A class of compounds containing sulfoxide structures

By developing compounds with sulfoxide structures to inhibit the helicase function of WRN protein, the treatment challenge of MSI-H cancer has been solved, providing a new method for treating colorectal cancer, gastric cancer, endometrial cancer, or ovarian cancer, achieving specific inhibition of WRN protein and inhibition of cancer cell growth.

CN119039191BActive Publication Date: 2026-03-10SHANGHAI SINOV BIOPHARMACEUTICAL CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-20
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Current technologies have not effectively addressed the treatment needs of cancers with microsatellite instability-high (MSI-H) or lack of DNA mismatch repair function, such as colorectal cancer, gastric cancer, endometrial cancer, or ovarian cancer, especially since WRN proteins provide crucial DNA repair functions in these cancer cells, making it difficult for existing treatments to effectively inhibit their growth.

Method used

A class of compounds containing sulfoxide structures were developed to inhibit the helicase function of WRN proteins. Compounds such as EVO32715P1/EVO32715P2, EVO32776, EVO32779, and EVO32814 were used as WRN inhibitors for the treatment of MSI-H cancer.

Benefits of technology

These compounds can effectively inhibit the helicase activity of WRN protein, leading to DNA breakage and apoptosis in cancer cells, providing a new strategy for treating MSI-H cancer and showing potential therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119039191B_ABST
    Figure CN119039191B_ABST
Patent Text Reader

Abstract

This invention discloses a class of compounds containing a sulfoxide structure as shown in formula (I), their uses, and pharmaceutical compositions containing the same. These compounds exhibit strong inhibitory activity against WRN, thereby inhibiting related cancer cells.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a class of compounds containing sulfoxide structure, its use and pharmaceutical composition containing the same. BACKGROUND

[0002] During the progression of cancer, the loss of DNA mismatch repair function often occurs, such as 10-30% of colorectal cancer, endometrial cancer, ovarian cancer and gastric cancer. Due to the loss of DNA mismatch repair function, the mutation burden of cancer cells is high, and deletions or insertions often occur in the repetitive sequence region of DNA, which is called microsatellite instability. Although progress has been made in the treatment of microsatellite instability-high (MSI-H) cancer, and pembrolizumab (PD-1 antibody) as a first-line treatment shows longer survival progression than chemotherapy for microsatellite instability-high / DNA mismatch repair function-deficient (MSI-H / dMMR) patients with advanced colorectal cancer, which makes pembrolizumab approved for first-line treatment of MSI-H / dMMR cancer, but there is still a need for clinical indications for colorectal cancer and other MSI-H.

[0003] Through large-scale functional genomics screens of multiple cell lines, including a Novartis analysis of 398 cell lines from the Cancer Cell Line Encyclopedia (CCLE) cell repository (McDonald E.R. et al., Project DRIVE: A Compendium of Cancer Dependencies and Synthetic Lethal Relationships Uncovered by Large-Scale, Deep RNAi Screening. Cell 170(3):577-592 (2017)), it was discovered that WRN (Werner syndrome protein) is synthetically lethal for cell lines with microsatellite instability-high (MSI-H) due to loss of DNA mismatch function (Behan, F.M. et al. Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens. Nature 568, 511-516 (2019); Chan, E.M. et al. WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Nature 568, 551-556 (2019); Kategaya, L., Perumal, S.K., Hager, J.H. & Belmont, L.D. Werner syndrome helicase is required for the survival of cancer cells with microsatellite instability. iScience 13, 488-497 (2019); Lieb, S. et al. Werner syndrome helicase is a selective vulnerability of microsatellite instability-high tumor cells. Elife 8, e43333 (2019)). WRN is synthetically lethal with MSI-H, and loss of WRN inhibits cell proliferation, activates multiple DNA damage biomarkers, induces cell division arrest and apoptosis in cancer cells with loss of DNA mismatch repair function, but not in cancer cells with intact DNA mismatch repair function.These findings demonstrate that WRN provides the DNA repair and maintenance functions essential for the survival of MSI-H cancer cells. Recently, the mechanism by which MSI-H cells depend on WRN has been clarified: the two-nucleotide TA repeat sequence is unstable only in MSI-H cells, capable of large-scale expansion, leading to atypical DNA secondary structures that require WRN unwinding (Van Wietmarschen, N. et al. Repeat expansions confer WRN dependency in microsatellite-unstable cancers. Nature 586, 292-298, 200.). In the absence of WRN (or with inhibited WRN unwinding function), the expanded TA repeat sequence in MSI-H cells is cleaved by nucleases, resulting in chromosome breakage. Therefore, inhibiting the helicase function of WRN is an attractive therapeutic strategy for cancer cells lacking DNA mismatch function.

[0004] Cancer still requires new treatments and therapies, especially those with microsatellite instability-high (MSI-H) or loss of DNA mismatch repair (dMMR), including colorectal cancer, gastric cancer, endometrial cancer, or ovarian cancer. Summary of the Invention

[0005] This invention provides compounds of formula (I) or pharmaceutically acceptable salts thereof:

[0006]

[0007] Where R1 is -OH or -NH(CO)-C 1-3 alkyl;

[0008] R2 is hydrogen, C 1-3 Alkyl or C 1-3 Alkoxy;

[0009] R3 is hydrogen, C 1-3 Alkyl or C 1-3 Alkoxy;

[0010] M can be CH or N.

[0011] In a preferred embodiment, R1 is -OH or -NH(CO)-CH3; R2 is hydrogen or methoxy; and R3 is hydrogen or methyl.

[0012] The compound or its pharmaceutically acceptable salt described in this invention may be any of the following compounds:

[0013]

[0014]

[0015] The present application also provides the use of a compound as shown above, or a pharmaceutically acceptable salt thereof, in the manufacture of a WRN inhibitor. The use includes the use in the treatment of colorectal cancer, gastric cancer, endometrial cancer, or ovarian cancer.

[0016] The present application also provides a pharmaceutical composition comprising a compound as shown above, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0017] As described herein, the term "pharmaceutically acceptable salt" refers to a pharmaceutically acceptable organic or inorganic salt of a compound of the present application. DETAILED DESCRIPTION

[0018] The present application is further illustrated by the following examples, but the present application is not limited to the described examples. The experimental methods in the following examples, if no specific conditions are indicated, are selected according to the conventional methods and conditions, or according to the instructions of the commercial products.

[0019] Example 1 EVO32715P1 / EVO32715P2

[0020]

[0021] Step 1:

[0022] Methyl 3-aminocyclopentanecarboxylate hydrochloride (200.00 mg, 1.11 mmol) was suspended in dichloromethane (8 mL) at room temperature, N,N-diisopropylethylamine (432.00 mg, 3.34 mmol) was added, the reaction system was clarified, and then cooled to 0 °C, acryloyl chloride (101.00 mg, 1.11 mmol) was added dropwise. The reaction system was continuously stirred at 0 °C for 30 minutes. The reaction system was quenched with water, extracted with dichloromethane twice, and then dried, filtered, and concentrated to obtain a yellowish oil crude product EVO32715-A1 (220.00 mg). The product was directly used in the next step without further separation. LCMS (ESI) m / z = 198.1 [M+H] + .

[0023] Step 2:

[0024] EVO32715-A1 (300.00 mg, crude) was dissolved in tetrahydrofuran (8 mL) at room temperature, and a solution of sodium hydroxide (183.00 mg, 4.56 mmol) in water (2 mL) was added. The reaction system was heated to 30 degrees Celsius and stirred for 2 hours. After the reaction system was concentrated, it was diluted with water, the pH was adjusted to 4-6 with dilute sulfuric acid, and then the water was concentrated to dryness. Tetrahydrofuran was added under ultrasonic, filtered, and the filtrate was concentrated to give a yellowish solid crude product EVO32715-A2 (300.00 mg). The product was used directly in the next step without further separation. LCMS (ESI) m / z = 182.1 [M-H] - .

[0025] Step 3:

[0026] EVO32715-A2 (300.00 mg, crude) was dissolved in N,N-dimethylformamide (10 mL) at room temperature, and HATU (934.00 mg, 2.46 mmol) and N,N-diisopropylethylamine (1.06 g, 8.19 mmol) were added. The reaction system was stirred at room temperature for 5 minutes, and then 3-aminobenzenesulfonic acid (255.00 mg, 1.47 mmol) was added. The reaction system was heated to 30 degrees Celsius and stirred for 2 hours. After the reaction system was concentrated, it was purified by medium pressure normal phase preparation (10% MeOH / DCM = 5%-100%, MeOH (1% TFA) / DCM = 10%-30%) to give 400.00 mg of a crude product. The product was further purified by medium pressure reverse phase preparation (0.1% HCOOH in H2O / CH3CN = 0-30%) to give a white solid EVO32715P1 (RT1(min): 15.8-16.2) (8.00 mg, yield 1.44%) and a white solid EVO32715P2 (RT1(min): 16.3-17.4) (45.00 mg, yield 8.12%). EVO32715P1: LCMS (ESI) m / z = 339.2 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 9.92 (s, 1H), 8.10 (d, J = 7.0 Hz, 1H), 7.77 (t, J = 1.9 Hz, 1H), 7.67 (dt, J = 7.4, 2.0 Hz, 1H), 7.28 - 7.18 (m, 2H), 6.22 (dd, J = 17.1, 10.0 Hz, 1H), 6.07 (dd, J = 17.1, 2.4 Hz, 1H), 5.56 (dd, J = 10.0, 2.4 Hz, 1H), 4.22 - 4.18 (m, 1H), 2.96 (p, J = 8.0 Hz, 1H), 2.08 - 1.94 (m, 3H), 1.79 - 1.71 (m, 2H), 1.53 - 1.44 (m, 1H). EVO32715 P2: LCMS (ESI) m / z = 339.2 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.94 (s, 1H), 8.20 (d, J = 7.6 Hz, 1H), 7.83 (t, J = 1.8 Hz, 1H), 7.62 (dt, J = 7.5, 2.0 Hz, 1H), 7.29 - 7.19 (m, 2H), 6.21 (dd, J = 17.1, 10.1 Hz, 1H), 6.06 (dd, J = 17.1, 2.4 Hz, 1H), 5.56 (dd, J = 10.0, 2.3 Hz, 1H), 4.21 - 4.09 (m, 1H), 2.84 (q, J = 8.2 Hz, 1H), 2.17 (dt, J = 12.5, 7.4 Hz, 1H), 1.95 - 1.82 (m, 3H), 1.66 (dt, J = 12.5, 9.1 Hz, 1H), 1.59 - 1.46 (m, 1H).

[0027] Example 2 EVO32776

[0028]

[0029] EVO32715-A2 (230.00 mg, 1.26 mmol) and p-toluidine-3-sulfonic acid (230.00 mg, 1.13 mmol) were dissolved in N,N-dimethylformamide (8 mL) at room temperature, and HATU (716.00 mg, 1.88 mmol) and N,N-diisopropyl ethylamine (811.00 mg, 6.28 mmol) were added successively. The reaction system was stirred at 30 degrees Celsius overnight. The reaction system was directly concentrated to get the crude product, which was purified by medium pressure normal phase preparation (10% MeOH / DCM = 5%-100% to MeOH (1% TFA) / DCM = 10%-30%) to get 300.00 mg of crude product, which was further purified by preparative high performance liquid chromatography to obtain white solid EVO32776 (mixture of stereoisomers, without separation) (50.00 mg, yield 10.81%). LCMS (ESI) m / z = 369.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.79-9.77 (m, 1H), 8.21-8.09 (m, 1H), 7.78-7.75 (m, 1H), 7.71-7.64 (m, 1H), 6.88-6.85 (m, 1.17H), 6.25-6.17 (m, 1H), 6.09-6.03 (m, 1.2H), 5.56 (dd, J = 10.0, 2.3 Hz, 1H), 4.21-4.10 (m, 1H), 3.70 (s, 3.6H), 2.94-2.77 (m, 1H), 2.18-2.11 (m, 1H), 2.05-1.81 (m, 3H), 1.68-1.61 (m, 1H), 1.55-1.49 (m, 1H).

[0030] Example 3 EVO32779

[0031]

[0032] Step 1:

[0033] 3-bromophenyl isocyanate (499.69 mg, 2.52 mmol) was dissolved in dichloromethane (15 mL) at 0 degrees Celsius, and 3-(Boc-amino)pyrrolidine (470.00 mg, 2.52 mmol) was added. The reaction liquid was stirred at room temperature for 1 hour. The reaction system was concentrated to get white solid EVO32779-C1 (960.00 mg). The product was directly used in the next step without further separation. LCMS (ESI) m / z = 328.0 / 330.0 [M-56+H] + .

[0034] Step 2:

[0035] To a single-neck flask, EVO32779-C1 (960.00 mg, crude), benzyl mercaptan (372.00 mg, 3.00 mmol), Pd2dba3 (160.00 mg, 0.17 mmol), XantPhos (217.00 mg, 0.37 mmol), N,N-diisopropylethylamine (968.00 mg, 7.49 mmol) and dioxane (15 mL) were added successively at room temperature. The reaction system was replaced with argon for 3 times, then warmed to 100 Celsius and stirred overnight. The reaction system was filtered, and the filter cake was washed with dichloromethane. The filtrate was concentrated to get the crude product, which was purified by medium pressure normal phase (EA / PE = 5-50%) to get yellow oil EVO32779-C2 (1.00 g, yield 93.62%). LCMS (ESI) m / z = 428.1 [M+H] + .

[0036] Step 3:

[0037] EVO32779-C2 (500.00 mg, 1.17 mmol) was dissolved in acetonitrile / water / glacial acetic acid (10 mL) at 0 Celsius, and dichloroisonicotinic acid (346.00 mg, 1.75 mmol) was added, and stirred at 0 Celsius for 1 hour. The reaction system was concentrated to get yellow oil EVO32779-C3 (600.00 mg,). The product was used directly in the next step without further purification. LCMS (ESI) m / z = 348.2 [M-56+H] + .

[0038] Step 4:

[0039] EVO32779-C3 (600.00 mg, crude) was dissolved in tetrahydrofuran (10 mL) at room temperature, and water (5 mL) was added, and warmed to 70 Celsius and stirred overnight. The reaction system was concentrated, and purified by medium pressure reverse phase (0.1% HCOOH in H2O / CH3CN = 0-3%) to get light yellow solid EVO32779-C4 (300.00 mg, yield 52.39%). LCMS (ESI) m / z = 284.2 [M-Boc-H] - .

[0040] Step 5:

[0041] EVO32779-C4 (200.00 mg, 0.52 mmol) was suspended in dichloromethane (6 mL) at room temperature, and triethylamine (3 mL) was added, and stirred at room temperature overnight. The reaction system was concentrated to get the crude product EVO32779-A3 (200.00 mg,). The product was used directly in the next step without further purification. LCMS (ESI) m / z = 285.9 [M+H]+ .

[0042] Step 6:

[0043] EVO32779-A3 (200.00 mg, crude) and triethylamine (355.00 mg, 3.50 mmol) were dissolved in tetrahydrofuran (10 mL) at 0 degree Celsius, and acryloyl chloride (127.00 mg, 1.40 mmol) was added. The reaction system was stirred at room temperature for 6 hours. After the reaction system was concentrated, it was purified by medium pressure reverse phase preparation (0.1% HCOOH in H2O / CH3CN = 0-5%) to obtain a crude product, which was then prepared by prep-HPLC twice to obtain white solid EVO32779 (23.00 mg, yield 9.67%). LCMS (ESI) m / z = 340.0 [M+H] + . 1 HNMR (400 MHz, DMSO-d6) δ 8.38 (d, J = 6.8 Hz, 1H), 8.27 (s, 1H), 7.74-7.73 (m, 1H), 7.61-7.56 (m, 1H), 7.17-7.13 (m, 2H), 6.24 (dd, J = 17.1, 10.0 Hz, 1H), 6.11 (dd, J = 17.1, 2.4 Hz, 1H), 5.60 (dd, J = 10.0, 2.4 Hz, 1H), 4.37-4.30 (m, 1H), 3.63-3.59 (m, 1H), 3.51-3.42 (m, 2H), 3.30-3.26 (m, 1H), 2.13-2.05 (m, 1H), 1.86-1.78 (m, 1H).

[0044] Example 4 EVO32814

[0045]

[0046] Step 1:

[0047] To a reaction flask was added EVO32715-A2 (80.00 mg, 436.67 μmol), tetrahydrofuran (3 mL), N,N-diisopropylethylamine (282.18 mg, 2.18 mmol, 380.29 μL), HATU (199.24 mg, 524.01 μmol), the reaction was stirred at room temperature for 10 minutes. A solution of EVO32742-A5 (99.68 mg, 436.67 μmol) in tetrahydrofuran (8 mL) was added, and the reaction was stirred at 25 degrees Celsius for 15 hours under argon protection. LC-MS showed that the product was generated, and the raw material EVO32742-A5 was also left. Silica gel was added to the reaction, and concentrated to dryness under reduced pressure, and purified by silica gel column chromatography (MeOH / DCM = 0-10%) to obtain 235.00 mg of oil. Purified by preparative high performance liquid chromatography to obtain white solid EVO32814 (17.00 mg, yield 9.89%). LCMS (ESI) m / z = 392.3 [M-H] - . 1 H NMR (400 MHz, DMSO-d6) δ 12.05 (s, 1H), 10.24 (s, 1H), 8.19 (d, J = 7.5 Hz, 1H), 8.10-8.05 (m, 1H), 7.73-7.70 (m, 1H), 7.39-7.34 (m, 1H), 6.21 (dd, J = 17.1, 10.1 Hz, 1H), 6.07 (dd, J = 17.1, 2.4 Hz, 1H), 5.56 (dd, J = 10.0, 2.4 Hz, 1H), 4.19-4.07 (m, 1H), 2.90-2.79 (m, 1H), 2.36 (s, 3H), 2.25-2.14 (m, 1H), 1.96-1.82 (m, 6H), 1.70-1.59 (m, 1H), 1.58-1.45 (m, 1H).

[0048] Biological effect examples

[0049] Protein expression and purification of WRN truncates

[0050] Construction of expression vector:

[0051] 1. Synthesize cDNA sequence encoding WRN (N517-Q1093) (Genscript Biotech Corporation) with 8xHis tag-Strep-TEV cleavage site at N-terminal, construct into pFastBacl vector (YouBio, Cat. No. 100000), insert site is BamHI and EcoRI, get pFastBacl-8His-Strep-TEV-WRN (N517-Q1093) recombinant plasmid;

[0052] 2. Take 50 μL DH10Bac competent cells (biomed, #BC112-01) slowly thawed on ice, add 1 μL pFastBac1-8His-Strep-TEV-WRN (N517-Q1093) recombinant plasmid, incubate on ice for 30 minutes, then 42°C water bath for 45 seconds, incubate on ice for 2 minutes;

[0053] 3. Add 450 μL SOC medium (2% Tryptone (OXOID, #LP0042), 0.5% Yeast Extract (OXIOD, #LP0021), 0.58% NaCl (Hushi, #10019360), 0.019% KCl (Hushi, 1002792168398), 0.203% MgCl2·6H2O (Hushi, 10012828), 0.246% MgSO4·7H2O (Hushi, 10013016), 0.36% Glucose (Biodee, #DE0149-500g)), place in a horizontal shaker at 220 rpm and 37°C for 4 hours;

[0054] 4. Dilute the cell solution 10 times in SOC medium, then take 50 uL to coat the agar plate (take 1% Tryptone, 0.5% Yeast Extract, 1% NaCl, 1.5% Agar (BioFroxx, #8211GR500), 50 μg / mL Kanamycin (Solarbio, #K8020-5g), 7 μg / mL Gentamycin (Solarbio, G8170-1g), 10 μg / mL Tetracycline (Solarbio, #T8180-5g), 40 μg / mL X-gal (Solarbio, #8050-1g) and 40 μg / mL IPTG (inalco, #1758-1400)), 37°C, dark growth for 48 hours;

[0055] 5. Pick 2 single colonies and place them in 5 mL SOC medium, 37°C, 250 rpm overnight culture; recombinant Bacmid extraction:

[0056] 1. Take 1.5 mL of colony culture in an EP tube (Axygen, #MCT-200-C-S), centrifuge at 13300 rpm for 1 minute;

[0057] 2. Remove the supernatant and extract the recombinant Bacmid with a plasmid extraction kit (Qiagen #DP103-03),

[0058] Experimental steps refer to the kit instructions. After centrifugation, transfer the supernatant to a new tube, add 750 μL isopropanol (Greagent, #G75885B), mix gently several times, and place on ice for 10 minutes;

[0059] 3. 13,300 rmp centrifugation for 15 minutes;

[0060] 4. Remove the supernatant, add 500 μL 70% ethanol (Greagent, Catalog No. 1101143), invert the EP tube repeatedly 8 times to wash the precipitated part, and centrifuge at 13,300 rmp for 5 minutes;

[0061] 5. Remove the supernatant, and in a sterile environment on the clean bench, add 500 μL of 70% ethanol sterilized by high pressure;

[0062] 6. Repeat steps 8 and 9;

[0063] 7. Remove as much supernatant as possible, centrifuge at 13,300 rmp for 2 minutes;

[0064] 8. Dry the precipitate for 5 minutes, and dissolve with 40 μL of TE buffer sterilized by high pressure;

[0065] 9. Measure the concentration of recombinant Bacmid by Nanodrop;

[0066] Insect cell transfection:

[0067] 1. Dilute Sf9 cells (Gibco, #11496015) to 1 × 10 6 cells / mL in Sf-900TMII SFM media (Gibco #10902088), and take 3 mL to 25 mL culture bottles;

[0068] 2. Take 15 μg of recombinant Bacmid, add 100 μL of Grace's Insect Medium (Gibco, #11605094), and then add 7 μL of X-treme transfection reagent (Roche #6366236001), and incubate at room temperature for 15-20 minutes

[0069] 3. Transfer the incubated product to the culture bottle containing Sf9 cell solution, and cultivate at 27°C and 100 rpm for 4 days; collect P0 virus:

[0070] 4. After 4 days of transfection, observe the cell state and prepare to collect the virus;

[0071] 5. First add serum (final concentration 2%), 3200 rpm centrifuge for 5 minutes at 4°C;

[0072] 6. Collect supernatant and store at 4°C, record as P0 virus; P1 virus preparation:

[0073] 7. Take 1 mL P0 virus, add 50 mL Sf9 cell culture solution (cell density 1.5-1.8 x 10 6 cells / mL), culture at 27°C for 3 days at 100 rpm;

[0074] 8. After 3 days of culture, check cell status and prepare to collect cells;

[0075] 9. Add serum (final concentration 2%), 3500 rpm centrifuge for 5 minutes at 4°C;

[0076] 10. Collect supernatant and store at 4°C, record as P1 virus; P2 virus preparation:

[0077] 11. Take 4 mL P1 virus, add to 200 mL Sf9 cell culture solution (cell density 1.5-1.8 x 10 6 cells / mL), culture at 27°C for 3 days at 100 rpm;

[0078] 12. After 3 days of culture, check cell status and prepare to collect cells;

[0079] 13. Add serum (final concentration 2%), 3500 rpm centrifuge for 5 minutes at 4°C;

[0080] 14. Collect supernatant and store at 4°C, record as P2 virus.

[0081] Protein expression and purification:

[0082] 15. Add 12.8 mL P2 virus to 6 bottles of 800 mL Sf9 cell culture solution (2 x 10 6 cells / mL) respectively, culture at 27°C for 48 h at 100 rpm;

[0083] 16. Centrifuge at 8000 rpm for 10 minutes at 4°C to collect cells;

[0084] 17. Resuspend cells with 800 mL cell lysis buffer (50 mM Tris-HCl pH 7.5, 500 mM NaCl, 5% glycerol, 0.5 mM TCEP, 1 mM PMSF, 5 mM MgCl2), add one piece of cOmplete™ protease inhibitor (Roche #11697498001);

[0085] 18. High pressure cell disrupter (Nantong Nantron Mechanical Manufacture, Model NT-H3, working pressure 650 bar), repeated 4 times, followed by 4°C 16000 rmp centrifugation for 60 minutes, collect supernatant for affinity chromatography:

[0086] 1) pass XT affinity column (5 mL, IBA lifesciences #2-5027-001), eluted with 50 mM HEPES pH 7.5, 500 mM NaCl, 5% glycerol, 0.5 mM TCEP, 1 mM PMSF, 75 mM Biotin buffer;

[0087] 2) eluted product added 6His-GST-Thrombin-TEV protease, 4°C overnight enzyme digestion;

[0088] 3) enzyme digestion product passed HiTrap Heparin HP (5 mL, GE Healthcare #17-0406-01) for ion exchange;

[0089] 4) passed GST column to remove residual protease;

[0090] 5) purified by HiLoad 16 / 600 Superdex 200 pg (GE Healthcare #28-9893-35) for molecular exclusion chromatography, flow rate 1 mL / min;

[0091] 19. SDS-PAGE to detect protein purity, protein purity should be greater than 99%, protein stored at -80°C for subsequent enzyme activity test.

[0092] Inhibition detection of compound on WRN truncate ATPase enzyme activity

[0093] ADP-Glo TM The ADP-Glo Kinase Assay Kit (Promega #V9101) is a chemiluminescent ADP detection method, which has the advantages of strong universality, good uniformity and high-throughput screening, and can be used to detect the activity of ADP generating enzymes (such as ATPase). The detection is carried out in two steps: first, after the kinase reaction, ADP-Glo TM reagent terminates the kinase reaction and consumes the remaining ATP; then add the kinase detection reagent, convert ADP to ATP, and measure the newly synthesized ATP by luciferase / luciferin reaction, and detect the chemiluminescence signal by luminometer. The light signal is positively correlated with the content of ADP, so the inhibition of different concentrations of compounds on WRN ATPase activity can be determined, and the concentration-effect curve is fitted to calculate the IC50 of the compound. The specific operation steps are as follows:

[0094] The buffer solutions used in this experiment were 25 mM HEPES (Gibco#15630-080), 5 mM NaCl (Sigma#59222C-100 mL), 0.01% F-127 (Sigma#P2443), 1 mM MgCl2 (Sigma#M1028-100 mL), and 1 mM TCEP (Sigma#646547).

[0095] 1. The compound was dissolved in DMSO to prepare a 10 mM stock solution. The compound was then serially diluted 3-fold to eight concentration points. 3 μL of each compound solution was added to each well of a 384-well plate (PerkinElmer #6008280). 3 μL of 5% DMSO was added to each of the High Control and Low Control wells.

[0096] 2. Add 6 μL of 5 nM WRN cutoff solution to each well and incubate with the compound at room temperature for 10 minutes.

[0097] 3. Add 6 μL of a mixture of ATP and DNA duplex fork (2.5 mM ATP, 25 nM DNA) to each well to prepare a 15 μL reaction system, and react at room temperature for 60 minutes;

[0098] 4. Take 5 μL of the reaction mixture from each well and add 5 μL of ADP-Glo ​​reagent stop solution (ADP-Glo) to each well. TM Incubate the kinase kit in a 384-well plate (well 2) at room temperature for 50 minutes to terminate the reaction.

[0099] 5. Take 5 μL of ADP (ADP-Glo) TM The kinase kit was supplemented with 5 μL of ADP-Glo ​​reagent (ADP-Glo). TM In the wells of the kinase kit (standard control wells);

[0100] 6. Add 10 μL of Kinase Detection Reagent (ADP-Glo) to all wells. TM The kinase kit was incubated at room temperature for 40 minutes. The light signal values ​​were read using a SpectraMaxi3x.

[0101] 7. Data analysis: Compound well inhibition rate (%) = (avg High Control - Cpd well) / (avg High Control - Low Control) * 100%, GraphPad Prism 9.0 software was applied to draw concentration-effect curve and calculate IC 50 values using four-parameter fitting equation.

[0102] Inhibition test of compound on WRN truncated body DNA unwinding activity

[0103] Experimental principle: two incomplete paired single-stranded DNA fragments with quenching group and fluorescent group respectively can form DNA duplex fork structure after annealing, WRN can unwind DNA duplex fork into single-stranded DNA, so as to detect single-stranded DNA level through fluorescence signal and evaluate WRN helicase activity. The specific experimental steps are as follows:

[0104] The buffer used in this experiment is consistent with the buffer formula of ATPase enzyme activity experiment.

[0105] 1. Synthesis of single-stranded DNA fragments (quenching single-stranded DNA of SEQ ID NO: 1:

[0106] TTTTTTTTTTTTTTTTCGTACCCGATGTGTTCGTTC, fluorescent single-stranded DNA of SEQ ID NO: 2: GAACGAACACATCGGGTACGTTTTTTTT, synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd., purified by HPLC method), dissolve the primer to 100 uM with enzyme-free water (Invitrogen #10977015);

[0107] 2. Dilute single-stranded DNA fragments to 20 uM with 500 mM NaCl solution (NaCl final concentration 50 mM), and add enzyme-free water to the volume. Take equal amount of single-stranded DNA fragments (10 uM) and put them into PCR instrument (BIORAD #C1000 Touch), program setting: 95℃ 5 minutes, 25℃ 1 minute (Ramp: 0.1℃ / s), 4℃ 30 minutes, single-stranded DNA annealing, get DNA duplex fork;

[0108] 3. Take 20uL 30nM fluorescent single-stranded DNA fragment and 20uL 30nM DNA duplex fork into 384-well plates (Corning #4514) respectively, and detect the fluorescence signal with a microplate reader: excitation wavelength 520nm, emission wavelength 590nm. Calculate the annealing efficiency according to the corresponding fluorescence signals respectively: (DNA duplex fork / single-stranded DNA) x 100%, and the annealing efficiency needs to be >90%;

[0109] 4. Compound is dissolved in DMSO to prepare a 10mM stock solution. The test compound is diluted by 3-fold gradient, a total of 10 concentration points (7.5x compound test concentration, 7.5% DMSO);

[0110] 5. Take 2uL compound solution and add to 384-well plates. Add 2uL 7.5% DMSO to the lowest inhibition control well (High Control) and the enzyme-free control well (Low Control) respectively;

[0111] 6. Add 5uL 6nM WRN truncation solution to each well, centrifuge at 1000rpm for 1 minute, and incubate at room temperature for 30 minutes;

[0112] 7. Add 8uL DNA duplex fork and ATP mixture (18.75nM DNA, 5.63mM ATP) to each well, centrifuge at 1000rpm for 1 minute, and react at room temperature for 20 minutes;

[0113] 8. Add 4uL 1.625% SDS solution (Sigma #75746-250G) to each well to terminate the reaction;

[0114] 9. Read the fluorescence signal intensity at excitation wavelength 520nm and emission wavelength 590nm with a fluorescence microplate reader (MD SpectraMax i3x);

[0115] 10. Data analysis: Compound well inhibition rate (%) = (avg High Control-Cpdwell) / (avg High Control-Low Control)*100%, use GraphPad Prism 9.0 software to draw concentration-effect curve and calculate IC 50 value using four-parameter fitting equation, the results are as follows:

[0116]

[0117] Wherein, A represents IC 50 ≤100nM; B represents 100nM < IC 50≤ 1000 nM; C means 1000 nM < IC 50 ≤ 10000 nM; "-" means not tested.

Claims

1. A compound of the following formula (I) or a pharmaceutically acceptable salt thereof: wherein R1is -OH, -NH(CO)-C 1-3 alkyl; R2is hydrogen, C 1-3 alkyl or C 1-3 alkoxy; R3is hydrogen, C 1-3 alkyl or C 1-3 alkoxy; M is CH or N.

2. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R1 is -OH or -NH(CO)-CH3.

3. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R2 is hydrogen or methoxy.

4. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein R3 is hydrogen or methyl.

5. The compound of claim 1 or a pharmaceutically acceptable salt thereof, which is any one of the following:

6. A pharmaceutical composition, characterized by, a pharmaceutical composition comprising a compound of any one of claims 1 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

7. Use of a compound of any one of claims 1-5 or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of claim 6 in the manufacture of a WRN inhibitor.

8. Use according to claim 7, characterized in that: the use is in the manufacture of a medicament for the treatment of colorectal cancer, gastric cancer, endometrial cancer, or ovarian cancer.

Citation Information

Patent Citations

  • DE149500A

  • WRN inhibitors

    CN118271323A

  • Covalent EGFR inhibitors and methods of use thereof

    EP4225288A1