A plant gene editing method for insufficient editing of target genes

Abstract

The present invention discloses a plant gene editing method for insufficiently editing a target gene, and belongs to the field of plant genetic engineering. The present invention provides a method for plant gene editing, which can achieve insufficient editing of the plant genome by using a promoter that functions after the callus enters the differentiation period to drive the expression of a gene editing functional element, thereby being able to be used to create a heterozygous mutant in the plant. The present invention also provides a promoter sequence for incomplete editing of the plant genome, a nucleic acid protein composition, and a method for creating a plant heterozygous mutant.

Description

Technical Field

[0001] The invention discloses a plant gene editing method for insufficiently editing a target gene, and belongs to the field of plant gene engineering. Background Art

[0002] The functional study of each gene in a plant body is not only of great guiding significance for basic research in botany, but also of great practical application value for genetic breeding. Collecting or creating some mutant materials (such as natural mutations or artificial mutagenesis) is an important means to study gene functions. However, since some genes are extremely important for the growth and development of organisms, mutations will cause mutant plants to fail to develop (such as failure to germinate, differentiate into seedlings in tissue culture, or premature death during growth) or fail to grow normally (such as albino seedlings) or fail to be passed down (such as female sterility) and cannot be obtained (the above situations are collectively referred to as mutation lethality in the present invention), which hinders a more detailed study of gene mutation materials and an in-depth analysis of gene functions.

[0003] Further research has found that many gene mutations that cause lethality occur on the basis of homozygous mutations. If it is a heterozygous mutation, the plant can still grow and develop normally because the gene at the other allele can still function. This heterozygous material can provide researchers with stable breeding test materials for in-depth and detailed gene function research.

[0004] At present, the rise of CRISPR / Cas gene editing technology has made the creation of mutants routine, but because conventional CRISPR / Cas is to overexpress Cas protein and gRNA expression frame in plant cells, the excess Cas / gRNA complex will continue to modify the target gene in the plant cell until all the alleles of the target gene in the cell are mutated (i.e., homozygous mutation is formed). Therefore, in plants, especially some diploid plants such as rice and tobacco, the probability of producing heterozygous mutants is low. Among 328 T0 plants, only 19 (5.8%) heterozygous plants (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant, 2015, 8 (8): 1274-1284), which makes conventional CRISPR / Cas gene editing technology unable to be well applied to the above-mentioned homozygous mutation lethal genes. Summary of the invention

[0005] To solve the above problems, the present invention attempts to optimize the design of the promoter of the Cas protein expression cassette in the gene editing system to achieve insufficient modification of the targeted nucleic acid, thereby obtaining a higher proportion of heterozygous mutations (i.e., containing both mutant genotypes and non-mutated genotypes) to solve the editing, modification and functional research of homozygous lethal genes.

[0006] In a first aspect, the present invention provides a spatiotemporal specific promoter for driving the expression of a Cas9 polypeptide.

[0007] 1) The spatiotemporal specific promoter is expressed when the plant enters the multicellular embryonic stage and thereafter, so that some cells of the plant are edited, thereby producing an incompletely edited heterozygous plant;

[0008] 2) The incompletely edited mutant plants produced using this promoter can stably inherit the corresponding mutations to their offspring.

[0009] The time-space specific promoter is a promoter expressed when the plant enters the multicellular embryo stage and after this stage, and is preferably a promoter that functions when the callus enters differentiation and later stages.

[0010] In some embodiments, the nucleotide sequence is one of the following:

[0011] (1) the sequence shown in SEQ ID NO.1;

[0012] (2) The sequence shown in SEQ ID NO.3.

[0013] In a second aspect, an expression cassette is provided, comprising the time-space specific promoter.

[0014] In some embodiments, the expression cassette further comprises: (1) a polynucleotide encoding a Cas9 polypeptide, and (2) a DNA polynucleotide encoding a gRNA molecule.

[0015] In a third aspect, an expression vector is provided, comprising the time-space specific promoter or the expression cassette.

[0016] In some embodiments, the backbone vector for constructing the expression vector is the gene editing vector TKC.

[0017] In a fourth aspect, the invention provides the use of the spatiotemporal specific promoter, the expression cassette or the expression vector in creating a heterozygous mutant.

[0018] A fifth aspect provides a method for creating a heterozygous mutant, comprising:

[0019] (1) selecting the time-space specific promoter according to any one of claims 1 to 3;

[0020] (2) Selecting plants in which the target nucleic acid is insufficiently edited.

[0021] In some embodiments, insufficient editing of the target nucleic acid is manifested as a plant containing both mutant target nucleic acids and non-mutated target nucleic acids.

[0022] The beneficial effect of the present invention is that: the present invention optimizes the design of the promoter that drives the Cas9 polypeptide in the gene editing element expression box of the gene editing system, thereby obtaining a new type of time-space specific promoter that is different from the promoter used in the conventional gene editing expression box. Plant editing using this promoter can cause insufficient modification of the plant genome, thereby causing a larger proportion of heterozygous mutations in the plants, which solves the problem of being unable to obtain mutant plants due to lethal homozygous mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the TKC vector in the examples.

[0024] Figure 2 Schematic diagram of TKC-C51, TKC-C52, and TKC-C53 vectors in the examples.

[0025] Figure 3 This is an example of an electrophoresis gel image for identifying mutations at the SE5 gene target site in the example.

[0026] Figure 4 This is an example of an electrophoresis gel image for identifying mutant types at the YSA gene target site in the embodiment. DETAILED DESCRIPTION

[0027] The following definitions and methods are provided to better define this application and guide those of ordinary skill in the art in the practice of this application. Unless otherwise specified, terms are understood according to the conventional usage of those of ordinary skill in the relevant field. All patent documents, academic papers, industry standards and other public publications cited herein are incorporated herein by reference in their entirety.

[0028] As used herein, "plant" is any plant, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. Unless otherwise specified, nucleic acids are written from left to right in the 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids can be represented herein by their commonly known three-letter symbols or single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Similarly, nucleotides can be represented by commonly accepted single-letter codes. Numerical ranges include numbers that limit the range. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers involving single-stranded or double-stranded forms, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides, which hybridize with single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encoding" or "encoded" when used in the context of a specific nucleic acid refers to the nucleic acid containing the necessary information to direct the translation of the nucleotide sequence into a specific protein. Codons are used to represent information encoding proteins. As used herein, the "full-length sequence" of a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the specific protein. The terms "polypeptide", "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to amino acids incorporated into proteins, polypeptides or peptides (collectively referred to as "proteins"). Amino acids can be naturally occurring amino acids, and unless otherwise limited, known analogs of natural amino acids can be included, which can function in a manner similar to naturally occurring amino acids.

[0029] The term "trait" refers to a physiological, morphological, biochemical or physical characteristic of a plant or a specific plant material or cell. In some cases, this characteristic is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting protein, starch or oil content of seeds or leaves, or by observing metabolic or physiological processes, for example, by measuring tolerance to water deprivation or specific salt or sugar or nitrogen concentrations, or by observing the expression level of one or more genes, or by agronomic observations such as osmotic stress tolerance or yield.

[0030] "Transgenic" refers to any cell, cell line, callus, tissue, plant part or plant whose genome is altered by the presence of heterologous nucleic acid, such as a recombinant DNA construct. The term "transgenic" as used herein includes those original transgenic events and those generated from the original transgenic events by sexual crosses or asexual propagation, and does not encompass genomic (chromosomal or extrachromosomal) alterations made by conventional plant breeding methods or by naturally occurring events, such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

[0031] In this application, the words "comprise", "comprising" or their variants are to be understood as including other elements, numbers or steps in addition to the described elements, numbers or steps. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has been effected, or a progeny cell of a plant or cell so modified, which progeny cell comprises the modification. "Control" or "control plant" provides a reference point for measuring phenotypic changes in the test plant.

[0032] Negative or control plants can include, for example: (a) wild-type plants or cells, i.e., plants or cells having the same genotype as the genetically modified starting material that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but that have been transformed with an empty construct (i.e., with a construct that has no known effect on the trait of interest, such as a construct containing a marker gene); (c) plants or plant cells that are non-transformed segregants of the test plant or plant cell; (d) plants or plant cells that are genetically identical to the test plant or plant cell but have not been exposed to conditions or stimuli that would induce expression of the gene of interest; or (e) the test plant or plant cell itself, which is under conditions where the gene of interest is not expressed.

[0033] Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequence and underlying gene sequence of proteins of agricultural interest.

[0034] In some embodiments, the nucleotide sequence of the present application can be changed to perform conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequence of the present application can be replaced without changing the amino acid sequence according to the disclosed monocot codon preference, for example, the codons encoding the same amino acid sequence can be replaced with codons preferred by monocot plants without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiment due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in the present application is replaced according to monocot plant preference codons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituent. Exemplary amino acid substitution groups with various aforementioned properties considered are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be performed. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences, and the other corresponding nucleotide sequences are present in a cloned genomic DNA fragment or cDNA fragment group (i.e., a genomic library or a cDNA library) from a selected organism. The hybridization probe can be a genomic DNA fragment, a cDNA fragment, an RNA fragment or other oligonucleotide, and can be marked with a detectable group such as 32P or other detectable markers. Thus, for example, a hybridization probe can be prepared by marking a synthetic oligonucleotide based on the embodiment sequence. The method for preparing hybridization probes and constructing cDNA and genomic libraries is generally known in the art. The hybridization of the sequence can be carried out under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" means the following conditions, i.e., under these conditions, relative to hybridization with other sequences, the probe will hybridize with its target sequence to a greater extent (e.g., at least 2 times, 5 times or 10 times of background) that can be detected.Stringent conditions are sequence-dependent and vary in different environments. By controlling the stringency of hybridization and / or controlling the washing conditions, a target sequence that is 100% complementary to the probe can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow some sequence mismatches to detect lower similarities (heterologous probe method). Typically, the probe length is less than about 1000 or 500 nucleotides. Typically, stringent conditions are conditions in which the salt concentration is less than about 1.5M Na ions, typically about 0.01M to 1.0M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature conditions are: when used for short probes (e.g., 10 to 50 nucleotides), at least about 30°C; when used for long probes (e.g., greater than 50 nucleotides), at least about 60°C. Stringent conditions can also be achieved by adding destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization using 30% to 35% formamide buffer, 1M NaCl, 1% SDS (sodium dodecyl sulfate) at 37°C, and washing in 1× to 2× SSC (20×SSC=3.0MNaCl / 0.3M trisodium citrate) at 50°C to 55°C. Exemplary moderate stringency conditions include hybridization in 40% to 45% formamide, 1.0M NaCl, 1% SDS at 37°C, and washing in 0.5× to 1× SSC at 55°C to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% SDS at 37°C, and a final wash in 0.1× SSC at 60°C to 65°C for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. The duration of hybridization is typically less than about 24 hours, typically about 4 hours to about 12 hours. Specificity is usually dependent on post-hybridization washes, with the key factors being the ionic strength and temperature of the final wash solution. The Tm (thermodynamic melting point) of a DNA-DNA hybrid can be approximated by the formula of Meinkoth and Wahl (1984) Anal. Biochem. 138: 267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% formamide) - 500 / L; where M is the molar concentration of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, "% formamide" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Washing is usually performed at least until equilibrium is reached and a low level of hybridization background is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mismatch should reduce the Tm by about 1°C; thus, the Tm, hybridization, and / or washing conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≥90% identity are desired, the Tm can be reduced by 10°C.Typically, stringent conditions are selected to be about 5°C lower than the Tm of the specific sequence and its complementary sequence at a defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C lower than the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C lower than the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C lower than the Tm.

[0035] In some embodiments, a fragment of a nucleotide sequence and an amino acid sequence encoded therein is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of the polynucleotide of the embodiment or a portion of the amino acid sequence of the polypeptide. The fragment of the nucleotide sequence can encode a protein fragment, and the protein fragment retains the biological activity of the natural or corresponding full-length protein, and thus has protein activity. Mutant proteins include biologically active fragments of natural proteins, which contain continuous amino acid residues that retain the biological activity of natural proteins. Some embodiments also include transformed plant cells or transgenic plants, which include the nucleotide sequence of at least one embodiment. In some embodiments, an expression vector is used to transform a plant, and the expression vector includes the nucleotide sequence of at least one embodiment and a promoter that drives expression in a plant cell operably connected thereto. Transformed plant cells and transgenic plants represent plant cells or plants that contain heterologous polynucleotides in the genome. In general, the heterologous polynucleotides are stably integrated in the genome of the transformed plant cell or transgenic plant, so that the polynucleotides are passed to offspring. The heterologous polynucleotides can be integrated into the genome individually or as part of an expression vector. In some embodiments, the plants involved in the present application include plant cells, plant protoplasts, plant cell tissue cultures that can regenerate plants, plant calli, plant masses and plant cells, which are complete plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, spikes, cobs, shells, stalks, roots, root tips, anthers, etc. The present application also includes plant cells, protoplasts, tissues, calli, embryos, flowers, stems, fruits, leaves and roots derived from the transgenic plants of the present application or their progeny, and thus at least partially comprising the nucleotide sequences of the present application.

[0036] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, the modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of this application. Unless otherwise specified, the examples are based on conventional experimental conditions, such as Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001), or the conditions recommended by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are conventional commercial reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0037] Example 1 Editing results of Cas9 polypeptide expression driven by commonly used constitutive promoters in rice

[0038] In this example, the SE5 gene (Andrés F, Galbraith DW, Talón M, Domingo C (2009) Analysis of PHOTOPERIOD SENSITIVITY5 sheds light on the role of phytochromes in photoperiodic flowering in rice. Plant Physiol 151: 681-690) that shows premature aging after homozygous mutation in rice is used as the target test gene in this example. A gRNA specifically targeting SE5 is designed using a web design tool (http: / / crispr.hzau.edu.cn / CRISPR / ). The target gene is edited and modified using the CRISPR / Cas9 system.

[0039] gRNA molecule targets the segment of SE5 gene: AGACGAGCTTGCTGTCGACG

[0040] The gene editing vector TKC (He Y, Zhu M, Wang L, Wu J, Wang Q, Wang R, Zhao Y. Programmed Self-Elimination of the CRISPR / Cas9 Construct Greatly Accelerates the Isolation of Edited and Transgene-Free Rice Plants. Mol Plant, 2018, 11(9): 1210-1213) created by the inventors in the early stage was used as the backbone vector ( Figure 1). Connect the gRNA expression cassette into it. For specific methods, see (He Y, Zhu M, Wang L, Wu J, Wang Q, Wang R, Zhao Y. Programmed Self-Elimination of the CRISPR / Cas9 Construct Greatly Accelerates the Isolation of Edited and Transgene-Free Rice Plants. Mol Plant, 2018, 11(9): 1210-1213)

[0041] The sequenced positive plasmid was transformed into Agrobacterium (EHA105) and infected with rice callus. The transformed variety was rice "Zhonghua 11" (also known as ZH11, from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences), (rice genetic transformation is now a common operating method in the field of rice transgenics, and the detailed transformation steps and various culture medium formulas used can be found in the literature: Hiei Y, Ohta S, Komari T, Kumashiro T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J, 1994, 6 (2): 271-282). Plants with SE5-CK editing events were obtained.

[0042] For the SE5-CK editing event, identification primers were designed upstream and downstream of the SE5 gene target site: SE5-F (GGAGGAGATGAGGGCGGTGGCCATGCGGCT) and SE5-R (TTTCCGATCACTCACACCAGGGGACGGCGGCGCGATCG). SE5-F and SE5-F were used to perform PCR amplification on plants with SE5 editing events. When the target site is edited and mutated, a Sal I restriction site (recognition sequence is GTCGAC) at the SE5 target site will be destroyed, and the PCR product of the mutant DNA cannot be digested by Sal I; when the target site is not edited, the wild-type DNA is amplified, and the PCR product DNA will be digested by Sal I. Therefore, SE5-F and SE5-F can be used for PCR amplification, and then the PCR product can be digested by Sal I to identify the mutant type at the SE5 gene target site in plants with SE5-CR editing events. An example of the identification gel image is shown in the figure. Figure 3 .

[0043] In the SE5-CK editing event, a total of 50 mutant plants were obtained, of which 6 were heterozygous plants, with a heterozygous mutation ratio of 12%. By selecting the offspring of the mutant T0 plants for planting, plants with SE5 gene mutations were detected in the offspring of each T0 mutant plant, and the mutation can be stably inherited.

[0044] Example 2 Editing results of using spatiotemporal specific promoters to drive Cas9 polypeptide expression

[0045] In the above embodiment, the excess Cas / gRNA complex will continue to modify the target gene in the plant cell until all the alleles of the target gene in the cell mutate, thereby forming a homozygous mutation, causing abnormal plant development or even death. If a plant with a heterozygous mutation can be obtained, since there is still a fully functional gene at the other allele, it is expected that the plant can grow and develop normally. This requires insufficient editing and modification of the target site. Generally, insufficient modification can be achieved by reducing the expression amount of the Cas / gRNA complex, but reducing the expression of the complex to an appropriate degree is also relatively complicated. This embodiment intends to drive the expression of the Cas9 polypeptide by using a spatiotemporal specific promoter, and limit the expression of Cas9 to the period when callus tissue differentiates into a multicellular embryo and after this period, in order to achieve the technical effect of insufficient modification. Using a spatiotemporal specific promoter to drive the expression of the Cas9 polypeptide is an incomplete editing strategy, but the mutations that may be produced by this incomplete editing cannot be inherited to offspring. Therefore, how to design it to achieve the technical effect of just creating a heritable heterozygous mutation is unpredictable by those skilled in the art.

[0046] In addition to selecting the SE5 gene that causes premature aging after homozygous mutation in rice, this embodiment also selected the gene YSA (Su N, Hu ML, Wu DX, Wu FQ, Fei GL, Lan Y, Chen XL, Shu XL, Zhang X, Guo XP, Cheng ZJ, Lei CL, Qi CK, Jiang L, Wang H, Wan JM (2012) Disruption of a rice pentatricopeptide repeat protein causes a seedling-specific albino phenotype and its utilization to enhance seed purity in hybrid rice production. Plant Physiol 159: 227-238) that causes leaf albino phenotype in the seedling stage after homozygous mutation as the target test gene of the embodiment. The gRNAs specifically targeting YSA and SE5 were designed by a web design tool (http: / / crispr.hzau.edu.cn / CRISPR / ). The target gene was edited and modified using the CRISPR / Cas9 system.

[0047] The segment of the SE5 gene targeted by the gRNA molecule is consistent with that in Example 1.

[0048] gRNA molecule targets the segment of the YSA gene: GAGTAGGGCCGCTTCGGCCG

[0049] By conducting a comprehensive comparative analysis of the previously published chip data of rice throughout its entire growth period (Wang L, Xie W, Chen Y, Tang W, Yang J, Ye R, Liu L, Lin Y, Xu C, Xiao J, Zhang Q (2010) A dynamic gene expression atlas covering the entire life cycle of rice. Plant J 61: 752-766), we discovered three genes, C5-1, C5-2, and C5-3, that are continuously highly expressed at the beginning of callus differentiation and in subsequent periods.

[0050] The gene editing vector TKC created by the inventors in the early stage was used as the backbone vector. The promoter of Cas9 was replaced with the promoters of C5-1, C5-2, and C5-3 genes (the promoter sequences of C5-1, C5-2, and C5-3 genes are SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively), and three vectors TKC-C51, TKC-C52, and TKC-C53 were obtained respectively ( Figure 2 Then the gRNA expression cassette was connected thereto. For specific methods, see (He Y, Zhu M, Wang L, Wu J, Wang Q, Wang R, Zhao Y. Programmed Self-Elimination of the CRISPR / Cas9 Construct Greatly Accelerates the Isolation of Edited and Transgene-Free Rice Plants. Mol Plant, 2018, 11(9): 1210-1213)

[0051] The sequenced positive plasmid was transformed into Agrobacterium (EHA105) and infected with rice callus. The transformed variety was rice "Zhonghua 11" (also known as ZH11, from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences). (Rice genetic transformation is now a common operating method in the field of rice transgenics. The detailed transformation steps and various culture medium formulas used are shown in the literature: Hiei Y, Ohta S, Komari T, Kumashiro T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J, 1994, 6 (2): 271-282). Four types of plants with editing events, namely TKC-C51-YSA, TKC-C52-YSA, TKC-C53-YSA, and TKC-C53-SE5, were obtained.

[0052] For the TKC-C53-SE5 editing event, the mutation detection method was consistent with Example 1.

[0053] For the TKC-C51-YSA, TKC-C52-YSA, and TKC-C53-YSA editing events, identification primers were designed upstream and downstream of the YSA gene target site: YSA-F (GTCCTGCGGCCACTTCCTCCCTC) and YSA-R (GCTGCTGCCCCTCGTAGCTGTCC). Because after the target gene is edited and mutated, an Eag I restriction site (recognition sequence is CGGCCG) at the YSA target site will be destroyed, and the PCR product of the mutant DNA cannot be digested by Eag I; when the target site is not edited, the wild-type DNA is amplified, and the PCR product DNA will be digested by Eag I. Therefore, PCR amplification can be performed using YSA-F and YSA-R, and then the PCR product can be digested by Eag I to identify the mutant type at the YSA gene target site in the plants of the YSA-CR editing event. An example of the identification gel image is shown in Figure 4 .

[0054] In the TKC-C51-YSA editing event, a total of 3 mutant plants were obtained, all of which were heterozygous plants, with a heterozygous mutation ratio of 100%. By selecting the offspring of the heterozygous T0 plants for planting, 2 YSA heterozygous mutant plants were detected among 17 T1 plants, indicating that the mutation generated by TKC-C51-YSA can be stably inherited by offspring.

[0055] In the TKC-C52-YSA editing event, a total of 10 mutant plants were obtained, all of which were heterozygous plants, with a heterozygous mutation ratio of 100%. By selecting the offspring of heterozygous T0 plants for planting, no YSA mutant plants were detected in 63 T1 plants, indicating that the mutation generated by TKC-C52-YSA is not heritable and the C5-2 promoter is not suitable for creating heterozygous genetic materials.

[0056] In the TKC-C53-YSA editing event, a total of 4 mutant plants were obtained, of which 3 were heterozygous plants, with a heterozygous mutation ratio of 75%. By selecting the offspring of the heterozygous T0 plants for planting, 2 YSA heterozygous mutant plants were detected among 20 T1 plants, indicating that the mutation generated by TKC-C53-YSA can be stably inherited by offspring.

[0057] In the TKC-C53-SE5 editing event, a total of 16 mutant plants were obtained, of which 16 were heterozygous plants, with a heterozygous mutation ratio of 100%. By selecting the offspring of heterozygous T0 plants for planting, 7 SE5 heterozygous mutant plants were detected among 52 T1 plants, indicating that the mutation generated by TKC-C53-SE5 can be stably inherited by offspring.

[0058] The above results indicate that TKC-C51 and TKC-C53, whose Cas9 protein expression is driven by the promoters of C5-1 and C5-3 genes, can produce a high proportion of heterozygous plants in the T0 generation and can be inherited by future generations.

[0059] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A spatiotemporal specific promoter for driving the expression of a Cas9 polypeptide, characterized in that: Its nucleotide sequence is one of the following: (1) the sequence shown in SEQ ID NO. 1; (2) The sequence shown in SEQ ID NO.

3.

2. The time-space specific promoter according to claim 1, characterized in that 1) The spatiotemporal specific promoter is expressed when the plant enters the multicellular embryonic stage and thereafter, so that some cells of the plant are edited, thereby producing an incompletely edited heterozygous plant; 2) The incompletely edited mutant plants produced using this promoter can stably inherit the corresponding mutations to their offspring.

3. The time-space specific promoter according to claim 1 or 2, characterized in that The time-space specific promoter is a promoter expressed when the plant enters the multicellular embryo stage and after this stage.

4. An expression cassette, characterized in that It comprises the time-space specific promoter described in claim 1.

5. The expression cassette according to claim 4, characterized in that Also includes: (1) a polynucleotide encoding a Cas9 polypeptide, and (2) DNA polynucleotide encoding the gRNA molecule.

6. An expression vector comprising the time-space specific promoter according to any one of claims 1 to 3 or the expression cassette according to any one of claims 4 to 5.

7. Use of the spatiotemporal specific promoter according to any one of claims 1 to 3, the expression cassette according to any one of claims 4 to 5, or the expression vector according to claim 6 in creating a heterozygous mutant.

8. A method for creating a heterozygous mutant, characterized in that: include: (1) Selecting the spatiotemporal specific promoter according to any one of claims 1 to 3; (2) Selecting plants in which the target nucleic acid is insufficiently edited.

9. The method according to claim 8, characterized in that: The insufficient editing of the target nucleic acid is manifested in that a plant contains both mutant target nucleic acid and non-mutated target nucleic acid.

Images