Osabcb20 gene for regulating cadmium accumulation in rice and application of the gene and its coded protein

Abstract

The present disclosure relates to an OsABCB20 gene for regulating cadmium accumulation in rice, a protein encoded by the gene and application thereof. Specifically, it relates to an OsABCB20 gene for regulating cadmium accumulation in rice, a mutant sequence of the gene, a protein, a vector, a transformant, a method for reducing cadmium accumulation in rice plants and application thereof. By mutating, inhibiting or knocking out the OsABCB20 gene in rice, the expression amount of the gene is down-regulated or the gene is inactivated, which can reduce the accumulation of cadmium in rice, provide gene resources and technical support for breeding rice varieties with reduced cadmium content, effectively improve the problem of excessive cadmium content in rice, and have important agricultural application value.

Description

Technical Field

[0001] This disclosure relates to the field of rice genetic engineering technology, specifically to an OsABCB20 gene that regulates cadmium accumulation in rice, its mutant sequence, a protein, a vector, a transformant, a method for reducing cadmium accumulation in rice plants, and their applications. Background Technology

[0002] Cadmium (Cd) is a heavy metal harmful to humans. It can enter the human body through the food chain and cause toxicity to the immune, urinary, and nervous systems, threatening human health. Cd pollution in arable land is a prominent problem, posing a significant challenge to the safe production of crops. Cadmium is the primary pollutant affecting the environmental quality of agricultural soil, especially in acidic soils and a planting structure dominated by indica rice, which exacerbates the risk of Cd exceeding the standard in rice. Therefore, to avoid the harm to human health caused by Cd pollution in paddy fields, it is necessary to reduce the Cd content in rice.

[0003] The plant ABC transporter family participates in a series of plant life activities by transporting various substrates. It comprises numerous family members, with diverse classifications, complex structures, and varied functions. There are eight major subfamilies of plant ABC transporters (ABCA~ABCG and ABCI), among which ABCB mainly participates in the transport of auxins and heavy metals, stimulates cell growth, and enhances tolerance to abiotic stresses. Therefore, identifying target genes that can reduce cadmium content in rice can provide genetic resources for low-cadmium rice breeding and has significant agricultural application value. Summary of the Invention

[0004] In order to address the problem of excessive cadmium in rice in existing technologies and to compensate for the lack of low-cadmium gene resources in existing technologies, the purpose of this disclosure is to reduce the accumulation of cadmium in rice or to cultivate rice varieties with reduced cadmium content.

[0005] To achieve the above objectives, the first aspect of this disclosure provides an OsABCB20 gene for regulating cadmium accumulation in rice, wherein the OsABCB20 gene has a nucleotide sequence as shown in (1) or (2):

[0006] (1) The nucleotide sequence as shown in SEQ ID NO: 1;

[0007] (2) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 and encodes a protein with the same function.

[0008] A second aspect of this disclosure provides a mutant sequence obtained by mutating the nucleotide sequence of the OsABCB20 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the OsABCB20 gene.

[0009] Optionally, the mutant sequence is selected from at least one of the following sequences:

[0010] (I) The nucleotide sequence shown in SEQ ID NO: 4 obtained by deleting base A at position 4 of the target site I of the rice OsABCB20 gene;

[0011] (II) The nucleotide sequence shown in SEQ ID NO: 5 obtained by deleting the AG fragment from position 4 to position 5 of the target site I of the rice OsABCB20 gene;

[0012] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0013] A third aspect of this disclosure provides a protein encoded by the OsABCB20 gene described in the first aspect, or encoded by a mutant sequence described in the second aspect.

[0014] The fourth aspect of this disclosure provides a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted into target site I and produces a mutant sequence as described in the second aspect;

[0015] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0016] The fifth aspect of this disclosure provides a transformant, the host of which is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the fourth aspect;

[0017] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0018] The sixth aspect of this disclosure provides a method for reducing cadmium content in rice, the method comprising: downregulating the expression level of the OsABCB20 gene or inactivating the OsABCB20 gene by mutating, inhibiting or knocking out the OsABCB20 gene in rice, and / or reducing or inactivating the protein content encoded by the OsABCB20 gene.

[0019] The methods for mutating, suppressing, or knocking out the OsABCB20 gene in rice include gene editing, EMS mutagenesis, radiation mutagenesis, or space-borne methods.

[0020] Optionally, the gene editing includes:

[0021] The OsABCB20 gene can be knocked out using CRISPR / Cas9 or TALEN, or the promoter that initiates the expression of the OsABCB20 gene can be edited using CRISPR / Cas9 or TALEN to suppress its expression.

[0022] Preferably, the method for knocking out the OsABCB20 gene using CRISPR / Cas9 includes the following steps:

[0023] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCB20 gene;

[0024] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.

[0025] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.

[0026] The nucleotide sequence of target site I is shown in SEQ ID NO: 3;

[0027] The sequences of the primers are shown in SEQ ID NO: 10 and SEQ ID NO: 11;

[0028] The mutations include the substitution, deletion, and / or addition of one or more nucleotides in the rice OsABCB20 gene.

[0029] Optionally, in step S1, the mutation includes one of the following:

[0030] (a) Delete the fourth base A in the sequence of target site I of the rice OsABCB20 gene;

[0031] (b) Deletion of the AG segment from position 4 to position 5 of the target site I of the rice OsABCB20 gene.

[0032] The seventh aspect of this disclosure provides the application of the OsABCB20 gene described in the first aspect, the mutant sequence described in the second aspect, the protein described in the third aspect, the vector described in the fourth aspect, or the transformant described in the fifth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.

[0033] Through the above technical solution, this disclosure provides an OsABCB20 gene for regulating cadmium accumulation in rice, its encoded protein, and its applications. By mutating, inhibiting, or knocking out the OsABCB20 gene in rice to downregulate gene expression or inactivate the gene, cadmium accumulation in rice can be reduced. This provides genetic resources and technical support for breeding rice varieties with reduced cadmium content, effectively improving the problem of excessive cadmium content in rice, and has significant agricultural application value.

[0034] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0035] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:

[0036] Figure 1 This paper discloses the structure and knockout lines of the OsABCB20 gene. osabcb20-1 and osabcb20-2 The sequencing results of the mutation sites.

[0037] Figure 2 This is the disclosed knockout strain. osabcb20-1 and osabcb20-2 The results of cadmium content testing in rice from wild-type Nipponbare rice. Detailed Implementation

[0038] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.

[0039] The first aspect of this disclosure provides an OsABCB20 gene for regulating cadmium accumulation in rice, said OsABCB20 gene having a nucleotide sequence as shown in (1) or (2):

[0040] (1) The nucleotide sequence as shown in SEQ ID NO: 1;

[0041] (2) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 and encodes a protein with the same function.

[0042] In this disclosure, the inventors unexpectedly discovered that by mutating, inhibiting, or knocking out the OsABCB20 gene in rice, thereby downregulating the expression level of the OsABCB20 gene or inactivating the OsABCB20 gene, and / or reducing or inactivating the protein content encoded by the OsABCB20 gene, it is possible to reduce the accumulation of cadmium in rice and cultivate rice varieties with reduced cadmium content.

[0043] According to this disclosure, sequences having more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 include sequences having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with the nucleotide sequence shown in SEQ ID NO: 1, and the aforementioned homologous sequences can encode proteins with the same function as the nucleotide sequence shown in SEQ ID NO: 1.

[0044] A second aspect of this disclosure provides a mutant sequence obtained by mutating the nucleotide sequence of the OsABCB20 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the OsABCB20 gene.

[0045] In one embodiment of this disclosure, the mutant sequence is selected from at least one of the following sequences:

[0046] (I) The nucleotide sequence shown in SEQ ID NO: 4 obtained by deleting base A at position 4 of the target site I of the rice OsABCB20 gene;

[0047] (II) The nucleotide sequence shown in SEQ ID NO: 5 obtained by deleting the AG fragment from position 4 to position 5 of the target site I of the rice OsABCB20 gene;

[0048] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0049] In the above embodiments, the inventors of this disclosure designed and edited a vector based on target site I, and infected rice plants with Agrobacterium. Mutations were randomly performed at the target site within the rice plants. Then, the mutant sequences were detected using designed primers, and mutant lines with deletions of base A or fragment AG were selected. In the OsABCB20 gene, deletions of base A or fragment AG resulted in corresponding changes in the codon sequence and composition, premature appearance of the stop codon, premature termination of the encoded protein, and changes in the structure and function of the protein encoded by the mutant sequence.

[0050] A third aspect of this disclosure provides a protein encoded by the OsABCB20 gene described in the first aspect, or encoded by a mutant sequence described in the second aspect.

[0051] In this disclosure, the amino acid sequence of the protein encoded by the OsABCB20 gene is shown in SEQ ID NO: 2; the amino acid sequence of the protein encoded by the mutant sequence is shown in SEQ ID NO: 6 and / or SEQ ID NO: 7.

[0052] According to this disclosure, the nucleotide sequence shown in SEQ ID NO:4 encodes the protein shown in SEQ ID NO:6; the nucleotide sequence shown in SEQ ID NO:5 encodes the protein shown in SEQ ID NO:7.

[0053] The fourth aspect of this disclosure provides a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with a target site I and produces a mutant sequence as described in the second aspect;

[0054] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0055] The fifth aspect of this disclosure provides a transformant, the host of which is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the fourth aspect;

[0056] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0057] In this disclosure, the genetically engineered bacterium can be competent Agrobacterium species EHA105.

[0058] The sixth aspect of this disclosure provides a method for reducing cadmium content in rice, the method comprising: downregulating the expression level of the OsABCB20 gene or inactivating the OsABCB20 gene by mutating, inhibiting or knocking out the OsABCB20 gene in rice, and / or reducing or inactivating the protein content encoded by the OsABCB20 gene.

[0059] The methods for mutating, suppressing, or knocking out the OsABCB20 gene in rice include gene editing, EMS mutagenesis, radiation mutagenesis, or space-borne methods.

[0060] In this disclosure, the activity of the encoded protein in rice is downregulated or inactivated by mutating the gene OsABCB20, or the abundance of the encoded protein is downregulated by inhibiting the expression of the gene OsABCB20, thereby improving the cadmium accumulation characteristics of rice or breeding low-cadmium-accumulating rice varieties with reduced cadmium content in rice. This effectively solves the problem of excessive cadmium content in rice.

[0061] In one embodiment of this disclosure, the gene editing includes:

[0062] The OsABCB20 gene can be knocked out using CRISPR / Cas9 or TALEN, or its expression can be inhibited by editing the promoter that initiates OsABCB20 gene expression using CRISPR / Cas9 or TALEN.

[0063] In one embodiment of this disclosure, the method for knocking out the OsABCB20 gene using CRISPR / Cas9 includes the following steps:

[0064] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCB20 gene;

[0065] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.

[0066] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.

[0067] The nucleotide sequence of target site I is shown in SEQ ID NO: 3;

[0068] The sequences of the primers are shown in SEQ ID NO: 10 and SEQ ID NO: 11;

[0069] The mutations include the substitution, deletion, and / or addition of one or more nucleotides in the rice OsABCB20 gene.

[0070] In the above embodiments, CRISPR-Cas9 technology was used to construct mutant plants, and two different types of mutant plants were screened for subsequent experiments. After planting the mutant plants in soil contaminated with the heavy metal cadmium, the Cd content of individual plant grains was measured. The results showed that the cadmium content in the grains of the mutant plants was significantly lower than that of the wild type. This indicates that OsABCB20 participates in regulating the absorption and translocation of Cd in rice. The mutant strain disclosed in this paper can significantly reduce the cadmium content in rice grains, contributing to food security and human health. It also provides genetic resources and technical support for breeding low-cadmium-accumulation rice.

[0071] In a preferred embodiment of this disclosure, in step S1, the mutation includes one of the following:

[0072] (a) Delete the fourth base A in the sequence of target site I of the rice OsABCB20 gene;

[0073] (b) Deletion of the AG segment from position 4 to position 5 of the target site I of the rice OsABCB20 gene.

[0074] The seventh aspect of this disclosure provides the application of the OsABCB20 gene described in the first aspect, the mutant sequence described in the second aspect, the protein described in the third aspect, the vector described in the fourth aspect, or the transformant described in the fifth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.

[0075] In this disclosure, OsABCB20 participates in the transport of the heavy metal cadmium in rice, increasing the rice's sensitivity to cadmium. Improving OsABCB20 can optimize the cadmium accumulation characteristics of rice and reduce the amount of cadmium accumulated in rice grains. Breeding rice varieties with reduced cadmium absorption using mutants of the rice OsABCB20 gene has potential application value in agriculture.

[0076] The present disclosure is further described in detail below through examples.

[0077] All raw materials used in the examples are commercially available. Unless otherwise specified, the experimental conditions in the examples were performed under conventional conditions known to those skilled in the art.

[0078] Example 1

[0079] This example illustrates the acquisition and molecular identification of the OsABCB20 gene knockout line.

[0080] The OsABCB20 gene's CDS is edited using CRISPR / Cas9 to induce nonsense mutations in the OsABCB20 gene, thereby suppressing its expression. The specific implementation method is as follows:

[0081] S1. Based on the target site selection principle of the CRISPR / Cas9 vector system, a 20bp sequence was selected from the sixth exon of the OsABCB20 gene as the target sequence for generating sgRNA.

[0082] The target sequence is located on the positive strand of the OsABCB20 gene coding region, 1215-1234 bp downstream of the start codon ATG, and the sequence is CGCAGGCAAAGTCGTTGCAC (as shown in SEQ ID NO: 3).

[0083] Based on the target sequences above, the adapter primers were designed as follows:

[0084] B20P1U3-F: GGCAGTGCAACGACTTTGCCTGCG (as shown in SEQ ID NO: 8);

[0085] B20P1U3-R: AAACCGCAGGCAAAGTCGTTGCAC (as shown in SEQ ID NO: 9).

[0086] The above adapter primers were synthesized and dissolved into 100 μmol / L stock solutions. 1 μL of each was taken. B20P1U3-F and B20P1U3-R were mixed to obtain B20P1U3 mixture. The B20P1U3 mixture was diluted to 1 μmol / L, placed on a PCR machine at 98℃ for 30 seconds, and then cooled to room temperature to complete the annealing and form adapters at the target sites.

[0087] References Ma XL ,Zhang QY ,Zhu QL ,Liu W ,Chen Y ,Qiu R ,Wang B ,YangZF ,Li HY ,Lin YR ,Xie YY ,Shen RX ,Chen SF ,Wang Z ,Chen YL ,Guo JX ,Chen LT ,Zhao XC ,Dong ZC ,Liu YG .A robust CRISPR / Cas9 system for convenient,high-efficiency multiplex genome editing in monocot and dicot plants .Mol Plant ,2015 ,8(8):1274–1284. Constructing the CRISPR / Cas9 recombinant vector pCRISPR / Cas9-OsABCB20 with the OsABCB20 gene target sequence.

[0088] S2. The pCRISPR / Cas9-OsABCB20 recombinant vector was introduced into competent Agrobacterium species EHA105, and the genetic transformation of rice was carried out by Baige Biotechnology Co., Ltd.

[0089] The procedure is briefly described as follows: Mature and plump seeds of the Japonica rice variety Nipponbare were selected, dehulled, sterilized with sodium hypochlorite, filtered dry, and inoculated onto an induction medium to induce callus formation. Nipponbare callus was infected with Agrobacterium EHA105 containing the pCRISPR / Cas9-OsABCB20 recombinant vector, then transferred to a co-culture medium and cultured in the dark at 24°C for 3 days. The callus was washed and transferred to a selection medium containing hygromycin for screening and culture for 30 days. The selected resistant callus was transferred to a pre-differentiation medium for 7-10 days, then to a differentiation medium under light. When the seedlings reached 2-4 cm in height, they were transferred to a rooting medium and grown for about 3 weeks, resulting in 15 T0 generation seedlings. After 3 days of hardening, the seedlings were transplanted into the soil. Seeds were collected and used to propagate the next generation, yielding T1 generation plants.

[0090] S3. Target site genotyping was performed on T1 generation plants to identify mutant plants, as briefly described below:

[0091] DNA was extracted from T1 generation plants using the SDS method. Primers were designed to amplify DNA fragments containing the target sequence OsABCB20. The amplification primers are as follows:

[0092] OsABCB20-CAS9-F:GCACCAGACCTTCAGACCTT (as shown in SEQ ID NO: 10);

[0093] OsABCB20-CAS9-R:AGGCAAACTAGCATCTGACCAA (as shown in SEQ ID NO: 11);

[0094] Using the extracted DNA as a template, and OsABCB20-CAS9-F and OsABCB20-CAS9-R as primers, PCR amplification was performed using high-fidelity LA Tap polymerase (TaKaRa). The following reaction system was established in a sterile PCR tube: 25 μL GCXBuffer solution, 8 μL dNTP Mixture, 0.5 μL LA Tap polymerase, 2 μL OsABCB20-F (10 nmol), 2 μL OsABCB20-R (10 nmol), 3.5 μL DNA, 9 μL ddH2O, for a total reaction volume of 50 μL. The reaction program was: 95℃ denaturation for 6 min; PCR amplification: 94℃ denaturation for 40 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 33 cycles, with a final extension at 72℃ for 5 min. After the reaction, the sample was sent to Qingke Sequencing Company for sequencing. The sequencing primer was OsABCB20-CAS9-F. Individual plants with a single peak at the target site in their sequencing results were screened and directly compared with wild-type sequences to analyze the target site genotype. Homozygous knockout lines with mutations at the target site leading to nonsense mutations were screened in T1 generation plants, and Hpt, Cas9, and other transgenic elements were detected using PCR. Further screening for knockout lines without transgenic elements was conducted. osabcb20-1 and osabcb20-2 Mutated sequences such as Figure 1 As shown.

[0095] Example 2

[0096] This example illustrates the elemental content of the OsABCB20 gene knockout strain.

[0097] (1) Planting of mutant materials:

[0098] The T1 generation of the loss-of-function OsABCB20 mutant, along with the control Zhonghua 11, was used in a field experiment in a cadmium-contaminated paddy field in Beishan, Changsha. The transgenic plants were also re-sequencing and identified. The planting density was 16.5 × 26 cm, and field management followed the routine field production management practices.

[0099] (2) Determination of cadmium content in rice:

[0100] After being harvested from the field and naturally dried, the rice was threshed, milled, and dried to constant weight in an oven at a temperature not lower than 80℃. 0.3000g of each sample was added to a sample tube, with two blanks and one standard rice sample added as controls for each batch. A mixed acid solution of 9mL nitric acid (re-distilled and purified): hydrogen peroxide (v / v 8:1) was added, and the mixture was placed in a microwave digester for digestion. The digestion reaction program was: room temperature to 190℃ for 15 min, 190℃ for 35 min, and 190℃ to room temperature for 15 min. After digestion, the sample tubes were placed in a constant-temperature acid removal apparatus for acid removal, with the reaction program being: 140℃ for 110 min. After acid removal, the sample tubes were rinsed repeatedly with small amounts of 1% nitric acid and transferred to 10mL volumetric tubes, brought to a final volume of 10mL, and filtered through a funnel made of folded quantitative filter paper into a 10mL test tube. The elements in the samples were determined by coupled plasma atomic emission spectrometry (Agilent ICP-OES 700), with each sample measured three times and the average value calculated.

[0101] The results are as follows Figure 2 As shown, "**" indicates the difference compared to the wild type. p <0.01; "*" indicates compared to the wild type, p <0.05. Two homozygous mutants with different mutation types. osabcb20-1 and osabcb20-2 The cadmium content of brown rice was significantly lower than that of wild-type rice, indicating that knocking out the OsABCB20 gene can reduce the cadmium content of rice.

[0102] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0103] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0104] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A method of reducing cadmium content in rice grain, characterized by, The method comprises: down-regulating expression of the OsABCB20 gene or deactivating the OsABCB20 gene in rice by mutation, inhibition or knockout, and / or reducing or deactivating the protein encoded by the OsABCB20 gene. The OsABCB20 gene is edited by gene editing. The nucleotide sequence of the OsABCB20 gene is shown in SEQ ID NO:

1.

2. The method of claim 1, wherein, The gene editing comprises: The OsABCB20 gene is knocked out by CRISPR / Cas9 or TALEN, or the promoter of the OsABCB20 gene is edited by CRISPR / Cas9 or TALEN to inhibit expression of the OsABCB20 gene.

3. The method of claim 2, wherein, The method for knocking out the OsABCB20 gene by CRISPR / Cas9 comprises the following steps: S1. Designing a CRISPR / Cas9 editing vector according to a target site I of the rice OsABCB20 gene; S2. Infecting the CRISPR / Cas9 editing vector into a rice plant by Agrobacterium, mutating at the target site I in the rice plant body, and then detecting and screening a T0 generation positive plant with a functional defect according to a designed primer; S3. Selfing the T0 generation positive plant to screen a T1 generation homozygous mutant plant, and obtaining a rice plant with reduced cadmium content in rice grains; The nucleotide sequence of the target site I is shown in SEQ ID NO:

3. The sequence of the primer is shown in SEQ ID NO: 10 and SEQ ID NO:

11. The mutation comprises substitution, deletion and / or addition of one or more nucleotides on the rice OsABCB20 gene.

4. The method of claim 3, wherein, In step S2, the mutation comprises one of the following: (a) deleting the base A at the 4th position of the sequence of the target site I of the rice OsABCB20 gene; (b) deleting the fragment AG from the 4th position to the 5th position of the sequence of the target site I of the rice OsABCB20 gene.

5. Use of a knockout of the OsABCB20 gene or the protein encoded thereby in the breeding of a rice variety with a reduced cadmium content in the rice grains, wherein, The nucleotide sequence of the OsABCB20 gene is shown in SEQ ID NO: 1.

Images