Rice osbhlh137 gene and application thereof

Editing the rice OsbHLH137 gene using the CRISPR/Cas9 system regulates rice panicle number and yield, solving the problem of increasing rice yield and providing genetic resources to improve rice plant architecture and yield.

CN119020370BActive Publication Date: 2026-02-13HUNAN HYBRID RICE RES CENT
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411130051.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-16
Publication Date
2026-02-13
Estimated Expiration
2044-08-16

AI Technical Summary

Technical Problem

Current technologies limit the potential for increasing rice yield. Expanding the planting area has limited potential, so it is necessary to increase yield per unit area. However, the regulation of rice panicle number is greatly affected by genetic and environmental factors. Insufficient research on the function of OsbHLH family members affects high-yield genetic breeding.

Method used

By knocking out or overexpressing the rice OsbHLH137 gene using the CRISPR/Cas9 system, the number of panicles and yield of rice can be regulated. This process includes designing target sites, constructing expression vectors, transforming recipient materials, and screening mutant strains to achieve gene editing.

Benefits of technology

Knocking out the OsbHLH137 gene increases the number of tillers and yield per plant, while overexpressing the OsbHLH137 gene reduces the number of tillers and increases the number of grains per panicle, providing genetic resources to regulate rice plant architecture and yield, thereby improving rice yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119020370B_ABST
    Figure CN119020370B_ABST
Patent Text Reader

Abstract

The application discloses a rice OsbHLH137 gene and application thereof, wherein a DNA sequence of the OsbHLH137 gene is shown as SEQ ID NO. 1. The OsbHLH137 gene is applied to regulating tillering and ear development of rice, and provides a high-quality gene resource for genetic improvement of plant type and yield of rice. By knocking out the OsbHLH137 gene in rice, the purpose of increasing tillering, reducing the number of grains per ear and increasing the yield of rice is achieved. By overexpressing the OsbHLH137 gene in rice, the purpose of reducing tillering, increasing the number of grains per ear and reducing the yield of rice is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to a rice OsbHLH137 gene and application thereof. BACKGROUND

[0002] As a major food crop in the world and China, high yield has been one of the most important research targets. However, after the first green revolution and the use of hybrid rice, the yield of rice has entered a slow growth stage. Meanwhile, due to the limitations of water resources and arable land area, the potential of increasing yield by further expanding the planting area of rice is very limited. Therefore, the increase of rice yield mainly relies on increasing the yield per unit. The yield of rice is mainly determined by the number of panicles, the number of grains per panicle and the thousand-grain weight, and the number of panicles is affected by the combination of heredity, development and environmental factors.

[0003] The bHLH protein family is a large family of transcription factors widely existing in animals, plants and microorganisms, contains an alkaline DNA binding domain and a representative helix-loop-helix domain, and is widely involved in important physiological processes such as perception of environmental signals, regulation of cell cycle and rhythm, and differentiation of tissues and organs. In rice, a total of 178 OsbHLH family members are predicted, and these gene members are speculated to be involved in the regulation of the development of rice roots and panicles, the synthesis of anthocyanins and terpenoids, the perception of light and hormone signals, iron ion balance and the like. For example, OsbHLH5 regulates rice anther development by regulating the expression of OsADF; OsbHLH123 is involved in the initiation / maintenance of the development of panicle neck axillary meristem of rice; and OsbHLH172 is involved in the signal transduction of BR to positively regulate the angle of rice leaves and the size of seeds. However, so far, only a small number of functions of OsbHLH family members have been reported. Therefore, in-depth study of the biological functions of each member of the rice OsbHLH family is helpful to the development of high-yield genetic breeding technology of rice. SUMMARY

[0004] The technical problem to be solved by the present application is to overcome the deficiencies in the prior art, and to provide a rice OsbHLH137 gene and application thereof.

[0005] In order to solve the above technical problem, the present application provides an OsbHLH137 gene, and the DNA sequence of the OsbHLH137 gene is shown in SEQ ID NO. 1.

[0006] Based on a general technical concept, the present application further provides an application of the OsbHLH137 gene in claim 1 in regulating the number of panicles and yield of rice.

[0007] The application further comprises the following steps: knocking out the OsbHLH137 gene in rice to increase the number of tillers, reduce the number of grains per panicle, and increase the yield of rice.

[0008] The application further comprises the following steps:

[0009] SA-1, two target sites of the OsbHLH137 gene are designed based on a CRISPR / Cas9 system, and the OsbHLH137 gene in an expression vector is knocked out;

[0010] SA-2, the expression vector in which the OsbHLH137 gene is knocked out is introduced into a receptor material to obtain callus;

[0011] SA-3, a mutant plant in which the callus is regenerated is screened, and the mutant plant is a rice plant with increased tillers, reduced number of grains per panicle, and increased yield of rice.

[0012] The application further comprises the following steps: overexpressing the OsbHLH137 gene in rice to reduce the number of tillers, increase the number of grains per panicle, and reduce the yield of rice.

[0013] The application further comprises the following steps:

[0014] The application further comprises the following steps:

[0015] SB-1, a DNA fragment of the OsbHLH137 gene is obtained by PCR amplification;

[0016] SB-2, the OsbHLH137 gene is connected to a UBI promoter on a modified pCAMBIA-1300 vector by Kpn I and BamH I double digestion to obtain a recombinant plasmid for overexpression of the OsbHLH137 gene;

[0017] SB-3, the recombinant plasmid is introduced into rice callus to obtain a rice plant with reduced tillers, increased number of grains per panicle, and reduced yield of rice.

[0018] The application further comprises the following steps: knocking out the OsbHLH137 gene in rice to increase the number of tillers, reduce the number of grains per panicle, and increase the yield of rice.

[0019] The DNA sequence of the bHLH-OE-For1 is shown as SEQ ID NO. 6.

[0020] The DNA sequence of the bHLH-OE-Rev1 is shown as SEQ ID NO. 7.

[0021] Compared with the prior art, the application has the advantages that:

[0022] The application provides application of an OsbHLH137 gene in regulation of panicle number, grain number per panicle and yield of rice. OsbHLH137 is a member of a rice bHLH transcription factor protein family, and the application confirms that the transcription factor protein encoded by the OsbHLH137 gene can negatively regulate the panicle number and yield of rice by constructing an osbhlh137 mutant plant of rice through CRISPR / Cas9 gene editing technology. Knocking out the OsbHLH137 gene can increase the tiller number and yield per plant of normal rice, and the osbhlh137 mutant also shows a decrease in the grain number per panicle. Overexpression of the OsbHLH137 gene in rice shows a decrease in the tiller number and yield, but an increase in the grain number per panicle. It is indicated that the OsbHLH137 gene can regulate the tillering and panicle development of rice, and provides a high-quality gene resource for genetic improvement of the plant type and yield of rice. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to make the purpose, technical scheme and advantages of the embodiments of the application more clear, the technical scheme in the embodiments of the application will be described clearly and completely below with reference to the drawings in the embodiments of the application.

[0024] Figure 1 It is a sequence alignment chart of the OsbHLH137 gene after knockout in experiment one of the application.

[0025] Figure 2 It is a field growth phenotype chart of the osbhlh137 mutant in experiment two of the application.

[0026] Figure 3 It is an agronomic trait analysis result chart of the osbhlh137 mutant in experiment three of the application.

[0027] Figure 4 It is a relative expression amount data analysis result chart of the OsbHLH137 overexpression line in experiment four of the application.

[0028] Figure 5 It is a field growth phenotype chart of the OsbHLH137 overexpression line in experiment five of the application.

[0029] Figure 6 It is an agronomic trait analysis result chart of the OsbHLH137 overexpression line in experiment six of the application. DETAILED DESCRIPTION

[0030] The application will be further described with reference to the following specific preferred embodiments, but the scope of the application is not limited by the same.

[0031] The materials, reagents and instruments used in the following examples can be obtained from commercial channels. The experimental methods in the following examples are conventional methods in the art, unless otherwise specified.

[0032] Example 1

[0033] A rice OsbHLH137 gene of the application, the DNA sequence of which is shown as SEQ ID NO. 1, specifically is as follows:

[0034]

[0035] The CAD sequence is shown as SEQ ID NO. 2, specifically:

[0036] ATGGAGATGACAAGCTGCTACAACGACGTCGACGCCGGCGACATTGGGGCCGGCGGTGATCTCTTCGATATGGTGTGGCCTGGACGACGACGACGGGAAGAAGACAACACCAG CGGCTGCCTCCCCTTGTCGCCGCCGCCGCCGCCTGAGCTCGCCGTGGATGATCAGCTACTGGCTGGAGGCGATGGCGGCGGCGGCAAACCGGTGGCGGTGGCGGTGGCGGAGGACGACGACTCCGGTGAGCGGTGGACGGAGGACCAGGTTCCGACAGACGAAGGGATATGCGTCATGGGGAGGAGAAGCGAGTCCAGCAAGGAGAGGAGGAAGATAACACGAGCAAGAAGATCGTCACGCTACTCTCAAACACATAGCCTGACAGAAAGGAAACGAAGGTGCAAGATAAACGAGAACCTGAAGACCCTGCAGCAGCTCGTTCCAGGTTGCGACAAGTCCAATAACCAGGCCTCAACGCTGGACAAAACCATCCGCTACATGAAGTCACTGCAGCAGCATGTCCAGGCCATGTCAGTTGGATGCATCATGAAGCCAGCAGCAGCAGGAGTGTCGTACCACCCATTCCTGCAACCGCCGCCGTACGTGCGGCCGGCGATCGCCGCCGGCGGCGCTGCTCCGGCGGGGATGGTTCCTAGGCCTCTTCCATCGTCGATGGTTCGTTTTGCTCCTGTGCTTCCAATGGTGGTTCACCATCCAGCGCCATTAATGATGATGCCTGCGGCGCCGGCGCCATTGATGACGTATCCGGGAGCTGGAGTGGCAGGTCCAAGTAACATCACGGCAGAACGAAAGAAAGATTAA.

[0037] The amino acid sequence is shown as SEQ ID NO. 3, specifically:

[0038] MEMTSCYNDVDAGDIGAGGDLFDMVWPGRRRREEDNTSGCLPLSPPPPPELAVDDQLLAGGDGGGGKPVAVAVAEDDDSGERWTEDQVPTDEGICVMGRRSESSKERRKITRARRSSRYSQTHSLTERKRRCKINENLKTLQQLVPGCDKSNNQASTLDKTIRYMKSLQQHVQAMSVGCIMKPAAAGVSYHPFLQPPPYVRPAIAAGGAAPAGMVPRPLPSSMVRFAPVLPMVVHHPAPLMMMPAAPAPLMTYPGAGVAGPSNITAERKKD.

[0039] Example 2

[0040] The application of the OsbHLH137 gene of the rice in Example 1 in regulating the number of panicles and yield of rice. Specifically, a method for increasing the tillering of rice, reducing the number of grains per panicle, and increasing the yield of rice. Specifically comprising the following steps:

[0041] (1) Using the online CRISPR / Cas9 target site design tool http: / / skl.scau.edu.cn / , two target sites for the OsbHLH137 gene are designed: Target1 and Target2.

[0042] The gene sequence of Target1 is shown in SEQ ID NO. 4, specifically: 5'-CGGCGGTGATCTCTTCGATA-3'.

[0043] The gene sequence of Target2 is shown in SEQ ID NO. 5, specifically:

[0044] 5'-TGAGCGGTGGACGGAGGACC-3'.

[0045] (2) Using rice variety Taibei 309 (TP309) as the receptor material, Agrobacterium-mediated genetic transformation is carried out, and the gene knockout expression vector is introduced into the TP309 rice material to obtain callus.

[0046] (3) The regenerated seedlings obtained are identified and screened to obtain osbhlh137 mutant plants: osbhlh137-1, osbhlh137-2 and osbhlh137-3.

[0047] The application does not have special limitations on the specific method of CRISPR / Cas9 gene editing, which can be carried out according to the conventional technical means in the art.

[0048] Experiment 1: Identification of OsbHLH137 mutants.

[0049] Sequence alignment was performed on osbhlh137-1, osbhlh137-2 and osbhlh137-3 and wild type TP309. The identified primer sequences include bHLH-Mu-F1 and bHLH-Mu-R1.

[0050] The DNA sequence of bHLH-Mu-F1 is 5'-GCTGATTACTACTCGGCGAAC-3';

[0051] The DNA sequence of bHLH-Mu-R1 is 5'-CCGTGACAATATTGGCTGCG-3'.

[0052] Figure 1 The results of sequencing and alignment analysis. As can be seen from the figure: the OsbHLH137 gene in the osbhlh137-1 mutant is inserted with 1bp A base at two target sequence sites, respectively, resulting in a frameshift mutation of the encoded OsbHLH137 gene, loss of original function (i.e. knockout). The OsbHLH137 gene in the osbhlh137-2 mutant is inserted with 5bp CTTCG and GGAGG bases at two target sequence sites, respectively, resulting in a frameshift mutation of the encoded OsbHLH137 gene, loss of original function (i.e. knockout). The OsbHLH137 gene in the osbhlh137-3 mutant is deleted by 197bp between two target sequence sites, resulting in a frameshift mutation of the encoded OsbHLH137 gene, loss of original function (i.e. knockout).

[0053] Experiment 2: Phenotype analysis of osbhlh137 mutants.

[0054] Homozygous osbhlh137 knockout mutant system: osbhlh137-1, osbhlh137-2 and osbhlh137-3, and wild type rice material TP309, were subjected to field test. Photographs were taken to record the growth performance of osbhlh137 mutants and wild type TP309 under field conditions.

[0055] Figure 2 is the growth performance of rice plants under field conditions. As can be seen from the figure: after knocking out the OsbHLH137 gene, the heading stage of rice plants is significantly advanced.

[0056] Experiment 3: Agronomic trait analysis results of osbhlh137 mutants.

[0057] The wild type TP309 and osbhlh137 mutants harvested in the same period were each selected 6 typical single plants for test analysis. The number of effective spikes, grain number per spike and grain yield per plant were investigated, and the obtained data were statistically tested using SPSS software.

[0058] Figure 3 The statistical results of the number of effective spikes, grain number per spike and grain yield per plant of the OsbHLH137 mutant showed that, compared with the wild type TP309, although the grain number per spike of the three osbhlh137 mutants was significantly reduced, the number of spikes per plant was significantly increased, and the final grain yield per plant was also significantly increased.

[0059] Example 3

[0060] An application of the OsbHLH137 gene in regulating the number of spikes and yield of rice according to Example 1. Specifically, a method for reducing rice tillering, increasing grain number per spike and reducing rice yield. Specifically comprising the following steps:

[0061] (1) The DNA fragment of the OsbHLH137 gene is obtained by PCR amplification.

[0062] The primer sequence for amplifying the DNA fragment of the OsbHLH137 gene includes bHLH-OE-For1 and bHLH-OE-Rev1.

[0063] The DNA sequence of bHLH-OE-For1 is shown in SEQ ID NO. 6, specifically: 5'-TGTAGTGAGGTACCATGGAGATGACAAGCTG-3';

[0064] The DNA sequence of bHLH-OE-Rev1 is shown in SEQ ID NO. 7, specifically: 5'-CGAGAGAACGTTGGATCCATCTTTCTTTCG-3'.

[0065] (2) After the OsbHLH137 gene is connected to the UBI promoter on the modified pCAMBIA-1300 vector through Kpn I and BamH I double digestion, a recombinant plasmid p1300-OsbHLH137 is obtained.

[0066] (3) The recombinant plasmid p1300-OsbHLH137 for overexpression of the OsbHLH137 gene is transformed into rice variety 9311 by Agrobacterium-mediated genetic transformation.

[0067] (4) The obtained callus regenerated seedlings are identified and screened, and the primer sequence for identification includes bHLH-OE-F1 and bHLH-OE-R1.

[0068] The gene sequence of bHLH-OE-F1 is 5'-AGCATCTATTCATATGCTCTAACC-3'.

[0069] The gene sequence of bHLH-OE-R1 is 5'-CCAAACATAGAGAATTAATTGATC-3'.

[0070] The primer combination amplifies a size of 420 bp. If this size of fragment can be amplified in the transgenic plant, it means that the plant is OsbHLH137 overexpression positive. The results obtained overexpression transgenic lines OE-1, OE-2, OE-3.

[0071] Experiment four: detection of the gene expression level of OsbHLH137 overexpression lines.

[0072] 1. RT-qPCR expression analysis

[0073] The RNA of the overexpression transgenic lines OE-1, OE-2, OE-3 plant leaves was extracted by Trizol method, and the cDNA obtained by reverse transcription was used as a template to detect the expression level of OsbHLH137 gene in the overexpression plants by real-time fluorescent quantitative PCR technology. At the same time, rice Ubiquitin gene was used as an internal standard.

[0074] The primer sequence for real-time fluorescent quantitative PCR detection is:

[0075] bHLH-Real-F1: 5'-TTGCGACAAGTCCAATAACCAG-3'

[0076] bHLH-Real-R1: 5'-GGAATGGGTGGTACGACACTC-3'

[0077] Ubi-Real-For1: 5'-GATCCAGGACAAGGAGGGG-3'

[0078] Ubi-Real-Rev1: 5'-TTGTAGTCGGCGAGGGTGC-3'

[0079] Figure 4 The results of the detection of the expression level of OsbHLH137 gene in three overexpression transgenic lines (OE-1, OE-2, OE-3) are shown in the table. The results show that compared with the wild type control plant, the expression level of OsbHLH137 gene in three independent T0 transgenic event lines is significantly up-regulated.

[0080] Experiment five: phenotype analysis of OsbHLH137 overexpression lines.

[0081] The homozygous OsbHLH137 overexpression lines obtained are used for field test with wild type rice material 9311. Photographs are taken to record the growth performance of the OsbHLH137 overexpression lines and wild type 9311 under field conditions, and the results are shown in Figure 5 .

[0082] As can be seen from the figure, after knocking out the OsbHLH137 gene, the heading stage of the rice plants is significantly delayed.

[0083] Experiment six: analysis of agronomic traits of the OsbHLH137 overexpression lines.

[0084] Wild type 9311 and overexpression lines OE-1, OE-2 and OE-3 harvested at the same period are selected, and 6 typical single plants of each line are selected for variety analysis. The number of effective ears, the number of grains per ear, and the grain yield per plant are investigated, and the obtained data are statistically tested using SPSS software.

[0085] Figure 6 The statistical results of the number of effective ears, the number of grains per ear, and the grain yield per plant are shown in the figure. As can be seen from the figure, compared with the wild type 9311, although the number of grains per ear of the three OsbHLH137 overexpression lines is significantly increased, the number of ears per plant and the grain yield per plant are significantly reduced.

[0086] The above description is only a preferred embodiment of the present application, and does not limit the present application in any form. Although the present application has been disclosed as above with the preferred embodiment, it is not intended to limit the present application. Any person skilled in the art can make many possible changes and modifications to the technical solutions of the present application, or modify equivalent embodiments, without departing from the spirit and technical solutions of the present application. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present application, without departing from the technical solutions of the present application, are still within the scope of protection of the present application.

Claims

1. A type of rice OsbHLH137 Genes, characterized by, The rice OsbHLH137 The DNA sequence of the gene is shown in SEQ ID NO.

1.

2. The rice according to claim 1 OsbHLH137 Application of genes in regulating rice panicle number and yield.

3. The application according to claim 2, characterized in that, The method of application includes: knocking out the rice in rice. OsbHLH137 Genes are used to increase the number of ears per plant and the yield of grains per plant.

4. The application according to claim 3, characterized in that, The method of application includes the following steps: SA-1, based on CRISPR / Cas9 system design for rice OsbHLH137 Two target sites of the gene, knocking out the expression vector OsbHLH137 Gene; SA-2, The expression vector that knocked out the rice OsbHLH137 gene was transferred into the recipient material to obtain callus tissue; SA-3, screening for mutant strains in callus regeneration seedlings, that is, rice plants with increased tillering, reduced number of grains per panicle, and increased rice yield.

5. The application according to claim 4, characterized in that, The two target sites include Target1 and Target2, the gene sequence of Target1 is shown in SEQ ID NO.4, and the gene sequence of Target2 is shown in SEQ ID NO.

5.

6. The application according to claim 2, characterized in that, The method of application includes overexpressing the rice OsbHLH137 gene in rice to reduce the number of panicles per plant and the grain yield per plant.

7. The application according to claim 6, characterized in that, The method of application includes the following steps: SB-1, the rice OsbHLH137 DNA fragments obtained by PCR amplification of genes; SB-2, the rice was digested with Kpn I and BamHI, and then... OsbHLH137 After the gene was inserted into the UBI promoter on the modified pCAMBIA-1300 vector, a recombinant plasmid overexpressing the OsbHLH137 gene was obtained. SB-3. The recombinant plasmid is introduced into rice callus tissue to obtain rice plants with reduced tillering, increased grain number per panicle, and reduced rice yield.

8. The application according to claim 7, characterized in that, In SB-1, the primers for PCR amplification include bHLH-OE-For1 and bHLH-OE-Rev1; The DNA sequence of bHLH-OE-For1 is shown in SEQ ID NO. 6; The DNA sequence of bHLH-OE-Rev1 is shown in SEQ ID NO.7.

Citation Information

Patent Citations

  • Application of MYB transcription factor OsMYBR17 gene for simultaneously promoting tillering and panicle development in increasing rice yield

    CN116814674A

  • Rice tillering regulation gene OsMAB and application of protein coded by rice tillering regulation gene OsMAB

    CN117512001A