Application of Fungus DBHCYZ-G2-1 and Its Extract in the Preparation of Antibacterial, Antioxidant or Antitumor Drugs

Abstract

The present invention discloses the application of the fungus DBHCYZ-G2-1 and its extract in the preparation of antibacterial, antioxidant or anti-tumor drugs. The advantages of the present invention are that for the first time, the endophytic fungi of the Zingiberaceae plant Costus afer were studied, and a Fusarium fungus Fusarium nirenbergiae DBHCYZ-G2-1 was obtained therefrom. And for the first time, the bioactivity evaluation and development and application research of its liquid extract were carried out. It was first found that the liquid extract of this strain of fungus has significant antibacterial and antioxidant activities and no obvious cytotoxicity. This finding suggests that the Fusarium fungus Fusarium nirenbergiae DBHCYZ-G2-1 provides a new fungal source for the research and development of new non-toxic antibacterial and antioxidant drugs. At the same time, the extract solution of this strain can be used to prepare natural preservatives, providing a scientific basis for the development and utilization of natural new antibacterial and antioxidant drugs and food preservatives derived from plant endophytic fungi.

Description

Technical Field

[0001] The present invention belongs to the field of endophytic fungi of medicinal plants, and particularly relates to the application of the fungus Fusarium nirenbergiae DBHCYZ-G2-1 and its extract in the preparation of antibacterial, antioxidant or antitumor drugs. Background Art

[0002] Endophytic fungi are a type of fungi that parasitize various tissues, organs and intercellular spaces of healthy plants at certain stages or all stages. They are the most potential resource treasure trove for discovering natural drug small molecules with novel structures and strong activities, and have a history of more than a hundred years. Since Strobel et al. isolated Taxomyces andreanae capable of producing paclitaxel from Taxus brevifolia, people have gradually regarded endophytic fungi as medicinal fungal resources to solve the drug source crisis. So far, scientists have isolated and discovered 171 genera of endophytic fungi from various medicinal plants, with as many as 1 million species. Endophytic fungi of plants have the characteristics of a large number of species, scalable fermentation, short culture cycles, and close ecological relationships with other organisms. Their secondary metabolites often exhibit diverse biological activities, including anti-tumor, anti-inflammatory, antibacterial, antioxidant, immunomodulatory, hypoglycemic, and hepatoprotective effects.

[0003] In recent years, finding endophytic fungi that can produce bioactive substances from medicinal plants has increasingly become a new research hotspot in microbiology and natural medicine chemistry. However, despite a lot of work done on the species, ecological distribution, metabolites, etc. of plant endophytic fungi, there is still a lack of comprehensive and systematic research. On the one hand, with the continuous increase in super-resistant bacteria caused by the abuse of traditional antibiotics, there is an urgent need to obtain antibacterial lead drug molecules with stronger targeting and therapeutic activities; on the other hand, with the increasing living standards of the people, healthy and nutritious fruit juice beverages are favored by consumers. Fruit juice is rich in nutrients and is easily contaminated by microorganisms and causes quality changes. Spoiled fruit juice not only causes waste of resources, but is more likely to cause poisoning, damage health, and affect consumption. Therefore, anti-corrosion and antibacterial inhibition have always been the top issues in the preservation and transportation of fruit juice. Currently, methods such as freezing, refrigeration, and chemical preservatives are generally used for preservation. However, chemical preservatives frequently issue safety alerts, indicating that finding natural, non-toxic and safe anti-corrosion and antibacterial agents is also of great significance in the food field. Therefore, using endophytic fungi of medicinal plants as a natural bioactive drug molecule screening resource treasure trove has important research value for the development of natural new antibacterial drugs and food anti-corrosion and preservation agents.

[0004] Costus lucanusianus J.Braun et K.Schum, also known as Costus pictus D.Don var. lucanusianus (J.Braun & K.Schum.) S.Y.Hu, is a plant of the genus Costus in the family Costaceae. It is native to tropical Africa and has been introduced by the South China Botanical Garden of the Chinese Academy of Sciences for garden ornamental purposes. The seedlings of Costus lucanusianus J.Braun et K.Schum are edible, and its leaves, flowers, fruits, stems, and roots are used as traditional medicines to treat fevers, measles, mumps, diabetes, rheumatism, ulcers, etc., but there is a lack of sufficient scientific evidence. According to literature reports, the aqueous extract of the leaves of Costus lucanusianus J.Braun et K.Schum has certain antioxidant activity, and two new steroid compounds have been found in the study of its chemical constituents. Among them, the compound 3,27-dihydroxy-1-methoxy-22-cholest-5-enone shows strong antibacterial activity against S. aureus, E. coli, and B. subtilis, etc.

[0005] Currently, there is no relevant research report on the endophytic fungi of Costus lucanusianus J.Braun et K.Schum. Summary of the Invention

[0006] The purpose of the present invention is to provide a preparation method of an endophytic fungal extract with the efficacy of antibacterial and anti-corrosion of fruit juice. At the same time, based on the extracted crude endophytic fungal extract, biological activity screening such as antibacterial, cytotoxic, and antioxidant activities has been carried out, as well as the application and development as a preservative and antibacterial agent for coconut juice.

[0007] Our research group previously carried out research on the endophytic fungi of Costus lucanusianus J.Braun et K.Schum. Through the isolation, purification, and identification of plant endophytic fungi, we obtained a strain of Fusarium nirenbergiae DBHCYZ-G2-1. No reports on the secondary metabolites and extract activities of this strain were found in the literature research. Therefore, we first carried out biological activity screening on the liquid fermentation extract of this strain. It was found that the extract of the liquid fermentation of DBHCYZ-G2-1 has relatively significant antibacterial and antioxidant activities, and at the same time has no obvious cytotoxicity. This indicates that the strain Fusarium nirenbergiae DBHCYZ-G2-1 has important theoretical guiding significance in the research and development of new non-toxic antibacterial and antioxidant drugs, and in enriching the endophytic fungal library of Zingiberaceae plants. At the same time, the extract of this strain shows a particularly significant bactericidal effect on the sterile coconut juice infected with S. aureus, and can be used to prepare natural preservatives, providing a scientific basis for the development and utilization of natural new food preservatives derived from plant endophytic fungi.

[0008] Therefore, the first object of the present invention is to provide the use of Fusarium nirenbergiae DBHCYZ-G2-1, its fermentation broth, its mycelium, or the organic solvent extract of its fermentation broth and mycelium in the preparation of antibacterial, anti-tumor drugs or antioxidant preparations.

[0009] Preferably, the antibacterial drug is a drug against Gram-positive bacteria such as Staphylococcus aureus, Methicillin-resistant Staphylococcus aureus, and Escherichia coli.

[0010] Preferably, the anti-tumor effect is against lung cancer or cervical cancer.

[0011] Preferably, the antioxidant preparation is an antioxidant drug or an antioxidant cosmetic.

[0012] Preferably, the antibacterial effect is for preservation. More preferably, it is for the preservation of coconut water. That is, it has a rapid bactericidal effect on coconut water infected with S. aureus.

[0013] Preferably, the fermentation broth and mycelium are fermentation cultures obtained by inoculating Fusarium nirenbergiae DBHCYZ-G2-1 into a medium in which the strain can grow, and then separating to obtain the fermentation broth and mycelium. The medium is further preferably a PDB medium. The preparation method per liter of the PDB medium is as follows: Boil 200 g of potatoes with 300 mL of pure water for 20 min, filter to obtain potato juice, then add 20 g of glucose, 3 g of KH2PO4, 1.5 g of MgSO4, 10 mg of vitamin B1, and add water to make up to 1000 mL, and sterilize to obtain.

[0014] Preferably, when culturing in the medium, the culture conditions are culturing at 28 °C and 120 r / min, and more preferably culturing for 7 days.

[0015] Preferably, the organic solvent is ethyl acetate.

[0016] Preferably, the organic solvent extract is obtained by adding the fermentation broth to ethyl acetate, mixing well and pouring it into a separating funnel for extraction, allowing it to stand until obvious stratification occurs, opening the piston of the separating funnel, collecting the ethyl acetate layer of the fermentation broth to obtain the bacterial liquid extract; at the same time, ultrasonically extracting the mycelium with ethyl acetate, filtering to obtain the mycelium extract, combining the bacterial liquid extract and the mycelium extract, and performing vacuum concentration to obtain the ethyl acetate extract.

[0017] Preferably, the extraction temperature is 25 to 30 °C.

[0018] Preferably, the extraction is carried out 3 to 5 times.

[0019] Preferably, the temperature of the vacuum concentration under reduced pressure is 50 to 60 °C.

[0020] The second object of the present invention is an antibacterial, anti-tumor drug or antioxidant preparation, which contains Fusarium nirenbergiae DBHCYZ-G2-1, its fermentation broth, its mycelium or the ethyl acetate extract of its fermentation broth and mycelium as an active ingredient.

[0021] Preferably, the antibacterial drug is a drug against Gram-positive bacteria such as Staphylococcus aureus, Methicillin-resistant Staphylococcus aureus and Escherichia coli.

[0022] Preferably, the antioxidant drug is a drug that can efficiently scavenge DPPH free radicals.

[0023] The preparation method of the extract of the Fusarium fungus F. nirenbergiae DBHCYZ-G2-1 of the present invention has the following advantages:

[0024] (1) The research object of the present invention is a fungal extract, and the repeatability is high;

[0025] (2) The extraction yield is high, the solvent residue is less, and it can be fermented and produced on different scales.

[0026] The extract of the Fusarium fungus F. nirenbergiae DBHCYZ-G2-1 prepared by the present invention has the following biological activity characteristics:

[0027] (1) When the extract of the Fusarium fungus F. nirenbergiae DBHCYZ-G2-1 prepared by the present invention is at 0.125 mg / mL, it has a significant inhibitory effect on S. aureus. At 0.25 mg / mL, it has an obvious bactericidal effect on both MRSA and E. coli.

[0028] (2) When the extract of the Fusarium fungus F. nirenbergiae DBHCYZ-G2-1 prepared by the present invention is at a concentration of 0.1 mg / mL, the scavenging rate of DPPH free radicals is 50.63%, showing medium-strength antioxidant activity.

[0029] (3) The extract of the Fusarium fungus F. nirenbergiae DBHCYZ-G2-1 prepared by the present invention has an extremely significant antibacterial rate at a concentration of 20 times the MIC value, and can completely kill the SA colonies infected with coconut juice within 24 hours.

[0030] The advantages of the present invention are that for the first time, the endophytic fungi of the Costaceae plant African spiral flag were studied, and a Fusarium fungus F. nirenbergiae DBHCYZ-G2-1 was obtained from it. And for the first time, the biological activity evaluation and development and application research of its liquid extract were carried out. It was first found that the liquid extract of this strain of fungus has significant antibacterial and antioxidant activities, and has no obvious cytotoxicity. This finding suggests that the Fusarium fungus F. nirenbergiae DBHCYZ-G2-1 provides a new fungal source for the research and development of new non-toxic antibacterial and antioxidant drugs. At the same time, the extract of this strain can be used to prepare natural preservatives, providing a scientific basis for the development and utilization of natural new antibacterial and antioxidant drugs and food preservatives from plant endophytic fungi. Description of the Drawings

[0031] Figure 1 are the morphologies of the Costaceae plant African spiral flag and the endophytic fungus F. nirenbergiae DBHCYZ-G2-1;

[0032] Figure 2 are the antibacterial effects of the extract of DBHCYZ-G2-1 against S. aureus, MRSA and E. coil;

[0033] Figure 3 are the MIC values of the extract of DBHCYZ-G2-1 against S. aureus, MRSA and E. coil;

[0034] Figure 4 are the results of the anti-corrosion and antibacterial of the extract of DBHCYZ-G2-1 against S. aureus-infected coconut water; Detailed Embodiments

[0035] The following examples are further descriptions of the present invention, rather than limitations on the present invention.

[0036] Example 1

[0037] 1. Isolation, purification and identification of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 of the Costaceae plant African spiral flag

[0038] The African spiral flag plant of the present invention was collected from the Ginger Garden of the South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, Guangdong Province on December 22, 2023. The healthy leaves of the African spiral flag were washed and subjected to programmed surface disinfection using the endophytic fungus isolation method. Take blank Petri dishes and pour 75% alcohol × 1, sterile water × 3, 3% sodium hypochlorite × 1, and sterile water × 3 respectively. Put the sample into the alcohol dish for 1 min, pass through three waters, put it into the sodium hypochlorite dish and soak for about 30 s, and then pass through three waters. Take the culture medium dish, cut the tissue into pieces, and plant it on a (PDA) potato dextrose agar medium (added with a penicillin-streptomycin mixture to prevent bacterial growth, with the working concentration of penicillin being 100 U / mL and streptomycin being 0.1 mg / mL) plate, and culture it in an incubator at 28°C. Regularly observe the endophytic fungus colonies growing from the tissue incisions, and pick them out in a timely manner and purify them 2-3 times to obtain endophytic fungi with single colonies. Take plant samples and wash them with sterile water and 75% alcohol, and sample from different positions. Put three samples in each culture medium, seal the culture medium, mark the date and number, and then put it into the incubator for culture. After 1-2 days of constant temperature culture, observe the colonies and their morphology, and sieve them with a new culture medium dish ( Figure 1 ).

[0039] 2. Identification of the endophytic fungus Fusarium nirenbergiae DBHCYZ-G2-1 of the African spiral flag

[0040] At room temperature, scrape the fungal sample from the culture medium with an inoculation loop or a cell scraper and transfer it to a mortar. Extract the total DNA of the strain according to the operating steps of the fungal DNA extraction kit (Magen). Then, use the total DNA as a template for PCR amplification and detect the target bands of the amplification results by agarose gel electrophoresis, and send them for sequencing. Subsequently, through BLAST comparison in the NCBI database, the above sequenced strains were preliminarily identified. Finally, based on the results of molecular biology identification and combined with the morphological characteristics of the strains, it was determined that the strain was the fungus Fusarium nirenbergiae DBHCYZ-G2-1 of the genus Fusarium, and its GenBank number was PQ060430. The strain was preserved in Room 324, Building 2, Research Area of the South China Botanical Garden, Chinese Academy of Sciences. The applicant guarantees to provide it to the public within 20 years from the application date.

[0041] The base sequence of this strain is:

[0042] GTGGGGCTTCGAGCTTCACTCCCAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGA

[0043] TCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTA

[0044] TATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGT

[0045] TCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAG

[0046] TGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGT

[0047] TCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTT

[0048] CCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTAC

[0049] TGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAG

[0050] GTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

[0051] Example 2

[0052] 1. Liquid fermentation of the endophytic fungus Fusarium nirenbergiae DBHCYZ-G2-1 from Heliconia caribaea

[0053] The endophytic fungus Fusarium nirenbergiae DBHCYZ-G2-1 preserved in 30% glycerol water was inoculated onto potato dextrose agar medium (PDA) and cultured in an incubator at 28 °C for 3 - 4 days for strain activation. Subsequently, the activated mycelia were inoculated into 150 L of potato dextrose liquid medium (each liter of the medium was prepared by the following method: 200 g of potatoes were boiled in 300 mL of pure water for 20 min, filtered to obtain potato juice, then 20 g of glucose, 3 g of KH2PO4, 1.5 g of MgSO4, and 10 mg of vitamin B1 were added, and water was added to make up to 1000 mL, sterilized to obtain), and cultured at 28 °C and 120 r / min for 7 days to obtain the liquid fermentation culture of DBHCYZ-G2-1.

[0054] 2. Preparation of Liquid Fermentation Extract of Endophytic Fungus Fusarium nirenbergiae DBHCYZ-G2-1 from Heliconia rostrata

[0055] The liquid fermentation culture of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 from Heliconia rostrata was filtered through three layers of gauze to obtain the bacterial liquid and mycelium respectively. The bacterial liquid was added to three times its volume of ethyl acetate, mixed well and poured into a separatory funnel. After standing until obvious stratification occurred, the piston of the separatory funnel was opened to collect the ethyl acetate layer, obtaining the mycelium extract; at the same time, the mycelium was subjected to ultrasonic extraction with organic solvents for 30 min at a material ratio of mycelium:ethyl acetate of 1 g:30 mL, and the bacterial liquid extract was obtained by filtration. The above extraction steps were repeated 3 times, and the bacterial liquid extract and the mycelium extract were combined and concentrated under vacuum (temperature not exceeding 60 °C) to obtain the extract of liquid fermentation of DBHCYZ-G2-1.

[0056] Example 3: Evaluation of Antibacterial Activity of Extract of Endophytic Fungus F. nirenbergiae DBHCYZ-G2-1 from Heliconia rostrata

[0057] In this example, Gram-positive bacteria such as Staphylococcus aureus (SA), Methicillin-resistant Staphylococcus aureus (MRSA), and Escherichia coli (EC) were used as the research objects, and the minimum inhibitory concentration (MIC) value was observed and determined by the microdilution method and the resazurin colorimetric method. Resazurin colorimetric reagent can be reduced from blue to pink in the cytoplasm, and the decrease of the colorimetric reagent can intuitively reflect the increase of the number of bacteria. Therefore, the minimum inhibitory concentration (MIC) of the active sample can be determined according to the observed color change of each well solution.

[0058] In the experiment, three test strains were first activated (the strains preserved in 20% glycerol were inoculated into MHB medium and cultured at 37 °C for 12 h). Then, the extract of liquid fermentation of DBHCYZ-G2-1 was diluted to OD = 0.07, that is, the bacterial liquid concentration was 1×10 8 CFU / mL. 7.5 mL of the indicator solution (100 μg / mL aqueous solution of resazurin) was mixed with 5 mL of the test bacterial solution (10 8Mix well (CFU / mL), add 180 μL of the above suspension to the first row of a 96-well plate, and add 100 μL successively to each row from the second to the eighth row. Subsequently, add 20 μL of the crude extract working solution (1 mg / mL), positive control, and negative control to the first row of the 96-well plate in sequence. After mixing the test sample with 180 μL of the suspension, take out 100 μL of it and transfer it to the second row for mixing evenly, then take 100 μL from the second row and transfer it to the third row for mixing evenly. Dilute the samples in rows three to eight successively by a two-fold serial dilution method in this way. Finally, place the 96-well plate in an incubator at 37 °C for 6 - 12 h, observe the color change of resazurin, and determine the MIC value of the test sample. When the bacterial solution turns red, it indicates no antibacterial activity; when it turns blue, it indicates antibacterial activity. The lowest dilution concentration at which the bacterial solution remains blue is considered the minimum inhibitory concentration of the compound to be tested. Each sample is prepared in 2 parallel aliquots, and vancomycin is used as the positive control drug.

[0059] The results show that: the extract from the liquid fermentation of DBHCYZ-G2-1 in Example 2 has obvious antibacterial activity against Gram-positive bacteria. At 0.125 mg / mL, it has a significant inhibitory effect on S. aureus. In addition, the extract from the liquid fermentation of DBHCYZ-G2-1 has obvious bactericidal effects on Methicillin-resistant S. aureus and E. coli at 0.25 mg / mL. The above results indicate that the extract of F. nirenbergiae DBHCYZ-G2-1 has good application prospects in antibacterial and anti-corrosion aspects. The specific experimental results are as Figure 2 、 3 and shown in Table 1.

[0060] Table 1. MIC values of the extract of DBHCYZ-G2-1 against S. aureus, MRSA and E. coil

[0061]

[0062] Example 4: Antibacterial activity test of the extract of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 from Ananas comosus

[0063] In this example, the DPPH free radical scavenging method was used to test the in vitro antioxidant activity of the DBHCYZ-G2-1 extract. The main basis is to evaluate the antioxidant activity of the test sample based on the color change of the DPPH free radical solution.

[0064] First, using absolute ethanol as a solvent, DPPH was prepared into a 0.1 mmol / L solution and stored in the dark. Using DMSO as a solvent, the positive control vitamin C was serially diluted into working solutions of 500, 250, 125, 62.5, 31.25, and 15.625 μM. The extract from the liquid fermentation of DBHCYZ-G2-1 was prepared into a 1000 μg / mL working solution. Then, 4 wells of the crude extract sample, 4 wells for each concentration of the positive drug, and 8 wells of the negative control DMSO were added to a 96-well plate, 10 μL / well. 90 μL of the DPPH solution was added to 3 of the replicate sample wells, and 90 μL of the methanol solution was added to the other 1 well. After standing in the dark at room temperature for 30 min, the absorbance A of the sample at 517 nm was measured, and the absorbance value was measured with a microplate reader at 517 nm to calculate the inhibition rate.

[0065] Calculation formula: Inhibition(%) = [1 - (OD 样品 - OD 样品对照 ) / (OD 阴性对照 - OD 空白对照 )] × 100.

[0066] The results of the antioxidant activity test showed that: the DPPH radical scavenging rate of the extract from the liquid fermentation of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 of African spiral flag in Example 1 was 50.63%, showing moderate antioxidant activity (Table 2), suggesting that the extract from the liquid fermentation of F. nirenbergiae DBHCYZ-G2-1 not only has application value in anti-corrosion and preservation, but also provides new endophytic fungal resources for the discovery of antioxidant lead compounds.

[0067] Table 2. Evaluation results of the antioxidant activity of the crude extract

[0068]

[0069] Example 4: Antibacterial activity test of the extract of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 of African spiral flag

[0070] The MTT method was used to test the cytotoxicity of the extract from the liquid fermentation of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 of African spiral flag.

[0071] 1. Reagents for the test: The extract from the liquid fermentation of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 prepared in the present invention was dissolved in dimethyl sulfoxide (DMSO) to obtain a stock solution with a concentration of 100 mg / mL, and then diluted to the required concentration with PBS. The positive control was doxorubicin.

[0072] The tumor cell lines used in this experiment were human non-small cell lung cancer cells (A549) and human cervical cancer cells (Hela).

[0073] 2. Experimental method: Take human non-small cell lung cancer cells (A549) and human cervical cancer cells (Hela) in the logarithmic growth phase, digest them with trypsin, count them by trypan blue staining, and after detecting that the cell viability is greater than 95% by the trypan blue exclusion test, adjust the cell concentration to 1×10 4 cells / mL with fresh DMEM medium. Pick appropriate cells and inoculate them into 96-well plates, add 90 μL of cell suspension to each well, and at the same time set up 3 blank wells as controls for zero adjustment. Culture them in an incubator at 37°C and 5% CO2 for 24 h. After the cells adhere to the wall, add 10 μL of the DMSO solution of the extract from the liquid fermentation of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 of African spiral flag at a concentration of 1 mg / mL to each well. Add 10 μL of DMSO / DMEM dilution (the DMSO concentration is less than 0.5% after entering the well) to the negative control, use doxorubicin as the positive control, and set three replicates. After culturing in an incubator at 37°C and 5% CO2 for 72 h, add 10 μL of MTT solution (5 mg / mL) to each well and incubate in an incubator at 37°C for 4 h. Discard the cell culture medium, add 100 μL of DMSO solution to each well, measure the absorbance at 490 nm, and calculate the inhibition rate according to the absorbance.

[0074] Calculation formula: Inhibition(%) = [1 - (A 样品 - A 空白 ) / (A 对照 - A 空白 )] × 100

[0075] The results of the cytotoxicity test showed that the inhibition rates of the extract from the liquid fermentation of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 of African spiral flag in Example 1 on non-small cell lung cancer cells (A549) and human cervical cancer cells (Hela) were 17.99% and 29.65% respectively (Table 3), which were quite different from the positive drug doxorubicin. The above results indicated that the extract of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 had no obvious cytotoxicity. It was suggested that the extract from the liquid fermentation of F. nirenbergiae DBHCYZ-G2-1 had a certain safety guarantee for application and development as an antibacterial and antiseptic product.

[0076] Table 3. Results of cytotoxicity evaluation of DBHCYZ-G2-1 extract

[0077]

[0078] Example 5: Antiseptic and Antibacterial Test of the Extract of Endophytic Fungus F. nirenbergiae DBHCYZ-G2-1 from African Helical Flag on Coconut Water

[0079] In this example, the plate colony counting method was used to evaluate the antibacterial and antiseptic effects of the extract of F. nirenbergiae DBHCYZ-G2-1 liquid fermentation on coconut water. The main basis was to measure the antibacterial effect by the difference in the number of colonies on the plate after the intervention of the extract of F. nirenbergiae DBHCYZ-G2-1 liquid fermentation and the blank group with the change of the culture days.

[0080] Add 30 μL of the activated S. aureus bacterial solution into a 50 mL centrifuge tube and shake it overnight at 200 rpm and 37 °C in a shaker. Dilute Staphylococcus aureus to 1×10 6 CFU / mL with sterile coconut water, and after diluting 1000 times, take 1 mL of the bacterial solution and co-culture it with the crude extract. The negative control does not contain an antibacterial agent, and the concentration of the crude extract is 20×MIC, and store it at 4 °C; the microbial concentration was measured on the 1st, 2nd, 3rd, and 4th days by the colony counting method. Take 1 mL of the bacterial solution in an EP tube, centrifuge at 3500 rpm for 6 min. After centrifugation, discard the supernatant, resuspend it with sterile coconut water, and adjust the bacterial solution concentration to OD 600 ≈0.07. Dilute the adjusted bacterial solution 1000 times. Take 1 mL of the diluted bacterial solution in an EP tube, add the F. nirenbergiae extract (at a concentration of 20×MIC), and place it in a 4 °C refrigerator for storage. Subsequently, take 100 μL of the bacterial solution on the first day, the second day, and the third day and spread it on a BHA plate, and incubate it in an inverted position in an incubator at 37 °C for 24 h. The microbial concentration was measured on the 1st, 2nd, 3rd, and 4th days by the colony counting method.

[0081] The experimental results of the antiseptic and antibacterial effects of the extract of F. nirenbergiae DBHCYZ-G2-1 liquid fermentation on coconut water showed that the extract of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 from African Helical Flag in Example 1 had very significant bactericidal and antiseptic activities. Under the intervention of a concentration of 20 times the MIC value, compared with the blank group, with the extension of the culture time, the number of S. aureus bacteria in the intervention group of the F. nirenbergiae DBHCYZ-G2-1 extract at 20 times the MIC value decreased significantly, and the antibacterial rate of the F. nirenbergiae extract was extremely significant, and the colonies could be completely killed after 24 h of intervention. The above results indicate that the extract of the endophytic fungus F. nirenbergiae DBHCYZ-G2-1 liquid fermentation from African Helical Flag has important application prospects in the application development of bactericidal and antiseptic products. The specific experimental results are as follows Figure 4 shown.

[0082] The above are only the preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as a limitation of the present invention. The protection scope of the present invention should be subject to the scope defined by the claims. For those of ordinary skill in the art, many improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as within the protection scope of the present invention.

Claims

1. Fusarium nirenbergiae Use of the organic solvent extract of the fermentation broth and mycelium of DBHCYZ-G2-1 in the preparation of antibacterial and antioxidant preparations; the antibacterial agent is against Staphylococcus aureus ( Staphylococcus aureus ), against methicillin-resistant Staphylococcus aureus (Methicillin-resistant Staphylococcus aureus ), and against Escherichia coli ( Escherichia coli ); the antioxidant preparation is an antioxidant drug or an antioxidant cosmetic; The fermentation broth and mycelia are obtained by inoculating Fusarium nirenbergiae DBHCYZ-G2-1 into a culture medium in which the strain can grow, culturing to obtain a fermentation culture, and separating to obtain the fermentation broth and mycelia; the culture medium is a PDB culture medium, and the preparation method per liter of the PDB culture medium is: boiling 200 g of potatoes with 300 mL of pure water for 20 min, filtering to obtain potato juice, then adding 20 g of glucose, 3 g of KH2PO4, 1.5 g of MgSO4, 10 mg of vitamin B1, adding water to make up to 1000 mL, and sterilizing to obtain;​ The organic solvent extract is obtained by adding the fermentation broth into ethyl acetate, mixing well, pouring the mixture into a separating funnel for extraction, allowing it to stand until obvious stratification occurs, opening the piston of the separating funnel, collecting the ethyl acetate layer of the fermentation broth to obtain the bacterial liquid extract; meanwhile, the mycelium is ultrasonically extracted with ethyl acetate, and the mycelium extract is obtained by filtration. The bacterial liquid extract and the mycelium extract are combined and concentrated under reduced pressure in vacuo to obtain the ethyl acetate extract.

2. The application according to claim 1, characterized in that, The antibacterial activity mentioned is for preservation.

3. The application according to claim 2, characterized in that The preservation mentioned is for coconut water.

4. The application according to claim 1, characterized in that Cultured in the said medium under the culture conditions of 28 °C and 120 r / min for 7 days.

5. The application according to claim 1, wherein The extraction temperature is 25 - 30 °C, and the extraction is carried out 3 - 5 times.

6. The application according to claim 1, characterized in that, For the concentration under reduced pressure in vacuo, the temperature is 50 - 60 °C.

Images