGTCAGGGTACACAGGTAACAGTGTCGTCAAAGGATGACAAATCCTGCGGCAAAGACAAAGAT
[0123] Nb2-Cys: (SEQ ID No:16)
[0124] CAGGTTCAGTTGCAGGAATCGGGAGGTGGTAGTGTTCAGGCTGGCGGATCGCTGCGCCTTTCCTGCGCGGCCTCCGGGCCCACGTATAGTTCATATTTCATGGCATGGTTCCGTCAAGCCCCCGGTATGGAACGTGAAGGCGTGGCTGCAAGCAGTTACGACGGGAGCACGACATTGTATGCGGACTCAGTAAAGGGCCGCTTCACCATTAGTCAAGGTAATGCTAAGAACACAAAGTTCTTGTTGTTGAATAATCTTGAGCCCGAAGATACGGCGATCTACTATTGTGCTTTACGCCGTCGTGGCTGGTCAAATACGTCGGGCTGGAAACAGCCAGGTTGGTACGACTATTGGGGTCAAGGCACGCAAGTAACCGTCAGTTCTAAGGATGACAAATCCTGCGGCAAAGACAAAGAT
[0125] NbGFPe-36linker-LaG16-Cys: (SEQ ID No:17)
[0126] CAGGTCCAACTGGTTGAGTCTGGAGGGGCGTTGGTGCAGCCCGGTGGGAGCCTTCGTCTTTCCTGTGCGGCCAGTGGATTCCCTGTTAACCGTTATAGTATGCGTTGGTATCGTCAAGCTCCTGGCAAAGAGCGTGAATGGGTGGCCGGAATGTCATCGGCCGGCGATCGCAGTAGTTACGAAGATTCGGTTAAAGGCCGTTTCACCATTAGTCGTGACGACGCCCGTAACACGGTTTATCTGCAGATGAATAGTTTAAAACCTGAAGACACAGCAGTATATTATTGCAATGTAAACGTAGGATTCGAATATTGGGGTCAGGGTACACAGGTAACAGTGTCGTCAGGCGGTAGTGCTGCTTCCGGTGGAGCATCAGCTAGTGGAGGTACGGGCGGATCCGGAGGGACTTCGGCTTCCGGTGCTTCTGCCGGCGGATCCGGTGGAGCTGGTACTCAGGTGCAACTTGTTGAAAGTGGAGGGCGTCTTGTGCAAGCGGGTGATAGTTTACGTCTTAGTTGTGCCGCTAGCGGGCGCACATTCAGTACATCTGCTATGGCTTGGTTTCGTCAAGCACCAGGCCGTGAGCGCGAGTTCGTGGCGGCTATCACGTGGACTGTGGGTAATACTATCTTAGGAGACAGCGTTAAGGGCCGCTTCACCATCAGTCGTGACCGCGCCAAAAATACAGTAGATCTGCAGATGGACAATTTGGAGCCTGAGGATACAGCTGTATATTATTGTAGCGCACGTAGCCGTGGCTACGTTCTGTCTGTTCTGCGCTCTGTCGACTCTTATGATTATTGGGGTCAAGGCACGCAAGTGACTGTGTCTAGCAAGGATGACAAATCCTGCGGCAAAGACAAAGAT
[0127] Step 3: Construct the sequence obtained in Step 2 into the pET26b expression vector, then transform it into Escherichia coli Rosetta(DE3) for induced protein expression, and purify to obtain the target protein.
[0128] The specific operation process of construction-transformation-induction expression is as follows:
[0129] (1) After synthesizing the gene fragment, connect it to the pET26b expression vector. The resulting ligation product confers kanamycin resistance;
[0130] (2) Transform the ligation product into competent Escherichia coli DH5α cells and spread them on a solid LB plate with kanamycin resistance. Incubate the plate upside down in a 37°C incubator for 12 - 14 h;
[0131] (3) Pick single colonies on the solid LB plate and send them to a sequencing company for sequencing. After the sequencing results are obtained, compare them with the designed sequence to check if the sequencing results are correct;
[0132] (4) Transform the plasmid with correct sequencing into competent Escherichia coli Rosetta(DE3) cells and spread them on a solid LB plate with kanamycin resistance. Incubate the plate upside down in a 37°C incubator for 12 - 14 h;
[0133] (5) Pick single colonies on the plate from step (4) and inoculate them into 50 mL of LB liquid medium with kanamycin resistance. Incubate the medium in a 37°C constant temperature shaker at 220 rpm for 12 - 14 h,
[0134] (6) Transfer the bacterial medium from step (5) to 2 L of 2×YT (Formedium) liquid medium and shake culture for amplification. When the OD600 is about 0.8, wait for it to cool and add IPTG to a final concentration of 0.5 mM. Induce at 22°C and 220 rpm for 16 hours;
[0135] (7) Centrifuge at 8000 rpm for 20 minutes to collect the bacterial cells;
[0136] (8) Lyse the bacteria by osmotic shock to release the protein. Use the histidine tag technology and affinity chromatography purification method to achieve the preliminary purification of the chimeric nanobody;
[0137] (9) Further purify the antibody product obtained in step (8) using size exclusion chromatography technology;
[0138] Example 2: Site-specific modification of chimeric nanobody
[0139] As Figure 2 shown, perform site-specific modification on the chimeric nanobody obtained in Example 1 above.
[0140] The specific experimental process is as follows:
[0141] (1) Replace the chimeric nanobody obtained in Example 1 above with an ultrafiltration tube into a phosphate buffer containing a reducing agent (1×PBS + 1 mM EDTA + 3 mM TCEP), and react at 4 °C for 30 min;
[0142] (2) Replace the buffer of the reduced chimeric nanobody in step (1) with phosphate buffer PB with a pH of 6.8 (PB: 8.1 mM Na2HPO4, 1.5 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, pH = 6.8), then add the crosslinking reagent DBCO-PEG4-Maleimide, and react at 4 °C for 2 hours under the condition that the molar ratio of nanobody to crosslinker is 1:20;
[0143] (3) Use a 7K desalting column to remove the crosslinking agent in the above step (2), then replace the buffer with 1×PBS buffer with a pH of 7.4 using a 10K ultrafiltration tube, and finally react overnight at 4 °C under the condition that the molar ratio of chimeric nanobody to Azide-DNA (5'-3': CCTTCAACATATCCTCTAC-Azide, SEQ ID No: 7) is 1:10;
[0144] (4) Finally, use size exclusion chromatography SEC and ion exchange technology IEX to purify to obtain a high-purity chimeric nanobody probe modified with DNA. Then use SDS-PAGE electrophoresis technology to verify that the purified peak is indeed the target product. The detailed characterization results are shown in Figure 3 . The detailed analysis is as follows: The reaction mixture (MIX) corresponds to lane A before purification. After purification by size exclusion chromatography SEC, two peaks appear. The first peak (P3, P4, P5 in the SEC diagram) corresponds to lanes B, C, and D in SDS-PAGE. The second peak (P7 in the SEC diagram) corresponds to lane E. There is no band in lane E but there is a high-intensity signal value in the size exclusion chromatography map. The results fully show that: during the SEC purification process, a large amount of unreacted DNA was removed, but the bands B, C, and D corresponding to the first peak show a high proportion of chimeric nanobodies that were not successfully modified with DNA. Therefore, further purification was carried out using ion exchange technology IEX. Lane G is the unmodified chimeric nanobody as a control. Lane H is a diluted sample of the first peak in the previous step of SEC (making the impurity proteins less obvious). The first peak of IEX (4 in the IEX diagram) corresponds to lane I, and the second peak (14 and 15 in the IEX diagram) corresponds to lanes J and K. The bands J and K show that the collected product contains a high proportion of chimeric nanobodies modified with DNA, indicating that the further purification effect is obvious.
[0145] Example 3: Single-molecule localization super-resolution imaging
[0146] The chimeric nanobody probe obtained in Example 2 above was applied to the labeling of various intracellular organelles. Next, the labeling of the endoplasmic reticulum and nuclear pore complex will be elaborated in detail as examples respectively.
[0147] (1) Endoplasmic reticulum labeling
[0148] The cultured COS-7 cells were seeded onto cell slides. When the density reached about 70%, the plasmid mEmerald-sec61b was transfected into the cells by transient transfection. The cells overexpressed the green fluorescent protein tag mEmerald that could bind to the purified nanobody, and the transfection efficiency was about 70%. Then the cells were fixed with a mixed fixative of 3% paraformaldehyde (PFA) and 0.1% glutaraldehyde (GA) at working concentration for 15 min. After removing the fixative, the cells were washed three times with 1×PBS buffer, and then blocked and permeabilized at room temperature for 1 hour. Finally, the chimeric nanobody probe in Example 2 was added to the cells and incubated overnight at 4°C. After washing three times with 1×PBS buffer, the DNA imaging strand PS1 (Cy3B-AGAAGTAATGTGGAA-BHQ2, SEQ ID No: 10) with a fluorescent dye was added for single-molecule localization super-resolution imaging.
[0149] Based on the above steps, the super-resolution imaging of the endoplasmic reticulum of NbGFPe-LaG16-Cys-DNA was obtained by single-molecule localization super-resolution imaging.
[0150] The results are as Figure 4 , By comparing the super-resolution imaging maps of the endoplasmic reticulum of the two chimeric nanobodies, it was found that the effect of the NbGFPe-Nb2-Cys-DNA probe was significantly better than that of NbGFPe-LaG16-Cys-DNA.
[0151] (2) Nuclear pore complex labeling
[0152] The cultured U-2OS Nup96-mEGFP cells were seeded onto cell slides. After 48 hours, they were fixed with pre-warmed 2.4% PFA solution for 30 min. After removing the fixative, the cells were washed three times with 1×PBS buffer, and then treated with a blocking and permeabilizing reagent (3% BSA@0.25% Triton X-100@1×PBS) at room temperature for 2 hours. Finally, the chimeric nanobody probe in Example 2 was added to the cells and incubated overnight at 4°C. After washing three times with 1×PBS buffer, the DNA imaging strand PS1 with a fluorescent dye was added for single-molecule localization super-resolution imaging.
[0153] Single-molecule localization super-resolution imaging was performed using NbGFPe-Cys-DNA, Nb2-Cys-DNA, and the combination of two single nanobodies (NbGFPe-Cys-DNA+Nb2-Cys-DNA) based on the above steps.
[0154] The results are as Figure 5 shown. By comparing the super-resolution imaging maps of single nanobodies and chimeric nanobodies, it was found that the chimeric nanobody NbGFPe-Nb2-Cys-DNA probe had significantly better performance than NbGFPe-Cys-DNA and Nb2-Cys-DNA, and also better than the combination of two single nanobodies (NbGFPe-Cys-DNA+Nb2-Cys-DNA).
Claims
1. A chimeric nanobody comprising the following sequences from N-terminus to C-terminus: NbGFPe nanobody sequence; 36 amino acid linker; Nb2 nanobody sequence; and A C-terminal linker containing cysteine, Furthermore, the amino acid sequence of the chimeric nanobody is SEQ ID No:
6.
2. A recombinant protein, which consists of the chimeric Nanobody as claimed in claim 1; and optionally a tag sequence that assists expression and / or purification.
3. A polynucleotide encoding the chimeric Nanobody as claimed in claim 1 or the recombinant protein as claimed in claim 2. The polynucleotide according to claim 3 , whose nucleotide sequence is SEQ ID No:
9. A recombinant expression vector comprising the polynucleotide according to claim 3 or 4.
6. A transformant comprising the polynucleotide according to claim 3 or 4 or the recombinant expression vector according to claim 5.
7. A chimeric nanobody single-molecule localization imaging probe, comprising: The chimeric Nanobody according to claim 1; A DNA sequence for DNA-PAINT imaging, whose nucleotide sequence is SEQ ID No: 7 or SEQ ID No: 8; and A linking group for connecting the chimeric nanobody and the DNA sequence for DNA-PAINT imaging.
8. The chimeric nanobody single-molecule localization imaging probe according to claim 7 has the structure shown below: In the above structures, represents the chimeric nanobody part, Represents a DNA sequence portion.
9. The method for preparing the chimeric nanobody single-molecule localization imaging probe according to claim 7, comprising: First, the chimeric Nanobody as claimed in claim 1 is reacted with a linker to obtain a chimeric Nanobody with a linker, and then the chimeric Nanobody with a linker is reacted with a DNA sequence for DNA-PAINT imaging; or First, the DNA sequence for DNA-PAINT imaging is reacted with a linker to obtain a DNA sequence with a linker, and then the DNA sequence with the linker is reacted with the chimeric Nanobody as claimed in claim 1, or The chimeric nanobody as claimed in claim 1 and the DNA sequence for DNA-PAINT imaging are reacted with a linker at the same time, Wherein, the linker carries a first reactive group for reacting with the chimeric nanobody, and a second reactive group for reacting with a DNA sequence for DNA-PAINT imaging.
10. The method according to claim 9, wherein: The first reactive group of the linker is a succinimide group, and the second reactive group is selected from an azide group, an alkynyl group, a dibenzocyclooctyne (DBCO) group, a trans-cyclooctene (TCO) group, a tetrazine (Tz) group, a bicyclo[6,1,0]nonynyl group, and an N-hydroxysuccinimide (NHS) group.
11. A kit comprising: the chimeric nanobody single-molecule localization imaging probe according to claim 7 or 8, and a DNA imaging strand with a fluorescent dye, wherein: The DNA imaging strand is a DNA sequence with a fluorescent dye and a quenching group at both ends, and its sequence is SEQ ID No: 10 or SEQ ID No: 11; the fluorescent dye is Cy3B or ATO643, and the quenching group is BHQ2 or BBQ650.
12. A method for performing DNA-PAINT super-resolution imaging, the method comprising the following steps: S1': fixed biological sample containing green fluorescent protein; S2': Block and permeabilize the fixed biological sample of S1'; S3': adding the chimeric nanobody single-molecule localization imaging probe in the kit as claimed in claim 11 to incubate the biological sample of S2'; S4': washing the biological sample of S3' with PBS buffer; and S5': Add the DNA imaging strand with fluorescent dye in the kit as claimed in claim 11 to the biological sample of S4' to perform single-molecule localization super-resolution imaging.
13. The method according to claim 12, wherein: The biological sample is a cell, and the method is used to perform DNA-PAINT super-resolution imaging on organelles in the cell, wherein the organelles include endoplasmic reticulum, nuclear pore complex, microtubule, Golgi, clathrin and mitochondria.
Citation Information
Patent Citations
Detection system
CN108732359A
Anti-HET-2 heavy chain antibody and application thereof
CN109627319A