A WRN inhibitor

Abstract

This invention discloses a class of WRN inhibitor compounds as shown in formula (I), their uses, and pharmaceutical compositions containing them. These compounds exhibit strong inhibitory activity against WRN, thereby inhibiting related cancer cells.

Description

TECHNICAL FIELD

[0001] The present application relates to a compound capable of inhibiting WRN activity, uses thereof and pharmaceutical compositions containing the same. BACKGROUND

[0002] During the progression of cancer, the loss of DNA mismatch repair function often occurs, such as 10-30% of colorectal cancer, endometrial cancer, ovarian cancer and gastric cancer. Due to the loss of DNA mismatch repair function, the mutation burden of cancer cells is high, and deletions or insertions often occur in the repetitive sequence region of DNA, which is called microsatellite instability. Although progress has been made in the treatment of microsatellite instability-high (MSI-H) cancer, and pembrolizumab (PD-1 antibody) as a first-line treatment shows longer survival progression than chemotherapy for microsatellite instability-high / DNA mismatch repair function-deficient (MSI-H / dMMR) patients with advanced colorectal cancer, which makes pembrolizumab approved for first-line treatment of MSI-H / dMMR cancer, but there is still a need for clinical indications for colorectal cancer and other MSI-H.

[0003] Through large-scale functional genomics screens of multiple cell lines, including a Novartis analysis of 398 cell lines from the Cancer Cell Line Encyclopedia (CCLE) cell repository (McDonald E.R. et al., Project DRIVE: A Compendium of Cancer Dependencies and Synthetic Lethal Relationships Uncovered by Large-Scale, Deep RNAi Screening. Cell 170(3):577-592 (2017)), it was discovered that WRN (Werner syndrome protein) is a synthetic lethal dependency for cell lines with microsatellite hyperstability (MSI-H) due to loss of DNA mismatch function (Behan, F.M. et al. Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens. Nature 568, 511-516 (2019); Chan, E.M. et al. WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Nature 568, 551-556 (2019); Kategaya, L., Perumal, S.K., Hager, J.H. & Belmont, L.D. Werner syndrome helicase is required for the survival of cancer cells with microsatellite instability. iScience 13, 488-497 (2019); Lieb, S. et al. Werner syndrome helicase is a selective vulnerability of microsatellite instability-high tumor cells. Elife 8, e43333 (2019)). WRN is a synthetic lethal to MSI-H, and in cancer cells with loss of DNA mismatch repair function, loss of WRN inhibits cell proliferation, activates multiple DNA damage biomarkers, induces cell division arrest and apoptosis, but in cancer cells with intact DNA mismatch repair function, loss of WRN does not result in these outcomes.These findings suggest that WRN provides DNA repair and maintenance functions that are essential for the survival of MSI-H cancer cells. Recently, the mechanism by which MSI-H cells depend on WRN was elucidated: two-nucleotide TA repeat sequences are only unstable in MSI-H cells, can undergo large-scale expansion, and in turn form atypical DNA secondary structures that require WRN for unwinding (Van Wietmarschen, N. et al. Repeat expansions confer WRN dependency in microsatellite-unstable cancers. Nature 586, 292-298, 200.). In the absence of WRN (or when WRN unwinding function is inhibited), the expanded TA repeat sequences in MSI-H cells are cleaved by nucleases, leading to chromosomal breaks. Thus, inhibiting the unwinding enzyme function of WRN is an attractive therapeutic strategy for cancer cells that lack DNA mismatch function.

[0004] There remains a need for new methods of treating and treating cancer, particularly microsatellite-high (MSI-H) or DNA mismatch repair-deficient (dMMR) cancer, including colorectal, gastric, endometrial, or ovarian cancer. SUMMARY

[0005] The present application provides a compound of the following formula (I) or a pharmaceutically acceptable salt thereof:

[0006]

[0007] wherein R1and R2are each independently hydrogen or halogen;

[0008] R3is -OH, -NH(CO)-CH3, -NH(CO)-fluoromethyl, -NH(CO)-C 1-3 haloalkyl; 1-3 haloalkyl;

[0009] R4is hydrogen or C 1-3 alkyl;

[0010] R5is hydrogen or C 1-3 alkoxy.

[0011] In a preferred embodiment, R1and R2are each independently hydrogen or fluorine; R3is -OH, -NH(CO)-CH3, -NH(CO)-fluoromethyl; R4is hydrogen or methyl; and R5is hydrogen or -OCH3.

[0012] In a more preferred embodiment, R3is -OH, -NH(CO)-CH3, -NH(CO)-CF3.

[0013] The compound or its pharmaceutically acceptable salt described in this invention may be any of the following compounds:

[0014]

[0015] This invention also provides the use of the compounds shown above or pharmaceutically acceptable salts thereof in the preparation of WRN inhibitors. This use includes the use in the treatment of colorectal cancer, gastric cancer, endometrial cancer, or ovarian cancer.

[0016] The present invention also provides a pharmaceutical composition comprising the compound shown above or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0017] As described herein, the term "pharmaceutically acceptable salt" refers to a pharmaceutically acceptable organic or inorganic salt of the compounds of the present invention. Detailed Implementation

[0018] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0019] Example 1 EVO32651

[0020]

[0021]

[0022] Step 1:

[0023] At room temperature, p-nitrobenzoyl chloride (1.61 g, 8.66 mmol) was added to a 20 mL solution of 3-aminobenzenesulfonic acid (1.50 g, 8.66 mmol) in dichloromethane. N,N-diisopropylethylamine (1.49 g, 11.55 mmol) was added dropwise while the reaction mixture was stirred at room temperature for 4 hours. The solvent was removed by concentration under reduced pressure to obtain a yellow solid EVO32651-C1 (2.70 g). This product was used directly in the next step without further separation. LCMS (ESI) m / z = 321.0 [MH] - .

[0024] Step 2:

[0025] At room temperature, Pd (10% on carbon) (270.00 mg, 2.54 mmol) was added to a methanol solution (30 mL) of intermediate EVO32651-C1 (2.70 g, 8.38 mmol). The mixture was purged with a hydrogen balloon five times, and the reaction solution was stirred at room temperature for 3 hours. The reaction solution was filtered to remove palladium on carbon, concentrated to remove the solvent, and a yellow solid EVO32651-C2 (2.40 g) was obtained. This product was used directly in the next step without further separation. LCMS (ESI) m / z = 291.0 [MH] - .

[0026] Step 3:

[0027] At room temperature, N,N-diisopropylethylamine (707.43 mg, 5.47 mmol) and acryloyl chloride (272.48 mg, 3.01 mmol) were added dropwise to a 15 mL solution of intermediate EVO32651-C2 (800.00 mg, 2.74 mmol) in dichloromethane with stirring. The reaction mixture was stirred overnight at room temperature. The solvent was removed by concentration under reduced pressure, and the residue was purified by preparative high-performance liquid chromatography (HPLC) to obtain a white solid EVO32651 (15.40 mg, yield 1.62%). LCMS (ESI) m / z = 346.9 [M+H] + . 1 H NMR(400MHz,DMSO-d6)δ10.46(s,1H),10.22(s,1H),8.06-7.99(m,3H),7.88-7.80(m,3H),7.39-7.2 8(m,2H), 6.50(dd,J=16.9,10.1Hz,1H), 6.34(dd,J=17.0,2.0Hz,1H), 5.84(dd,J=10.0,2.0Hz,1H).

[0028] Example 2 EVO32676

[0029]

[0030] Step 1:

[0031] At room temperature, thionyl chloride (1.61 g, 13.51 mmol) was added to 3-fluoro-4-nitrobenzoic acid (500.00 mg, 2.70 mmol), and one drop of N,N-dimethylformamide was added dropwise with stirring at room temperature. The reaction mixture was heated to 80°C and stirred for 4 hours. TLC (petroleum ether / ethyl acetate = 1 / 1) showed that the starting material reacted completely. The product was concentrated under reduced pressure to obtain a yellow oily liquid EVO32676-A1 (550.00 mg). The product was used directly in the next step without further separation.

[0032] Step 2:

[0033] At room temperature, 3-aminobenzenesulfonic acid (467.95 mg, 2.70 mmol) and N,N-diisopropylethylamine (698.42 mg, 5.40 mmol) were added to a 15 mL solution of dichloromethane containing compound EVO32676-A1 (550.00 mg, crude product). The reaction mixture was stirred overnight at room temperature. The reaction was monitored by LC-MS until completion. The product was concentrated under reduced pressure to obtain a yellow solid, EVO32676-A2 (1.40 g). This product was used directly in the next step without further separation. LCMS (ESI) m / z = 339.2 [MH] - .

[0034] Step 3:

[0035] At room temperature, reduced iron powder (410.28 mg, 7.35 mmol) and ammonium chloride (392.99 mg, 7.35 mmol) were added to a mixed solution of compound EVO32676-A2 (0.50 g, crude) in 10 mL of ethanol and 2 mL of water. The reaction solution was heated to 80°C and stirred overnight. TLC (dichloromethane / methanol = 10 / 1) indicated that the reactants had largely reacted. The mixture was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure, the pH was adjusted to approximately 9 with saturated sodium bicarbonate, extracted with ethyl acetate, washed with saturated brine, and concentrated under reduced pressure to obtain a yellow oily liquid. The liquid was then purified under medium pressure to obtain a yellow solid EVO32676-A3 (150.00 mg, yield 32.90%). LCMS (ESI) m / z = 309.2 [MH] - .

[0036] Step 4:

[0037] At room temperature, acryloyl chloride (35.00 mg, 386.72 μmol) and sodium hydroxide (18.56 mg, 464.07 μmol) were added to a mixed solution of tetrahydrofuran (10 mL) and water (3 mL) of compound EVO32676-A3 (120.00 mg, 386.72 μmol). The reaction mixture was heated to 80 °C and stirred for 24 hours. LC-MS monitoring showed the formation of the target product. The mixture was concentrated under reduced pressure, and the residue was added to trifluoroacetic acid (1 mL). The mixture was stirred at room temperature for 1 hour, concentrated under reduced pressure, and the residue was purified under medium pressure to obtain a yellow solid. This was further purified by high-performance liquid chromatography to obtain a white solid EVO32676 (3.50 mg, yield 2.48%). LCMS (ESI) m / z = 363.3 [MH] - . 1H NMR (400MHz, DMSO-d6): δ10.30(s,1H),10.23(s,1H),8.29(t,J=8.2Hz,1H),8.03(t,J=1.9Hz,1H),7.95(dd,J=12.0,2.0Hz,1H), 7.91-7.84(m,2H),7.40-7.29(m,2H),6.73(dd,J=17.0,10.2Hz,1H),6.35(dd,J=17.0,1.9Hz,1H),5.85(dd,J=10.2,1.9Hz,1H).

[0038] Example 3 EVO32678

[0039]

[0040] Step 1:

[0041] At room temperature, thionyl chloride (3.21 g, 27.01 mmol) was added to 2-fluoro-4-nitrobenzoic acid (1.00 g, 5.40 mmol), and one drop of N,N-dimethylformamide was added dropwise with stirring at room temperature. The reaction mixture was heated to 80°C and stirred for 4 hours. TLC (petroleum ether / ethyl acetate = 1 / 1) showed that the starting material reacted completely. The product was concentrated under reduced pressure to obtain a yellow oily liquid EVO32678-A1 (1.30 g). The product was used directly in the next step without further separation.

[0042] Step 2:

[0043] At room temperature, 3-aminobenzenesulfonic acid (425.41 mg, 2.46 mmol) and N,N-diisopropylethylamine (634.93 mg, 4.91 mmol, 855.70 μL) were added to a 15 mL solution of compound EVO32678-A1 (500.00 mg, crude) in dichloromethane. The reaction mixture was stirred overnight at room temperature. The reaction was monitored by LC-MS until completion. The product was concentrated under reduced pressure to obtain a yellow solid EVO32678-A2 (1.30 g). This product was used directly in the next step without further separation. LCMS (ESI) m / z = 339.2 [MH] - .

[0044] Step 3:

[0045] At room temperature, reduced iron powder (1.07 g, 19.10 mmol) and ammonium chloride (1.02 g, 19.10 mmol) were added to a mixed solution of compound EVO32678-A2 (1.30 g, crude product) in ethanol (10 mL) and water (2 mL). The reaction solution was heated to 80°C and stirred overnight. TLC (dichloromethane / methanol = 10 / 1) indicated that the reactants had basically reacted completely. The mixture was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure, the pH was adjusted to approximately 9 with saturated sodium bicarbonate, extracted with ethyl acetate, washed with saturated brine, and concentrated under reduced pressure to obtain a yellow oily liquid. The liquid was purified under medium pressure to obtain a yellow solid EVO32678-A3 (600.00 mg, yield 50.61%). LCMS (ESI) m / z = 309.2 [MH] - .

[0046] Step 4:

[0047] At room temperature, N,N-diisopropylethylamine (104.13 mg, 805.67 μmol) and acryloyl chloride (72.92 mg, 805.67 μmol) were added to a 10 mL solution of compound EVO32678-A3 (250.00 mg, 805.67 μmol) in dichloromethane. The reaction mixture was stirred at room temperature for 4 hours. LC-MS monitoring showed the formation of the target product. The product was concentrated under reduced pressure to obtain a yellow solid, which was then purified by high-performance liquid chromatography to obtain a white solid EVO32678 (42.00 mg, yield 14.31%). LCMS (ESI) m / z = 363.0 [MH] - . 1 H NMR (400MHz, DMSO-d6): δ10.58(s,1H),10.30(s,1H),7.98(t,J=1.9Hz,1H),7. 81(dd,J=12.9,1.9Hz,1H),7.73(dt,J=7.8,1.7Hz,1H),7.69(t,J=8.3Hz,1H),7 .46(dd,J=8.5,1.9Hz,1H),7.37-7.33(m,1H),7.30(t,J=7.7Hz,1H),6.47(dd,J =17.0, 10.0Hz, 1H), 6.34 (dd, J = 17.0, 2.0Hz, 1H), 5.85 (dd, J = 10.0, 2.1Hz, 1H).

[0048] Example 4 EVO32682

[0049]

[0050] Step 1:

[0051] Sodium hydroxide (5.82 g, 145.84 mmol) was added to a mixed solution of 4-aminobenzoic acid (10.00 g, 72.92 mmol) in tetrahydrofuran (50 mL) and water (30 mL) at room temperature. The reaction solution was cooled to 0°C, and acryloyl chloride (6.60 g, 72.92 mmol) was slowly added dropwise with stirring. After the addition was complete, the reaction solution was stirred at room temperature overnight. The reaction was monitored by LC-MS until completion. The solution was concentrated under reduced pressure, and the residue was adjusted to pH 3 with dilute hydrochloric acid. The mixture was filtered, and the dried filter cake was added to methanol (20 mL). The mixture was stirred at room temperature for 1 hour. The filter cake was then filtered and dried to give a white solid EVO32682-A1 (5.20 g, yield 37.3%). LCMS (ESI) m / z = 192.2 [M+H] + .

[0052] Step 2:

[0053] At room temperature, glacial acetic acid (445.52 mg, 7.42 mmol) and thionyl chloride (1.67 g, 12.36 mmol) were added to a 10 mL solution of 3-nitrobenzenesulfonamide (1.00 g, 4.95 mmol) in N-methylpyrrolidone. The reaction mixture was heated to 100 °C and stirred for 3 hours. LC-MS monitoring showed the formation of the target product. Water (30 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, concentrated under reduced pressure, and the residue was purified by medium-pressure preparative treatment to obtain a brown solid EVO32682-A2 (810.00 mg, yield 67.07%). LCMS (ESI) m / z = 243.1 [MH] - .

[0054] Step 3:

[0055] At room temperature, reduced iron powder (571.66 mg, 10.24 mmol) and ammonium chloride (547.56 mg, 10.24 mmol) were added to a mixed solution of compound EVO32682-A2 (500.00 mg, 2.05 mmol) in 10 mL of ethanol and 2 mL of water. The reaction solution was heated to 80°C and stirred overnight. LC-MS monitoring showed the formation of the target product. After diatomaceous earth filtration, the filtrate was concentrated under reduced pressure, and the residue was purified under medium pressure to obtain a brown solid EVO32682-A3 (170.00 mg, yield 38.76%). LCMS (ESI) m / z = 215.0 [M+H] + .

[0056] Step 4:

[0057] At room temperature, EVO32682-A3 (35.00 mg, 163.37 μmol) was added to a 5 mL solution of N-methylpyrrolidone containing compound EVO32682-A1 (31.23 mg, 163.37 μmol). The reaction mixture was heated to 60 °C and stirred overnight. LC-MS monitoring showed the formation of the target product. Water (10 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, concentrated under reduced pressure, and the residue was purified under medium pressure to obtain a brown solid. This was further purified by high-performance liquid chromatography to obtain a white solid EVO32682 (9.20 mg, yield 14.54%). LCMS (ESI) m / z = 388.0 [M+H] + . 1 H NMR (400MHz, DMSO-d6): δ10.54(s,1H),10.35(s,1H),8.18(s,1H),8.02(d,J=8.7Hz,2H),7.98-7.93(m,1H),7.84(d,J=8.8Hz,2H),7.50(d, J=7.7Hz,1H),7.40(t,J=7.9Hz,1H),6.53(dd,J=17.0,10.1Hz,1H),6.33(dd,J=17.0,2.0Hz,1H),5.84(dd,J=10.1,2.0Hz,1H),1.74(s,3H).

[0058] Example 5 EVO32683

[0059]

[0060] Step 1:

[0061] At room temperature, thionyl chloride (8.15 g, 68.55 mmol) was added dropwise to a toluene solution (7 mL) of m-nitrobenzoic acid (500.00 mg, 2.99 mmol) with stirring. The reaction mixture was heated to 80°C and stirred overnight. The solution was concentrated under reduced pressure to obtain a yellow solid EVO32683-A1 (555.00 mg). The product was used directly in the next step without further separation.

[0062] Step 2:

[0063] At room temperature, N,N-diisopropylethylamine (773.10 mg, 5.98 mmol) was added dropwise to a 10 mL solution of intermediate EVO32683-A1 (555.00 mg, crude) and 3-aminobenzenesulfonic acid (517.99 mg, 2.99 mmol) in dichloromethane with stirring. The reaction mixture was stirred at room temperature for 3 hours. The solvent was removed by concentration under reduced pressure to obtain a yellow solid EVO32683-A2 (963.00 mg). The product was used directly in the next step without further separation. LCMS (ESI) m / z = 321.3 [MH] - .

[0064] Step 3:

[0065] At room temperature, Pd (10% on carbon) (150.00 mg, 1.41 mmol) was added to a methanol solution (10 mL) of intermediate EVO32683-A2 (963.00 mg, crude product). The mixture was purged with hydrogen five times, and the reaction solution was stirred overnight at room temperature. The reaction solution was filtered to remove palladium on carbon, and the solvent was removed by concentration under reduced pressure to obtain a yellow solid EVO32683-A3 (873.00 mg). The product was used directly in the next step without further separation. LCMS (ESI) m / z = 293.1 [M+H] + .

[0066] Step 4:

[0067] At room temperature, N,N-diisopropylethylamine (132.64 mg, 1.03 mmol) and acryloyl chloride (92.89 mg, 1.03 mmol) were added dropwise to a 10 mL solution of intermediate EVO32683-A3 (300.00 mg, crude) in dichloromethane with stirring. The mixture was stirred at room temperature for 2 hours. The solvent was removed by concentration under reduced pressure, and the solution was purified by preparative high-performance liquid chromatography (HPLC) to obtain a white solid EVO32683 (112.90 mg, yield 31.76%). LCMS (ESI) m / z = 345.3 [MH] - . 1H NMR(400MHz,DMSO-d6)δ10.40(s,1H),10.35(s,1H),8.16(t,J=2.0Hz,1H),8 .06(t,J=1.9Hz,1H),8.00(dd,J=8.0,2.2Hz,1H),7.82(dt,J=7.7,1.8Hz,1H ),7.76-7.69(m,1H),7.50(t,J=7.9Hz,1H),7.39-7.30(m,2H),6.49(dd,J=1 7.0, 10.1Hz, 1H), 6.32 (dd, J = 17.0, 2.0Hz, 1H), 5.82 (dd, J = 10.1, 2.1Hz, 1H).

[0068] Example 6 EVO32695

[0069]

[0070]

[0071] Step 1:

[0072] Sodium carbonate (312.93 mg, 2.95 mmol) was added to a 20 mL solution of p-aminoanisole-2-sulfonic acid (300.00 mg, 1.48 mmol) and p-nitrobenzoyl chloride (273.94 mg, 1.48 mmol) in acetonitrile while stirring. The reaction mixture was stirred at room temperature for 3 hours. The solvent was removed by concentration under reduced pressure to obtain a white solid EVO32695-A1 (788.00 mg). The product was used directly in the next step without further separation. LCMS (ESI) m / z = 351.2 [MH] - .

[0073] Step 2:

[0074] At room temperature, Pd (10% on carbon) (52.00 mg, 488.63 μmol) was added to a methanol solution (20 mL) of intermediate EVO32695-A1 (520.00 mg, crude product). The mixture was purged with hydrogen five times, and the reaction solution was stirred at room temperature for 3 hours. The reaction solution was filtered to remove palladium on carbon, and the solvent was removed by concentration under reduced pressure to obtain a white solid EVO32695-A2 (450.00 mg). The product was used directly in the next step without further separation. LCMS (ESI) m / z = 323.3 [M+H] + .

[0075] Step 3:

[0076] Sodium carbonate (221.95 mg, 2.09 mmol) was added to a tetrahydrofuran (10 mL) and water (5 mL) solution of intermediate EVO32695-A2 (450.00 mg, crude) under stirring. The reaction mixture was stirred at room temperature for 2 hours. The solvent was removed by concentration under reduced pressure, and the solution was purified by preparative high-performance liquid chromatography (HPLC) to obtain a white solid EVO32695 (44.40 mg, yield 8.45%), LCMS (ESI) m / z = 377.2 [M+H]. + . 1H NMR (400MHz, DMSO-d6) δ10.44(s,1H),10.09(s,1H),8.05-7.96(m,3H),7.87-7.78(m,3H),6.96(d,J=8.9Hz, 1H), 6.50 (dd, J=17.0, 10.1Hz, 1H), 6.33 (dd, J=17.0, 2.0Hz, 1H), 5.83 (dd, J=10.0, 2.0Hz, 1H), 3.77 (s, 3H).

[0077] Example 7 Example EVO32739

[0078]

[0079] Step 1:

[0080] At room temperature, 3-nitrobenzenesulfonamide (200.00 mg, 0.99 mmol) was dissolved in dichloromethane (8 mL), and N,N-diisopropylethylamine (383.00 mg, 2.97 mmol), 4-dimethylaminopyridine (12.00 mg, 0.099 mmol), and trifluoroacetic anhydride (311.00 mg, 1.48 mmol) were added sequentially. The reaction mixture was stirred overnight at room temperature. The solution was concentrated under reduced pressure, quenched with water, extracted once with ethyl acetate, and the organic phase was washed once with water and once with saturated brine. The solution was dried, filtered, and concentrated under reduced pressure to obtain a crude product. The crude product was purified using a medium-pressure normal phase chromatography (EA / PE = 10%–100%) to give a yellow oily compound EVO32739-A1 (220.00 mg, yield 74.58%). LCMS (ESI) m / z = 297.1 [MH] - .

[0081] Step 2:

[0082] At room temperature, EVO32739-A1 (220.00 mg, 0.74 mmol) was dissolved in tetrahydrofuran (5 mL), and then Pd (10% on carbon) (55.00 mg) was added. The mixture was purged with hydrogen five times, and the reaction solution was heated to 30°C and stirred for 4 hours. The reaction system was filtered, and the filter cake was washed with ethyl acetate and tetrahydrofuran. The filtrate was concentrated under reduced pressure to obtain a pale yellow oily substance, EVO32739-A2 (200.00 mg). This product was used directly in the next step without further separation. LCMS (ESI) m / z = 269.1 [M+H] + .

[0083] Step 3:

[0084] At room temperature, EVO32739-A2 (70 mg, crude) and EVO32682-A1 (50.00 mg, 0.26 mmol) were dissolved in N,N-dimethylformamide (3 mL), followed by the addition of HATU (149.00 mg, 0.39 mmol) and N,N-diisopropylethylamine (101.00 mg, 0.78 mmol). The reaction mixture was stirred at room temperature for 2 hours. The solution was quenched with water, extracted once with ethyl acetate, and the organic phase was washed once with water and once with saturated brine. The solution was dried, filtered, and concentrated under reduced pressure to obtain the crude product. The crude product was then purified by high-performance liquid chromatography (HPLC) to obtain a pale yellow solid EVO32739 (5.00 mg, yield 4.46%). LCMS (ESI) m / z = 440.1 [MH]. - . 1 H NMR (400MHz, DMSO-d6) δ10.42(s,1H),10.33(s,1H),8.67(brs,1H),8.18(t,J=1.9Hz,1H),8.00-7.96(m,3H),7.83-7.79(m,2H),7 .51-7.48(m,1H),7.40(t,J=8.0Hz,1H),6.47(dd,J=17.0,10.1Hz,1H),6.31(dd,J=17.0,2.0Hz,1H),5.81(dd,J=10.1,2.0Hz,1H).

[0085] Example 8 EVO32742

[0086]

[0087] Step 1:

[0088] 3-Nitrotoluene (2.00 g, 14.58 mmol) was added to the flask, and chlorosulfonic acid (26.30 g, 225.67 mmol, 15 mL) was slowly added dropwise under stirring in an ice-water bath. After the addition was complete, the temperature was raised to 80°C and stirred for 3 hours. The reaction solution was slowly poured into crushed ice, and the reaction proceeded vigorously. Ethyl acetate (100 mL) was added, and the mixture was stirred until the ice was completely dissolved. The mixture was then separated, and the organic phase was washed twice with water and once with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain a brown oily substance, EVO32742-A1 (2.40 g, crude product). The product was used directly in the next step without further separation.

[0089] Step 2:

[0090] EVO32742-A1 (1.20 g, crude product) and tetrahydrofuran (12 mL) were added to the flask. 25% ammonia solution (2.14 g, 15.28 mmol, 2.38 mL) was added dropwise at room temperature, and the mixture was stirred at room temperature for 4 hours. LC-MS showed product formation. Ethyl acetate was added, and the mixture was washed twice with water and once with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain a dark-colored crude solid. A PE / EA mixture of 5 / 1 (12 mL) was added and stirred. The mixture was filtered, washed with PE / EA mixture of 5 / 1, dried under vacuum, and the filter cake was collected to obtain a light yellow solid EVO32742-A2 (553.00 mg, yield 50.22%). LC-MS (ESI) m / z = 215.2 [MH]. - .

[0091] Step 3:

[0092] Add EVO32742-A2 (200.00 mg, 925.01 μmol), 1,2-dichloroethane (5 mL), triethylamine (280.80 mg, 2.78 mmol, 386.78 μL), acetyl chloride (108.92 mg, 1.39 mmol, 84.17 μL), and DMAP (11.30 mg, 92.50 μmol) to the flask, heat to 30°C, and stir for 16 hours. TLC (PE / EA = 3 / 1) indicates that the starting material has basically reacted completely, and TLC (DCM / MeOH = 10 / 1) indicates that new spots have formed. The residue was concentrated under reduced pressure, and then purified by medium-pressure normal-phase preparation (EA / PE = 10%-100% (MeOH / DCM = 0-10%)). The crude product was concentrated under reduced pressure, then mixed with DCM, filtered, washed, dried, and the filter cake was collected to obtain a pale yellow solid EVO32742-A3 (56.00 mg, yield 23.44%). LCMS (ESI) m / z = 257.1 [MH] - .

[0093] Step 4:

[0094] Tetrahydrofuran (3 mL), Pd(OH)₂ (20% on carbon) (15.00 mg, 106.81 μmol), and Pd (10% on carbon) (10.00 mg, 93.97 μmol) were added to EVO₃2742-A₃ (54.00 mg, 209.10 μmol). The mixture was purged with hydrogen three times and stirred at room temperature for 3.5 hours. LC-MS indicated the reaction was complete. The mixture was filtered through diatomaceous earth and washed with THF. The filtrate was concentrated under reduced pressure and used directly in the theoretical amount of EVO₃2742-A₄ (47.00 mg) for the next reaction. LC-MS (ESI) m / z = 229.0 [M+H] + 227.1 [MH] -.

[0095] Step 5:

[0096] EVO32742-A4 (47.00 mg, 205.90 μmol) was mixed with EVO32682-A1 (39.36 mg, 205.90 μmol), N-methylpyrrolidone (3 mL), and thionyl chloride (122.48 mg, 1.03 mmol, 75.09 μL). The mixture was heated to 60°C and stirred for 5.5 hours under argon protection. LC-MS showed product formation. Ethyl acetate was added, and the mixture was washed twice with ice water and once with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was subjected to silica gel column chromatography (MeOH / DCM = 0-10%) to give 77.00 mg of a brown solid, which was purified by preparative high-performance liquid chromatography to give a white solid EVO32742 (24.00 mg, yield 29.04%). LCMS(ESI)m / z = 402.1[M+H] + . 1 H NMR(400MHz,DMSO-d6)δ12.09(s,1H),10.46(s,1H),10.44(s,1H),8.29-8.24(m,1H),8.02-7.95(m,2H),7.95 -7.89(m,1H),7.85-7.78(m,2H),7.46 -7.41(m,1H),6.47(dd,J=17.0,10.1Hz,1H),6.31(dd,J=17.0,2.0Hz,1H),5.82(dd,J=10.0,2.0Hz,1H),2.40(s,3H),1.94(s,3H).

[0097] Example 9 EVO32815

[0098]

[0099] Step 1:

[0100] EVO32815-A1 (1.40 g, 10.21 mmol), N,N-dimethylformamide (10 mL), and pyridine (491.00 mg, 6.21 mmol, 0.50 mL) were added to the reaction flask. Acryloyl chloride (923.99 mg, 10.21 mmol, 829.43 μL) was added dropwise with stirring in an ice-water bath. After the addition was complete, stirring was continued in an ice-water bath for 3 hours. TLC (ethyl acetate) showed that the starting materials had basically reacted completely. Water (100 mL) was slowly added to the reaction solution, and a solid precipitated. The mixture was stirred for 30 minutes, filtered through filter paper, and the filter cake was washed with water (20 mL x 5). The cake was then dried and collected to obtain a light yellow solid, EVO32815-A2 (1.44 g, yield 73.78%). LCMS (ESI) m / z = 192.2 [M+H] + Step 2:

[0101] EVO32742-A5 (66.00 mg, 289.13 μmol) was mixed with EVO32815-A2 (55.28 mg, 289.13 μmol), N-methylpyrrolidone (3 mL), and thionyl chloride (171.99 mg, 1.45 mmol, 105.45 μL). The reaction mixture was heated to 60°C and stirred for 6 hours under argon protection. LC-MS showed product formation, with small amounts of both starting materials remaining. Water (30 mL) was added to the reaction flask, resulting in solid precipitation. After stirring for 30 minutes, the mixture was filtered. The filter cake was washed with water (10 mL x 3). TLC (DCM / MeOH = 10 / 1) and LC-MS showed that the product was mainly in the filtrate. The filtrate was extracted with EA (30 mL x 3), and the combined organic phases were washed successively with water (20 mL x 3) and saturated brine (20 mL x 1). The mixture was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain a yellow oily substance. This was then subjected to silica gel column chromatography (MeOH / DCM = 0-5%) to obtain 55.00 mg of a crude yellow-green solid. Preparative high-performance liquid chromatography (HPLC) purified the crude product to obtain a white solid EVO32815 (30.00 mg, yield 25.85%). LCMS (ESI) m / z = 400.3 [MH] - . 1H NMR(400MHz,DMSO-d6)δ12.10(s,1H),10.58(s,1H),10.39(s,1H),8.28-8. 23(m,1H),8.22-8.17(m,1H),7.96-7.89(m,2H),7.71-7.64(m,1H),7.50(t ,J=7.9Hz,1H),7.47-7.42(m,1H),6.46(dd,J=17.0,10.1Hz,1H),6.30(dd, J=17.0,2.0Hz,1H),5.80(dd,J=10.1,2.0Hz,1H),2.41(s,3H),1.94(s,3H).

[0102] Biological Effects Examples

[0103] Protein expression and purification of WRN truncated variant

[0104] Constructing expression carriers:

[0105] 1. A cDNA sequence encoding WRN(N517-Q1093) was synthesized (Genscript Biotech Corporation) with an 8xHis tag-Strep-TEV cleavage site at the N-terminus, and constructed into the pFastBac1 vector (YouBio, catalog number), with insertion sites of BamHI and EcoRI, to obtain the pFastBac1-8His-Strep-TEV-WRN(N517-Q1093) recombinant plasmid;

[0106] 2. Take 50 μL of DH10Bac competent cells (biomed, #BC112-01) and thaw them slowly on ice. Add 1 μL of pFastBac1-8His-Strep-TEV-WRN (N517-Q1093) recombinant plasmid, incubate on ice for 30 minutes, then incubate in a 42°C water bath for 45 seconds, and then incubate on ice for 2 minutes.

[0107] 3. Add 450 μL of SOC medium (2% Tryptone (OXOID, #LP0042), 0.5% Yeast Extract (OXIOD, #LP0021), 0.58% NaCl (Hushi, #10019360), 0.019% KCl (Hushi, 1002792168398), 0.203% MgCl2·6H2O (Hushi, 10012828), 0.246% MgSO4·7H2O (Hushi, 10013016), 0.36% Glucose (Biodee, #DE0149-500g)), and incubate at 220 rpm and 37℃ for 4 hours in a horizontal shaker.

[0108] 4. Dilute the cell slurry 10-fold in SOC medium, then spread 50 μL onto agarose plates (containing 1% Tryptone, 0.5% Yeast Extract, 1% NaCl, 1.5% Agar (BioFroxx, #8211GR500), 50 μg / mL Kanamycin (Solarbio, #K8020-5g), 7 μg / mL Gentamycin (Solarbio, G8170-1g), 10 μg / mL Tetracycline (Solarbio, #T8180-5g), 40 μg / mL X-gal (Solarbio, #8050-1g), and 40 μg / mL IPTG (Inalco, #1758-1400)). Incubate at 37°C in the dark for 48 h.

[0109] 5. Pick two single colonies and place them in 5 mL of SOC medium, incubate overnight at 37°C and 250 rpm; Extraction of recombinant Bacmid:

[0110] 1. Take 1.5 mL of bacterial culture medium into an EP tube (Axygen, #MCT-200-CS) and centrifuge at 13300 rpm for 1 minute;

[0111] 2. Remove the supernatant and extract recombinant Bacmid using a plasmid extraction kit (Qiagen#DP103-03).

[0112] Following the kit instructions, transfer the supernatant after centrifugation to a new tube, add 750 μL of isopropanol (Greagent, #G75885B), mix gently a few times, and place on ice for 10 minutes.

[0113] 3.13, centrifuge at 300 rpm for 15 minutes;

[0114] 4. Remove the supernatant, add 500 μL of 70% ethanol (Greagent, catalog number 1101143), invert the EP tube 8 times to clean the precipitate, and centrifuge at 13,300 rpm for 5 minutes.

[0115] 5. Remove the supernatant and add 500 μL of autoclaved 70% ethanol in a sterile environment in a laminar flow hood;

[0116] 6. Repeat steps 8 and 9;

[0117] 7. Remove as much supernatant as possible, centrifuge at 13,300 rpm for 2 minutes;

[0118] 8. Air dry the precipitate for 5 minutes, then dissolve it in 40 μL of autoclaved TE buffer;

[0119] 9. Nanodrop determination of recombinant Bacmid concentration;

[0120] Insect cell transfection:

[0121] 1. Sf-900TMII SFM media (Gibco #10902088) diluted Sf9 cells (Gibco, #11496015) to 1×10⁻⁶. 6 cells / mL, take 3mL into a 25mL culture flask;

[0122] 2. Take 15 μg of recombinant Bacmid, add 100 μL of Grace's Insect Medium (Gibco, #11605094), then add 7 μL of X-treme transfection reagent (Roche #6366236001), and incubate at room temperature for 15-20 minutes.

[0123] 3. Transfer the incubation product to a culture flask containing Sf9 cell culture medium and incubate at 27°C and 100 rpm for 4 days; collect P0 virus:

[0124] 4. Four days after transfection, observe the cell status and prepare to collect the virus;

[0125] 5. First, add serum (final concentration 2%, Sijiqing #11011-8611), and centrifuge at 3200 rpm for 5 minutes at 4℃;

[0126] 6. Collect the supernatant and store at 4℃, denoted as P0 virus; P1 virus preparation:

[0127] 7. Take 1 mL of P0 virus and add it to 50 mL of Sf9 cell culture medium (cell density 1.5-1.8 × 10⁶ cells / mL). 6(cells / mL), cultured at 27℃ and 100 rpm for 3 days;

[0128] 8. After culturing for 3 days, check the cell status and prepare to collect the cells;

[0129] 9. Add serum (final concentration 2%), centrifuge at 3500 rpm for 5 minutes at 4°C;

[0130] 10. Collect the supernatant and store at 4℃, labeling it as P1 virus; P2 virus preparation:

[0131] 11. Take 4 mL of P1 virus and add it to 200 mL of Sf9 cell culture medium (cell density 1.5-1.8 × 10⁻⁶). 6 (cells / mL), cultured at 27℃ and 100 rpm for 3 days;

[0132] 12. After culturing for 3 days, check the cell status and prepare to collect the cells;

[0133] 13. Add serum (final concentration 2%), centrifuge at 3500 rpm for 5 minutes at 4°C;

[0134] 14. Collect the supernatant and store it at 4℃, and label it as P2 virus.

[0135] Protein expression and purification:

[0136] 15.6 bottles of 800mL Sf9 cell culture medium (2×10⁶) 6 12.8 mL of P2 virus was added to each of the cells / mL, and the cells were incubated at 27°C and 100 rpm for 48 h.

[0137] Centrifuge at 16.4℃ and 8000 rpm for 10 minutes, then collect the cells;

[0138] 17. Resuspend the cells in 800 mL of cell lysis buffer (50 mM Tris-HCl pH 7.5, 500 mM NaCl, 5% glycerol, 0.5 mM TCEP, 1 mM PMSF, 5 mM MgCl2) and add one tablet of cOmplete™ protein inhibitor (Roche #11697498001).

[0139] 18. Cells were disrupted under high pressure (Nanjing Naton Electromechanical Manufacturing Co., Ltd., model NT-H3, working pressure 650 bar), repeated 4 times, followed by centrifugation at 16000 rpm for 60 minutes at 4°C. The supernatant was collected for affinity chromatography.

[0140] 1) Pass The XT affinity column (5 mL, IBA lifesciences #2-5027-001) was eluted with a buffer of 50 mM HEPES pH 7.5, 500 mM NaCl, 5% glycerol, 0.5 mM TCEP, 1 mM PMSF, and 75 mM Biotin.

[0141] 2) Add 6His-GST-Thrombin-TEV protease to the elution product and digest overnight at 4°C;

[0142] 3) The enzyme digestion products were subjected to ion exchange using HiTrap Heparin HP (5 mL, GE Healthcare #17-0406-01);

[0143] 4) Remove residual protease by passing through a GST column;

[0144] 5) Purification molecular size exclusion chromatography was performed using HiLoad 16 / 600 Superdex 200pg (GE Healthcare #28-9893-35) at a flow rate of 1mL / min;

[0145] 19. SDS-PAGE is used to determine protein purity, which must be greater than 99%. The protein is frozen at -80°C for subsequent enzyme activity testing.

[0146] Detection of the inhibitory effect of the compound on WRN truncated ATPase activity

[0147] ADP-Glo TM The kinase assay kit (Promega#V9101) is a chemiluminescent ADP detection method with advantages such as high versatility, good uniformity, and high-throughput screening. It can be used to detect the activity of ADP-producing enzymes (such as ATPase). The assay is performed in two steps: first, after the kinase reaction, ADP-Glo ​​is added... TM The reagent terminates the kinase reaction and consumes the remaining ATP; then, a kinase detection reagent is added to convert ADP to ATP, and the newly synthesized ATP is measured by a luciferase / luciferin reaction, with the chemiluminescence signal detected by a photometer. The light signal is positively correlated with the ADP concentration; therefore, the inhibition of WRNATPase activity by different concentrations of the compound can be determined, allowing for the fitting of a concentration-effect curve and the calculation of the compound's IC50. The specific operating steps are as follows:

[0148] The buffer solutions used in this experiment were 25 mM HEPES (Gibco#15630-080), 5 mM NaCl (Sigma#59222C-100 mL), 0.01% F-127 (Sigma#P2443), 1 mM MgCl2 (Sigma#M1028-100 mL), and 1 mM TCEP (Sigma#646547).

[0149] 1. The compound was dissolved in DMSO to prepare a 10 mM stock solution. The compound was then serially diluted 3-fold to eight concentration points. 3 μL of each compound solution was added to each well of a 384-well plate (PerkinElmer #6008280). 3 μL of 5% DMSO was added to each of the High Control and Low Control wells.

[0150] 2. Add 6 μL of 5 nM WRN cutoff solution to each well and incubate with the compound at room temperature for 10 minutes.

[0151] 3. Add 6 μL of a mixture of ATP and DNA duplex fork (2.5 mM ATP, 25 nM DNA) to each well to prepare a 15 μL reaction system, and react at room temperature for 60 minutes;

[0152] 4. Take 5 μL of the reaction mixture from each well and add 5 μL of ADP-Glo ​​reagent stop solution (ADP-Glo) to each well. TM Incubate the kinase kit in a 384-well plate (well 2) at room temperature for 50 minutes to terminate the reaction.

[0153] 5. Take 5 μL of ADP (ADP-Glo) TM The kinase kit was supplemented with 5 μL of ADP-Glo ​​reagent (ADP-Glo). TM In the wells of the kinase kit (standard control wells);

[0154] 6. Add 10 μL of Kinase Detection Reagent (ADP-Glo) to all wells. TM The kinase kit was incubated at room temperature for 40 minutes. The light signal values ​​were read using a SpectraMaxi3x.

[0155] 7. Data Analysis: The pore inhibition rate (Inhibition%) of the compound is calculated as (avg High Control - Cpd well) / (avg High Control - Low Control) * 100%. Using GraphPad Prism 9.0 software, a four-parameter fitting equation was used to plot the concentration-effect curve and calculate the IC50. 50 value.

[0156] Detection of the inhibitory effect of the compound on the unwinding activity of WRN truncated DNA

[0157] Experimental Principle: Two incompletely paired single-stranded DNA fragments, one with a quenching group and the other with a fluorescent group, anneal to form a DNA duplex fork structure. WRN can unwind this DNA duplex fork into single-stranded DNA, allowing the detection of single-stranded DNA levels via fluorescence signal to evaluate the helicase activity of the WRN. The specific experimental steps are as follows:

[0158] The buffer solution used in this experiment has the same formulation as the buffer solution used in the ATPase enzyme activity experiment.

[0159] 1. Synthesis of a single-stranded DNA fragment (quenched single-stranded DNA of SEQ ID NO:1):

[0160] TTTTTTTTTTTTTTTTCGTACCCGATGTGTTCGTTC, fluorescent single-stranded DNA of SEQ ID NO:2: GAACGAACACATCGGGTACGTTTTTTTT, synthesized by Sangon Biotech (Shanghai) Co., Ltd., purified by HPLC, primers dissolved in enzyme-free water (Invitrogen #10977015) to 100 uM;

[0161] 2. Dilute the single-stranded DNA fragment to 20 μM with 500 mM NaCl solution (final NaCl concentration 50 mM), and make up the volume with enzyme-free water. Mix equal amounts of the single-stranded DNA fragment (10 μM) and place them in a PCR instrument (BIORAD#C1000 Touch). Set the program to: 95℃ for 5 minutes, 25℃ for 1 minute (Ramp: 0.1℃ / s), and 4℃ for 30 minutes to anneal the single-stranded DNA and obtain DNA duplexfork.

[0162] 3. Transfer 20 μL of 30 nM fluorescent single-stranded DNA fragment and 20 μL of 30 nM DNA duplex fork to 384 wells (Corning #4514), respectively. Detect the fluorescence signal using a microplate reader: excitation wavelength 520 nm, emission wavelength 590 nm. Calculate the annealing efficiency based on the corresponding fluorescence signals: (DNA duplex fork / single-stranded DNA) × 100%. The annealing efficiency should be >90%.

[0163] 4. The compound was dissolved in DMSO to prepare a 10 mM stock solution. The compound was then serially diluted 3-fold to a total of 10 concentration points (7.5 × compound detection concentration, 7.5% DMSO).

[0164] 5. Add 2 μL of the compound solution to a 384-well plate. Add 2 μL of 7.5% DMSO to each of the High Control and Low Control wells.

[0165] 6. Add 5 μL of 6 nM WRN cutoff solution to each well, centrifuge at 1000 rpm for 1 minute, and incubate at room temperature for 30 minutes;

[0166] 7. Add 8 μL of a mixture of DNA duplex fork and ATP (18.75 nM DNA, 5.63 mM ATP) to each well, centrifuge at 1000 rpm for 1 minute, and react at room temperature for 20 minutes.

[0167] 8. Add 4 μL of 1.625% SDS solution (Sigma#75746-250G) to each well to terminate the reaction;

[0168] 9. Use a fluorescence microplate reader (MD SpectraMax i3x) to read the fluorescence signal intensity at an excitation wavelength of 520 nm and an emission wavelength of 590 nm;

[0169] 10. Data Analysis: The pore inhibition rate (Inhibition%) of the compound is calculated as (avg High Control - Cpdwell) / (avg High Control - Low Control) * 100%. Using GraphPad Prism 9.0 software, a four-parameter fitting equation was used to plot the concentration-effect curve and calculate the IC50. 50 The values ​​and results are as follows:

[0170]

[0171] Where A represents IC 50 ≤100nM; B indicates 100nM < IC 50≤1000nM; C indicates 1000nM < IC 50 ≤10000nM; "-" indicates untested.

Claims

1. A compound of the following formula (I) or a pharmaceutically acceptable salt thereof: ###0001### (I) wherein: R1 and R2 are each independently hydrogen or halogen; R3 is -OH, -NH(CO)-CH3, -NH(CO)-fluoromethyl; R4 is hydrogen or methyl; and R5 is hydrogen or -OCH3. wherein 2. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R1 and R2 are each independently hydrogen or fluorine. R3 is -OH, -NH(CO)-C 1-3 alkyl, -NH(CO)-C 1-3 haloalkyl; R4is hydrogen or C 1-3 alkyl; R5is hydrogen or C 1-3 alkoxy.

3. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R3 is -OH, -NH(CO)-CH3, -NH(CO)-fluoromethyl.

4. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R4 is hydrogen or methyl.

5. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R5 is hydrogen or -OCH3.

6. The compound of claim 1 or a pharmaceutically acceptable salt thereof, which is any one of the following: ###0002### ###0003### ###0004### ###0005### ###0006### ###0007### ###0008### ###0009### ###0010### ###0011### ###0012### ###0013### ###0014### ###0015### ###0016### ###0017### ###0018### ###0019### ###0020### ###0021### ###0022### ###0023### ###0024### ###0025### ###0026### ###0027### ###0028### ###0029### ###0030### ###0031### ###0032### ###0033### ###0034### ###0035### ###0036### ###0037### ###0038### ###0039### ###0040### ###0041### ###0042### ###0043### ###0044### ###0045### ###0046### ###0047### ###0048### ###0049### ###0050### ###0051### ###0052### ###0053### ###0054### ###0055### ###0056### ###0057### ###0058### ###0059### ###0060### ###0061### ###0062### ###0063### ###0064### ###0065### ###0066### ###0067### ###0068### ###0069### ###0070### ###0071### ###0072### ###0073### ###0074### ###0075### ###0076### ###0077### ###0078### ###0079### ###0080### ###0081### ###0082### ###0083### ###0084### ###0085### ###0086### ###0087### ###0088### ###0089### ###0090### ###0091### ###0092### ###0093### ###0094### ###0095### ###0096### ###0097### ###0098### ###0099### ###0100### ###0101### ###0102### ###0103### ###0104### ###0105### ###0106### ###0107### ###0108### ###0109### ###0110### ###0111### ###0112### ###0113### ###0114### ###0115### ###0116### ###0117### ###0118### ###0119### ###0120### ###0121### ###0122### ###0123### ### ​ 7. A pharmaceutical composition, characterized by, ​ ​ 9. Use according to claim 8, characterized in that: ​

Images