Lactobacillus reuteri derived from non-human primates and its application

By isolating the Lactobacillus reuteri MacFasB02 strain from primates, the problem of poor adaptability of probiotic strains between different host animals was solved, and multiple probiotic effects in the field of human health were achieved, including lowering blood lipids, controlling weight, protecting the liver and alleviating arthritis, with significant application prospects.

CN119020230BActive Publication Date: 2025-09-16INST OF ZOOLOGY GUANGDONG ACAD OF SCI +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411412756.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-11
Publication Date
2025-09-16
Estimated Expiration
2044-10-11

AI Technical Summary

Technical Problem

Existing probiotic strains derived from different host animals have poor intestinal adaptability, resulting in inconsistent application effects in animal production. There are also no reports on the isolation of Lactobacillus reuteri from non-human primates, which affects their application in improving human health.

Method used

The Lactobacillus reuteri MacFasB02 strain was isolated from primates and has been shown to be able to lower low-density lipoprotein cholesterol and triglyceride levels, inhibit weight gain, protect the liver and relieve rheumatoid arthritis inflammation without changing diet or exercise. It has extremely strong acid and bile salt resistance and is suitable for colonization in the gastrointestinal tract of primates.

Benefits of technology

The Lactobacillus reuteri MacFasB02 strain significantly lowers blood lipid levels, inhibits weight gain, has good liver protection effects, and can relieve rheumatoid arthritis inflammation and improve motor dysfunction. It is suitable for the preparation of products that lower blood lipids, control weight gain, protect the liver and relieve arthritis, and has important application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119020230B_ABST
    Figure CN119020230B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of probiotics and their application technology, and in particular to a kind of Lactobacillus reuteri derived from non-human primates and its application. The present invention isolates a new Lactobacillus reuteri (Limosilactobacillus reuteri) MacFasB02 strain from the feces of crab-eating macaques that tolerate a high-fat diet. The strain can significantly reduce the LDL-C and TG levels caused by a high-fat diet, and can be used to reduce the host's blood lipid levels; it has a good liver-protecting effect; it can effectively inhibit the weight gain caused by a high-fat diet; it can effectively alleviate rheumatoid arthritis inflammation. At the same time, the strain also has extremely strong acid resistance and bile salt resistance, is suitable for colonization in the gastrointestinal tract of primates, has a natural advantage for improving human health, and has important application value in multiple fields such as lowering blood lipids, inhibiting weight gain, protecting the liver, and treating rheumatoid arthritis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of probiotics and their applications, and particularly relates to Lactobacillus reuteri derived from non-human primates and applications thereof. Background Art

[0002] Probiotics, with their health benefits, are increasingly attracting the attention of researchers and industry. They beneficially impact the health of host animals by improving their intestinal microbiome. Numerous beneficial probiotic strains have been successfully developed and validated, finding widespread application in health foods, pharmaceuticals, and the dairy industry. Among them, Lactobacillus reuteri is widely found in nature and can be isolated from the intestines of vertebrates and mammals. Lactobacillus reuteri has strong adhesion to the intestinal mucosa, improving the distribution of intestinal flora, antagonizing the colonization of harmful bacteria, and preventing intestinal diseases. Lactobacillus reuteri also produces a non-proteinaceous, broad-spectrum antimicrobial substance called reuterin, which inhibits the growth of a wide range of Gram-positive and Gram-negative bacteria, yeasts, fungi, and pathogens. Lactobacillus reuteri is a Campylobacter with a slightly irregular shape and rounded ends. It is an obligate heterofermenter that ferments sugars to produce CO2, lactic acid, acetic acid, and ethanol.

[0003] Studies have shown that different strains of Lactobacillus reuteri have different physiological effects. For example, Limosilactobacillus reuteri DSMZ 17648 can be used to treat Helicobacter pylori (H. pylori), and Limosilactobacillus reuteri NCIMB 30242 can be used to treat high cholesterol. At the same time, the functional effects of strains from different host sources vary significantly. Lactobacillus reuteri has multiple effects, but the results of its application in actual animal production are not consistent. Due to the different intestinal environments of different animals, probiotics from different host sources also have different adaptability to the animal intestine, affecting their colonization and function. Probiotics derived from the intestines of the same animal can overcome adverse factors in the digestive tract and the adverse effects of other microbial communities, quickly colonize, and thus quickly take effect. Therefore, the advantageous characteristics of homologous probiotics have been highly valued.

[0004] Non-human primates share significant genetic similarity with humans, with gene sequence homology reaching 93-97.5%. Their intestinal morphology, metabolic mechanisms, and physiological functions are highly similar to those of humans. However, the successful isolation of Lactobacillus reuteri from non-human primates has yet to be reported. Therefore, exploring Lactobacillus reuteri from non-human primates for treating diseases and improving human health would enhance practical applications and fill gaps in relevant fields. It would also play a crucial role in enriching the existing probiotic market and improving the quality and efficacy of existing probiotic products. Summary of the Invention

[0005] In order to overcome the shortcomings of the above-mentioned existing technologies, the present invention isolates a Lactobacillus reuteri (Limosilactobacillus reuteri) MacFasB02 strain from primates. This strain can lower low-density lipoprotein cholesterol (LDL-C) levels and triglyceride (TG) levels, inhibit weight gain, protect the liver, and has the effects of alleviating rheumatoid arthritis inflammation and improving motor dysfunction. It has important potential application value in the field of human disease treatment.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] The first aspect of the present invention provides a Lactobacillus reuteri (Limosilactobacillus reuteri) MacFasB02 strain, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on July 29, 2024, with the deposit number: GDMCC No: 64918; the 16S rDNA sequence of the Lactobacillus reuteri MacFasB02 strain is shown in SEQ ID No: 1.

[0008] The second aspect of the present invention provides use of the Lactobacillus reuteri MacFasB02 strain described in the first aspect in the preparation of a lipid-lowering product.

[0009] Preferably, the lipid-lowering product is a product that lowers LDL-C and TG levels.

[0010] The present invention has found through research that the Lactobacillus reuteri MacFasB02 strain can lower blood lipid levels (including lowering serum LDL-C and TG levels), and is expected to be used to improve hyperlipidemia and its induced related diseases, such as diabetes.

[0011] The third aspect of the present invention provides use of the Lactobacillus reuteri MacFasB02 strain described in the first aspect in the preparation of a product for inhibiting weight gain.

[0012] Unlike typical weight loss strategies, which involve changing diet or increasing exercise, the Lactobacillus reuteri MacFasB02 strain did not reduce the weight of mice, but it did slow weight gain and reduce the rate of weight gain without changing diet or increasing exercise. In today's prevalent high-fat diet, this approach has significant application value in inhibiting / preventing excessive weight gain and lowering blood lipid levels in a high-fat environment.

[0013] The fourth aspect of the present invention provides use of the Lactobacillus reuteri MacFasB02 strain described in the first aspect in the preparation of a liver protection product.

[0014] Preferably, the liver protection product is a product that improves liver lesions and fat accumulation caused by a high-fat diet.

[0015] The present invention has found through research that the Lactobacillus reuteri MacFasB02 strain can alleviate liver cell degeneration caused by a high-fat diet, reduce liver cell vacuolation, shrink the spaces between liver cells, and alleviate lipid accumulation in the liver, thus having a good liver-protecting effect.

[0016] The fifth aspect of the present invention provides use of the Lactobacillus reuteri MacFasB02 strain described in the first aspect in preparing a product for alleviating rheumatoid arthritis inflammation.

[0017] Rheumatoid arthritis (RA) is a chronic systemic disease characterized by synovitis. Excessive synovial proliferation and recurrent, intense inflammation lead to the destruction of articular cartilage and bone, causing joint fibrosis, joint dysfunction, and ultimately disability. Research has found that the Lactobacillus reuteri MacFasB02 strain can alleviate the symptoms of collagen-induced RA and reduce serum TNF-α and IL-6 levels, demonstrating a therapeutic effect on RA, offering a new and safe treatment option for the disease.

[0018] Preferably, the type of product comprises a pharmaceutical product.

[0019] The sixth aspect of the present invention further provides a probiotic preparation, wherein the probiotic preparation uses the Lactobacillus reuteri MacFasB02 strain described in the first aspect as a main active ingredient.

[0020] Preferably, the probiotic preparation further comprises a pharmaceutically acceptable excipient.

[0021] More preferably, the excipients include diluents, binders, wetting agents, disintegrants, lubricants, glidants, etc. known in the art. Diluents include, but are not limited to, starch, dextrin, sucrose, glucose, lactose, mannitol, sorbitol, xylitol, calcium hydrogen phosphate, etc.; wetting agents include, but are not limited to, water, ethanol, isopropyl alcohol, etc.; binders include, but are not limited to, starch slurry, dextrin, syrup, honey, glucose solution, acacia gum slurry, gelatin slurry, sodium carboxymethyl cellulose, hydroxypropyl methylcellulose, ethyl cellulose, polyethylene glycol, etc.; disintegrants include, but are not limited to, dry starch, microcrystalline cellulose, low-substituted hydroxypropyl cellulose, polyvinyl pyrrolidone, cross-linked sodium carboxymethyl cellulose, sodium carboxymethyl starch, sodium lauryl sulfate, etc.; lubricants and glidants include, but are not limited to, talc, silicon dioxide, polyethylene glycol, etc.

[0022] Preferably, the probiotic preparation has a dosage form including injection, tablet, powder, granule, capsule, pill, enteric-coated capsule, etc. The preparation can be used in a manner including but not limited to oral administration.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention discloses a strain of Lactobacillus reuteri MacFasB02 derived from non-human primates. The strain is isolated from the feces of crab-eating macaques that tolerate a high-fat diet. The strain has multiple prebiotic effects, including significantly reducing the levels of low-density lipoprotein cholesterol (LDL-C) and triglycerides (TG) caused by a high-fat diet, and has a good lipid-lowering effect; it has a good liver-protecting effect; it can effectively inhibit weight gain caused by a high-fat diet without changing the food intake; it can effectively relieve the inflammation of rheumatoid arthritis and improve motor dysfunction. At the same time, the strain also has extremely strong acid and bile salt resistance, and is suitable for colonization in the gastrointestinal tract of primates. Since primates are highly similar to humans in terms of intestinal morphology, metabolic mechanism and physiological function, this strain has a natural advantage in improving human health and is conducive to obtaining practical and effective application effects. Therefore, the Lactobacillus reuteri MacFasB02 strain has important application value in many fields such as lowering blood lipids, controlling weight gain, protecting the liver, alleviating rheumatoid arthritis inflammation and improving motor dysfunction.

[0025] In addition, compared with existing similar products, this strain is the only Lactobacillus reuteri derived from non-human primates and resistant to high-fat environments. It has strong adaptability to the gastrointestinal tract of primates (including humans), has a wide range of indications and significant effects, and has market prospects for development into live biopharmaceuticals (LBP) or probiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The colony morphology of Limosilactobacillus reuteri MacFasB02 strain is shown;

[0027] Figure 2 Gram staining results of Limosilactobacillus reuteri MacFasB02 strain;

[0028] Figure 3 This is the phylogenetic tree of Limosilactobacillus reuteri MacFasB02 strain;

[0029] Figure 4 These are the blood lipid results of mice fed a high-fat diet and a maintenance diet for 10 weeks;

[0030] Figure 5 The blood lipid results of mice after 13 weeks of intervention with Limosilactobacillus reuteri MacFasB02 strain;

[0031] Figure 6 The curve of body weight changes, growth rate and daily food intake of mice during the intervention period of Limosilactobacillus reuteri MacFasB02 strain;

[0032] Figure 7 The results of H&E and Oil Red O staining of the liver of hyperlipidemic mice treated with Limosilactobacillus reuteri MacFasB02 for 13 weeks (scale bar: 100 μm);

[0033] Figure 8 The swelling and pathological conditions of the rat's feet;

[0034] Figure 9 is the change in foot volume of rats before and after intervention;

[0035] Figure 10 Changes in rat gait before and after intervention

[0036] Figure 11The changes of TNF-α and IL-6 levels in the serum of rats before and after intervention;

[0037] Figure 12 is the growth curve of Limosilactobacillus reuteri MacFasB02 strain;

[0038] Figure 13 This is the acid and bile salt resistance test of Limosilactobacillus reuteri MacFasB02 strain (the left picture shows different bile salt concentration environments, and the right picture shows different pH environments). DETAILED DESCRIPTION

[0039] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0040] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0041] Example 1: Isolation and Identification of Lactobacillus reuteri MacFasB02 Strain

[0042] The Lactobacillus reuteri (L. reuteri) MacFasB02 strain was isolated from the feces of a cynomolgus monkey that tolerated a high-fat diet. The isolation and identification steps and results are as follows:

[0043] Fecal samples were collected from 6-year-old cynomolgus monkeys that tolerated a high-fat diet and were housed at the Institute of Zoology, Guangdong Academy of Sciences. The samples were placed in a 50 mL sterile centrifuge tube. Sterile PBS (9 mL sterile PBS per gram of feces) was added to the tube in a clean bench and mixed on a vortex. After mixing, the tube was allowed to stand for 10 minutes, the supernatant was separated, and diluted 10 6 -10 8 After the elution is doubled, 100 μL is spread on an MRS agar plate and cultured at 38°C for 18-24 hours. Single colonies on the plate are picked and inoculated on an MRS plate using the plate streak method for purification. After observing the purified colonies, the milky white, round, neatly edged, smooth-surfaced colonies with a white papilla in the middle of the top are selected. Figure 1), inoculated them into MRS liquid culture medium and numbered them. After culturing for 18-24 hours, a small amount of bacterial liquid was taken for Gram staining. The bacterial morphology was observed under an optical microscope, and the blue-purple short rod-shaped strains ( Figure 2 ) for 16s rDNA sequencing.

[0044] 16s rDNA sequencing was performed using universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT) and was completed by Beijing Qingke Biotechnology Co., Ltd. using Sanger sequencing. The 16s rDNA sequences of each strain were BLAST-compared in the Genome database of NCBI. The MacFasB02 strain (its sequence is shown in SEQ ID No: 1) had an E value of 0 compared with several other L. reuteri strains known to NCBI, and the identities were all greater than 99%. After constructing a phylogenetic tree, it was found that ( Figure 3 ), the MacFasB02 strain is indeed a different strain of Lactobacillus reuteri of the same species.

[0045] At present, the L. reuteri MacFasB02 strain has been deposited in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC) on July 29, 2024, with the deposit number GDMCC No: 64918, and the deposit address is No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province.

[0046] Limosilactobacillus reuteri MacFasB0216s rDNA sequence (2541bp, SEQ IDNo: 1):

[0047]

[0048] Example 2 Function and Application of Lactobacillus reuteri MacFasB02 Strain

[0049] (1) Limosilactobacillus reuteri MacFasB02 strain can lower serum cholesterol levels

[0050] Twenty-one 7-week-old C57BL / 6J male mice were purchased from Hunan Slake Jingda Experimental Animal Co., Ltd. and housed in the SPF barrier facility of the Institute of Animals of Guangdong Academy of Sciences (License Number for the Use of Experimental Animals: SYXK (Yue) 2023-0329). Animal adaptation training was performed one week before the start of the experiment, and the mice were guaranteed free access to food throughout the entire process. Three mice were then randomly selected to be fed with conventional maintenance feed (purchased from Guangdong Medical Experimental Animal Center, the formula is shown in Table 1), and the remaining 18 mice were fed with high-fat feed (purchased from Keao Xieli (Tianjin) Feed Co., Ltd., the formula is shown in Table 2) to induce hyperlipidemia in mice. When the animals were raised for 10 weeks, three mice induced with high-fat feed and mice fed with maintenance feed were randomly selected, and the mouse serum was separated after orbital blood sampling. Guangdong Lane Pharmaceutical Research Institute Co., Ltd. was commissioned to test TC, TG, LDL-C, and HDL-C indicators. The results showed that after 10 weeks of feeding, the serum TC and LDL-C levels of mice induced with high-fat feed were significantly higher than those of mice fed with maintenance feed (P<0.05, Figure 4 ), indicating that the hyperlipidemia mouse model was successfully established.

[0051] After the model was successfully established, compound antibiotics (ampicillin 1g / L, gentamicin 500mg / L, neomycin 1g / L, penicillin 100U / L) were added to the drinking water of all mice, and vancomycin (1mg / mL) and metronidazole (0.5mg / mL) were given by gavage alternately every other day. The antibiotic treatment lasted for 1 week. Afterwards, the water containing compound antibiotics was replaced with normal drinking water, and the remaining 15 mice were divided into two groups, including 8 mice in the high-fat diet + PBS group (referred to as HLP+PBS) and 7 mice in the high-fat diet + L.reuteriMacFasB02 group (referred to as HLP+Lr). The mice were gavaged once a day for 13 consecutive weeks and continued to be fed with high-fat feed. Among them, the HLP+PBS group was gavaged with sterile PBS, and the HLP+Lr group was gavaged with 1×10 10CFU / mL L. reuteri MacFasB02 in PBS solution. At 13 weeks after oral gavage, blood was collected from all mice and serum was separated to measure TC, TG, LDL-C, and HDL-C. The above results show that feeding L. reuteri MacFasB02 significantly reduced the levels of LDL-C and TG in the serum of mice fed a high-fat diet (P<0.05, Figure 5 ), and has a tendency to reduce TC, and is expected to be used in the preparation of probiotic preparations for lowering blood lipids.

[0052] Table 1 Maintaining feed composition indicators (GB 14924.3-2010)

[0053]

[0054] Table 2 High-fat feed ratio (100kg per portion)

[0055]

[0056] (2) Limosilactobacillus reuteri MacFasB02 strain can inhibit weight gain in mice

[0057] During the intervention period using L. reuteri MacFasB02 in part (1), the body weight of mice and the high-fat diet intake of each cage of mice were measured weekly (once a week). The results showed that there was no significant difference in the average daily food intake of mice in the HLP+PBS and HLP+Lr groups, and there was no significant difference in the body weight of mice in the same group during the intervention period. However, there was a significant difference in the increase in body weight between the two groups before and after the intervention (P<0.05, Figure 6 The above results indicate that, under the same food intake conditions, the L. reuteri MacFasB02 strain can inhibit the weight gain of mice by regulating their metabolism and reduce the extent of their weight gain.

[0058] (3) Limosilactobacillus reuteri MacFasB02 has a liver-protective effect

[0059] In the experiment using L. reuteri MacFasB02 strain for intervention in part (1), the livers of mice gavaged for 13 weeks were collected from the HLP+PBS and HLP+Lr groups, fixed with 4% paraformaldehyde, and commissioned to Wuhan Sevier Biotechnology Co., Ltd. for frozen sectioning, H&E and Oil Red O staining. The staining results showed that the L. reuteri MacFasB02 strain could significantly improve the liver lesions and fat accumulation caused by a high-fat diet in mice. Among them, the H&E staining results showed that the L. reuteri MacFasB02 strain could alleviate the degeneration of mouse liver cells, reduce hepatocyte vacuolation, and reduce the gaps between liver cells. The Oil Red O staining results showed that the L. reuteri MacFasB02 strain could alleviate the lipid accumulation in the liver ( Figure 7 ).

[0060] (4) Lactobacillus reuteri MacFasB02 can alleviate rheumatoid arthritis inflammation. Six 7-week-old SD male rats were purchased from Hunan Slake Jingda Experimental Animal Co., Ltd. and divided into a normal group (Nomal group) and a treatment group (Treatment group). All experimental animals were acclimated to feeding for one week before the experiment began. Free access to food was guaranteed throughout the feeding process. The Treatment group was then modeled. The modeling period was 2 weeks, the antibiotic treatment period was 1 week, and the intervention period was 10 weeks.

[0061] At the beginning of the experiment, a primary immunization was performed. Equal amounts of bovine type II collagen and complete Freund's adjuvant were mixed and emulsified using a vortexer, maintaining low temperature during the emulsification process, to prepare a type II collagen emulsion. This emulsion was injected intradermally at the base of the rat's tail at multiple points (0.2 mL / rat). One week after the primary immunization, a booster immunization was performed. A type II collagen emulsion prepared using the same method was then injected intradermally at the base of the rat's tail (0.1 mL / rat).

[0062] After the model was successfully established, antibiotics (ampicillin 1g / L, gentamicin 500mg / L, neomycin 1g / L, penicillin 100U / L) were added to the drinking water of all rats, and vancomycin (1mg / mL) and metronidazole (0.5mg / mL) were given by gavage alternately every other day for 1 week. After that, the water containing antibiotics was replaced with normal drinking water, and the rats in the Treatment group were given a 1×10 10 Rats in the normal group were gavaged with PBS solution containing CFU / mL L. reuteri MacFasB02, while rats in the normal group were gavaged with sterile PBS at a volume of 0.5 mL / rat / day for 10 weeks.

[0063] After 10 weeks of intervention, the swelling of the ankle joints of the rats in the Treatment group was alleviated, and the degree of finger joint lesions was reduced ( Figure 8 In addition, the volume of the left and right feet of rats in the Treatment group was significantly reduced ( Figure 9 ), motor function was significantly improved throughout the walking cycle, and gait was basically restored to normal ( Figure 10 The red dotted box indicates the gait of the left hind limb of rats in the normal period, RA period and after intervention). The levels of TNF-α and IL-6 in serum were significantly reduced ( Figure 11 The above experimental results show that the Lactobacillus reuteri MacFasB02 strain has the effect of alleviating rheumatoid arthritis inflammation.

[0064] Example 3 Acid and bile resistance properties of Lactobacillus reuteri MacFasB02 strain

[0065] According to the volume ratio of 1%, 1×10 8 After CFU / mL L. reuteri MacFasB02 was inoculated into MRS medium, the OD of the medium was detected every 2 h for 24 h. 600 Absorbance and pH value of the culture medium. The results showed that L. reuteri MacFasB02 reached a stable growth phase at 6-8 hours, and the suspended bacterial density reached its highest value; L. reuteri MacFasB02 produced acid during growth, which caused the pH value of the MRS culture medium to drop to around 4.3 at 6-8 hours, which was consistent with the time when the growth curve reached a stable growth phase ( Figure 12 ); In addition, the survival rate of L. reuteri MacFasB02 was 72.5±7.86% in the environment of pH=3.0, and the survival rate was 148.09±19.13% in the environment of bile salt concentration of 0.5% ( Figure 13 ), which has strong acid and bile salt resistance and has the potential to colonize in the human intestine.

[0066] In summary, the Lactobacillus reuteri MacFasB02 strain newly isolated from primates for the first time in the present invention has multiple functions, including lowering blood lipid levels (LDL-C and TG), inhibiting weight gain, protecting the liver, alleviating rheumatoid arthritis inflammation, and improving motor dysfunction. This shows that this strain has important application prospects in the fields of disease treatment and is expected to be made into living biological drugs (LPBs) or probiotic preparations to exert its effects.

[0067] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. It is apparent to those skilled in the art that various changes, modifications, substitutions, and variations of these embodiments may be made without departing from the principles and spirit of the present invention, and the changes still fall within the scope of protection of the present invention.

Claims

1. A strain of Lactobacillus reuteri ( Limosilactobacillus reuteri ) MacFasB02 strain, characterized in that The Lactobacillus reuteri MacFasB02 strain was deposited in the Guangdong Provincial Microbial Culture Collection Center on July 29, 2024, with the deposit number: GDMCC No: 64918; the 16S rDNA sequence of the Lactobacillus reuteri MacFasB02 strain is shown in SEQ ID No:

1.

2. Lactobacillus reuteri according to claim 1 ( Limosilactobacillus reuteri ) The use of MacFasB02 strain in the preparation of lipid-lowering drugs, characterized in that: The lipid-lowering drug is a drug that lowers low-density lipoprotein cholesterol and triglyceride levels.

3. Lactobacillus reuteri according to claim 1 ( Limosilactobacillus reuteri ) Use of the MacFasB02 strain in the preparation of a drug for inhibiting weight gain, characterized in that: The inhibition of body weight gain is to inhibit body weight gain without changing food intake.

4. Lactobacillus reuteri according to claim 1 ( Limosilactobacillus reuteri ) Application of MacFasB02 strain in the preparation of liver protection drugs, characterized in that, The liver protection drug is a drug that improves liver lesions and fat accumulation caused by a high-fat diet.

5. Lactobacillus reuteri according to claim 1 ( Limosilactobacillus reuteri ) Application of MacFasB02 strain in the preparation of medicines for relieving rheumatoid arthritis inflammation.

6. The use according to any one of claims 2 to 5, characterized in that: The medicine also includes pharmaceutically acceptable excipients.

Citation Information

Patent Citations

  • Improvements relating to electric terminal sockets

    GB550056A

  • Lactobacillus reuteri and application thereof

    CN105062933A

  • Application of breast milk-derived lactobacillus reuteri in reducing fat and regulating fat metabolism rhythm

    CN110205261A

  • Lactobacillus reuteri composition capable of relieving rheumatoid arthritis

    CN110613738A