siRNA, drug for simultaneously inhibiting the expression of two target genes, and their applications

Abstract

The present invention relates to a dual-targeting siRNA agent, which comprises two different siRNAs targeting two different genes or pharmaceutically acceptable salts thereof, and the two different siRNAs or salts thereof are linked by a pharmaceutically acceptable ligand. The siRNA is a dsRNA composed of a sense strand and an antisense strand. The two different genes are selected from two of angiotensinogen (AGT), proprotein convertase subtilisin / kexin type 9 (PCSK9), and angiopoietin-like protein 3 (ANGPTL3). The present invention provides the application of the dual-targeting siRNA agent in the preparation of a drug for preventing or treating diseases related to hypertension or / and lipid disorders. The dual-targeting siRNA agent of the present invention can effectively inhibit the expression of two target genes in vivo simultaneously, and has the advantages of strong non-antagonistic activity and high safety. The present invention also provides siRNAs corresponding to the genes of the above dual-targeting siRNA agent and their use for preventing or treating diseases related to hypertension or / and lipid disorders.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to siRNAs, drugs for simultaneously inhibiting the expression of two target genes, and their applications. Background Art

[0002] Chronic diseases such as hypertension, hyperlipidemia, and hypercholesterolemia are the main inducements of cardiovascular and cerebrovascular complications. With the improvement of the living standards of humans, these chronic diseases have become important factors that trouble people's health and reduce the quality of life. In most hypertension guidelines, in the case of not using antihypertensive drugs, systolic blood pressure (SBP) or diastolic blood pressure (DBP) ≥ 140 / 90 mmHg is defined as hypertension (Whelton, Paul K et al. Hypertension vol. 71, 6 (2018): 1269-1324.). Hypertension usually appears together with other chronic diseases such as hyperlipidemia, hypercholesterolemia, and diabetes. In a study involving 4942 hypertensive outpatients in 2009, 24.3% of the patients also suffered from diabetes. In the above survey, the prevalence of hypertriglyceridemia was 18.9%, and the prevalences of hypercholesterolemia and low HDL cholesterol were 13.5% and 16.6% respectively. The co-occurrence of these diseases not only increases the risk of cardiovascular and cerebrovascular complications but also complicates the management of such diseases (Miao, Chao-Ying et al. Journal of clinical hypertension vol. 23, 7 (2021): 1399-1404). It has been reported that antihypertensive treatment is beneficial to improving various indicators of patients. For example, for every 10 mmHg reduction in systolic blood pressure, the risk of cardiovascular disease is reduced by 20%; in addition, the risks of coronary heart disease, stroke, and heart function deficiency are reduced by 17%, 27%, and 28% respectively. Due to having the same risk factors and pathogenesis, the combination of antihypertensive and lipid-lowering drugs will have a synergistic effect on the treatment of the above chronic diseases, and the improvement of the cardiovascular and cerebrovascular diseases can also be used as an end-point indicator for hypertension treatment (Ranasinghe, Priyanga et al. Journal of the American Heart Association vol. 11, 20 (2022): e027694.).

[0003] The renin-angiotensin-aldosterone system (RAAS) is an endocrine system that maintains blood pressure, blood volume and water-salt balance in the human body. The angiotensin (ANG I / II) secreted by this system has the effect of constricting blood vessels. Overactivation of the RAAS system is one of the important causes of hypertension (Arendse, Lauren B et al. Pharmacological reviews vol. 71, 4 (2019): 539-570). At present, the main antihypertensive drugs in clinical practice are RAAS inhibitors, including angiotensin-converting enzyme inhibitors ACEI (such as pril drugs), angiotensin II antagonists ARB (such as sartan drugs), etc. Even though the mechanism of action of these RAAS inhibitor drugs is not exactly the same, they have certain body compensation and require patients to take medication every day without interruption, so some patients have poor compliance. It is worth noting that angiotensinogen (AGT) produced by liver cells is the only precursor of angiotensin (Ang II). Studies have shown that the polymorphism of the AGT gene is closely related to the body's blood pressure regulation, so AGT is an important target for gene silencing treatment of hypertension and related diseases. Inhibiting AGT can effectively prevent the over-activation of the RAAS system, thereby playing a role in lowering blood pressure, making up for the common shortcomings of RAAS inhibitor drugs (Ren, Liwei et al. Current opinion in nephrology and hypertension vol. 29, 2 (2020): 180-189). Recent studies have shown that siRNA-mediated AGT gene silencing using a GalNAc system coupled to specific hepatocytes can inhibit the RAAS system for weeks to months, requiring only a single dose, which can improve compliance and cardiovascular and cerebrovascular diseases better than current RAAS inhibitors (Desai, Akshay S et al. The New England journal of medicine vol. 389, 3 (2023): 228-238.).

[0004] As mentioned above, hypertension is closely related to hyperlipidemia. Hyperlipidemia is usually a lipid disorder caused by elevated levels of cholesterol and / or triglycerides in the serum and is an important inducer of cardiovascular diseases such as atherosclerosis. Loss-of-function variants in the angiopoietin-like protein 3 (ANGPTL3) gene are associated with reduced plasma levels of triglycerides, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol. Human genetics studies have shown that individuals carrying heterozygous loss-of-function variants in ANGPTL3 have significantly lower serum levels of triglycerides, high-density lipoprotein cholesterol, and low-density lipoprotein (LDL-C) cholesterol than those without these variants (Dewey, Frederick E et al. The New England journal of medicine vol.377, 3 (2017): 211-221.). Functionally, ANGPTL3 produced by hepatocytes is secreted into the blood and forms active molecules after cleavage by PCSK3 or PCSK6, which can inhibit lipoprotein lipase (which catalyzes the hydrolysis of triglycerides) and endothelial lipase (which hydrolyzes lipoprotein phospholipids), thereby leading to increased plasma levels of triglycerides, high-density lipoprotein (HDL), and phospholipids. Therefore, inhibiting the expression of ANGPTL3 can be an important target for the treatment of hyperlipidemia (Kersten, Sander. Nature reviews. Endocrinology vol.13, 12 (2017): 731-739.).

[0005] In addition, the proportion of patients with hypertension who develop hypercholesterolemia is also high. Hypercholesterolemia is generally defined according to LDL-C and non-HDL-C levels. Similarly, human genetic studies have shown that proprotein convertase subtilisin / kexin type 9 (PCSK9) may be associated with familial hypercholesterolemia. Two common loss-of-function mutations in PCSK9 (PCSK9-679X and PCSK9-142X) are positively correlated with low LDL-C levels in the blood (Cohen, Jonathan C et al. The New England journal of medicine vol. 354, 12 (2006): 1264-72.). PCSK9 is synthesized in the liver and secreted into the circulatory system. PCSK9 in cells can bind to and direct newly synthesized LDL receptors to be transported from the Golgi apparatus to lysosomes for degradation; while PCSK9 in the circulatory system can specifically bind to LDL receptors on the surface of liver cells, thereby mediating their entry into lysosomes in liver cells for degradation, ultimately leading to a decrease in the ability of the liver to bind and clear LDL-C and an increase in LDL-C levels in the blood (Horton, Jay D et al. Journal of lipid research vol. 50 Suppl, Suppl (2009): S172-7). Therefore, inhibiting the expression level of PCSK9 is an important target for the treatment of hypercholesterolemia and the prevention of cardiovascular and cerebrovascular diseases related to LDL-C. Currently, for lipid-lowering treatment methods, monoclonal antibody drugs, antisense oligonucleotide drugs (ASOs), siRNAs drugs, etc. targeting ANGPTL3 and PCSK9 have been developed, and good treatment effects have been achieved using LDL-C or triglyceride as indicators (Chen, Ruoyu et al. Journal of clinical laboratory analysis vol. 36, 7 (2022): e24552.).

[0006] The discovery of the RNAi phenomenon has pushed RNA therapy to a new height. RNAi technology refers to the degradation of target genes by exogenous siRNAs using the cell's endogenous system. In terms of mechanism, the exogenous double-stranded siRNAs can be recognized by the ribonuclease Dicer in the cell and divided into single-stranded guide strands and their complementary strands in the RNA-induced silencing complex (RISC). The siRNA as the guide strand then binds to the Argonate2 protein (AGO2) and guides it to the target RNA, and the degradation of the target RNA is mediated by AGO2. In addition to degrading RNAs in the cytoplasm, siRNAs can also promote chromatin remodeling and histone modification in the nucleus, leading to transcriptional silencing (Matzke et al. Nature reviews. Genetics vol.6, 1(2005):24-35.). Currently, multiple siRNA drugs have been approved by the FDA, and there are also many candidate siRNAs undergoing phase III clinical trials (Zhu, Yiran et al. Cell death & disease vol.13, 7644. 23 Jul. 2022). siRNAs are unstable in blood and tissues and are easily digested and degraded by nucleases in the body. To improve the stability of the antisense and sense strands of siRNAs, chemical modifications such as 2'-O-methylation and 2'-fluorination are usually introduced when synthesizing siRNA drugs. The delivery of siRNA drugs is also an important guarantee for RNAi therapy. The most mature delivery system currently is N-oligosaccharide acetylgalactosamine (GalNAc). GalNAc can bind to the asialoglycoprotein receptor (ASGPR) specifically expressed in liver cells. After being conjugated with siRNA, it can achieve active delivery to liver cells, which is an important breakthrough in the field of RNA therapy. And the three genes AGT, ANGPTL3, and PCSK9 concerned in this invention are all hepatocyte-specific or highly expressed proteins. Therefore, the GalNAc system can be used to achieve the liver delivery of single-target or dual-target siRNA drugs (Debacker, Alexandre J et al. Molecular therapy vol.28, 8(2020):1759-1771).

[0007] Currently, RNAi drugs targeting the PCSK9 gene have been approved for marketing, while RNAi drugs targeting the AGT and ANGPTL3 genes are still in the research and development stage and both show good therapeutic effects. However, it is still of great significance to further develop highly effective and long-lasting RNAi drugs. The dual-target RNAi drugs formed by pairwise combination of siRNAs targeting the three genes respectively have great clinical application prospects for the combined treatment of chronic cardiovascular and cerebrovascular diseases such as hypertension, hyperlipidemia, and hypercholesterolemia. For example, the siRNA combinations of AGT and ANGPTL3, and AGT and PCSK9 into dual-target drugs may have a synergistic therapeutic effect on blood pressure reduction and lipid reduction; while the siRNA combination of ANGPTL3 and PCSK9 into a dual-target drug may achieve unexpected drug persistence for the treatment of hypercholesterolemia or hyperlipidemia and improve the therapeutic effect. There are not many single-target siRNAs that are truly suitable for clinical application, and it is even more difficult to use different siRNAs targeting two target genes in combination. In addition to effectively controlling the target genes, it is also required that the two siRNAs do not antagonize each other in vivo, and the duration of the two targets should be generally the same and other high requirements. However, despite this, due to the huge medical application prospects, the research on multi-targets is still welcomed and expected. Summary of the Invention

[0008] Based on this, the object of the present invention is to provide a dual-targeting siRNA agent for simultaneously inhibiting the expression of any two target genes of angiotensinogen (AGT), proprotein convertase subtilisin / kexin type 9 (PCSK9), and angiopoietin-like 3 (ANGPTL3) in cells and its application, which has the advantages of effectively inhibiting the expression of two target genes in vivo simultaneously, not antagonizing each other, high activity, and high safety.

[0009] In the first aspect of the present invention, a dual-targeting siRNA agent is provided. Among them, the dual-targeting siRNA agent includes two different siRNAs targeting two different genes or their pharmaceutically acceptable salts. The two different siRNAs or their salts are connected by a ligand for delivering nucleic acids to form an integral entity. The siRNA is a dsRNA composed of a sense strand and an antisense strand, and the two different genes are selected from two of AGT, PCSK9, and ANGPTL3;

[0010] Among them, the base composition of the siRNA targeting AGT is selected from one of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0011] A) The dsRNA duplex is 1167f, wherein the sense strand comprises UGACCAGCUUGUUUGUGAA (SEQ ID NO: 59), and the antisense strand comprises UUCACAAACAAGCUGGUCGGG (SEQ ID NO: 60);

[0012] B) The dsRNA duplex is 1167b, wherein the sense strand comprises GCCGACCAGCUUGUUUGUGAA (SEQ ID NO: 51), and the antisense strand comprises UUCACAAACAAGCUGGUCGGC (SEQ ID NO: 52);

[0013] C) The dsRNA duplex is 1165d, wherein the sense strand comprises GAGAACCAGUGUUUAGCGA (SEQ ID NO: 39), and; the antisense strand comprises UCGCUAAACACUGGUUCUUGG (SEQ ID NO: 40);

[0014] D) The dsRNA duplex is 1165f, wherein the sense strand comprises CCAAGAACCAGUGUUUAGCGA (SEQ ID NO: 43), and the antisense strand comprises UCGCUAAACACUGGUUCUUGG (SEQ ID NO: 44);

[0015] Wherein, the siRNA base composition targeting PCSK9 is selected from one of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0016] E) The dsRNA duplex is 11040a, wherein the sense strand comprises CUUAUUCUGGGUUUUGUAGCA (SEQ ID NO: 375), and the antisense strand comprises UGCUACAAAACCCAGAAUAAG (SEQ ID NO: 376);

[0017] F) The dsRNA duplex is 11002d, wherein the sense strand comprises GCAGCCAACUUUUCUAGAA (SEQ ID NO: 259), and the antisense strand comprises UUCUAGAAAAGUUGGCUGUGG (SEQ ID NO: 260);

[0018] G) The dsRNA duplex is 11002a, wherein the sense strand comprises CUACAGCCAACUUUUCUAGAA (SEQ ID NO: 253), and the antisense strand comprises UUCUAGAAAAGUUGGCUGUAG (SEQ ID NO: 254);

[0019] Wherein, the base composition of the siRNA targeting ANGPTL3 is selected from one of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0020] H) The dsRNA duplex is 7061f, wherein the sense strand comprises UACUUGAACUCAACUCAAA (SEQ ID NO: 579), and the antisense strand comprises UUUGAGUUGAGUUCAAGUGGG (SEQ ID NO: 580); I) The dsRNA duplex is 7061b, wherein the sense strand comprises GCCACUUGAACUCAACUCAAA (SEQ ID NO: 571), and the antisense strand comprises UUUGAGUUGAGUUCAAGUGGC (SEQ ID NO: 572).

[0021] In some embodiments thereof, the dual-targeting siRNA agent targets genes AGT and PCSK9, AGT and ANGPTL3, and PCSK9 and ANGPTL3.

[0022] In some embodiments thereof, the targeted genes are AGT and any one selected from PCSK9 and ANGPTL3, preferably AGT and PCSK9.

[0023] The present invention also provides a method for modifying nucleotides for the above siRNA, for improving the stability, activity of siRNA in vivo and in vitro and reducing off-target activity. The modified nucleotides at least include one or more of the following: 2′-O-methyl modified nucleotides, 2′-fluoro modified nucleotides, 2′-deoxynucleotides, 2′3′-seco nucleotide analogs, LNA, unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2′-F-arabinonucleotides, 2′-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic residues, inverted 2′-OMe nucleotides, inverted 2′-deoxynucleotides, 2′-amino modified nucleotides, 2′-alkyl modified nucleotides, morpholino nucleotides and 3′-OMe nucleotides, nucleotides containing a 5′-thioester phosphate group, or terminal nucleotides linked to a cholesterol derivative or a didodecylamide group, 2′-amino modified nucleotides, aminophosphates, or unnatural bases containing nucleotides, etc.

[0024] In some of these embodiments, the sense strand comprises no more than 3, 2, 1, or 0 unmodified nucleotides, and the modified nucleotides in the sense strand are respectively selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluoro modified nucleotides, reverse abasic residues, and the sense strand contains 0, or 1, or 2, or 3 phosphorothioate bonds at the 5'-end and 3'-end; and wherein, the antisense strand comprises no more than 3, 2, 1, or 0 unmodified nucleotides, and the modified nucleotides in the antisense strand include respectively selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluoro modified nucleotides, VPU (2'-O-methyluridine-5'-(E)-vinyl phosphate-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinyl phosphate-3'-phosphate), or other VPU derivatives, and the antisense strand contains 1-3 phosphorothioate bonds at each of the 5'-end and 3'-end.

[0025] In some of these embodiments, the dsRNA duplex targeting the AGT gene is modified and is selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0026] a) The dsRNA duplex is 1167.25-19, wherein the 5'-3' sense strand comprises

[0027] I nvab*mU*mGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mG;

[0028] b) The dsRNA duplex is 1167.27-21, wherein the 5'-3' sense strand comprises

[0029] I nvab*mG*mCmCmGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mC;

[0030] c) The dsRNA duplex is 1165.5-14, wherein the 5'-3' sense strand comprises

[0031] I nvab*mG*mAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG;

[0032] d) The dsRNA duplex is 1165.5-16, wherein the 5'-3' sense strand comprises

[0033] I nvab*mC*mCmAmAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG.

[0034] In some of these embodiments, the siRNA targeting PCSK9 is modified and is selected from one of the following sequences, or a sequence that differs from its sense or antisense strand by no more than 1 nucleotide:

[0035] e) The dsRNA duplex is 11040.10-23, wherein the 5'-3' sense strand comprises

[0036] I nvab*mC*mUmUmAmUmUmCmUfGfGfGfUmUfUmUmGmUmAmGmCmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fG*mCmUmAmCmAmAmAmAmCdCmCfAmGfAmAmUmA*mA*mG;

[0037] f) The dsRNA duplex is 11002.17-21, wherein the 5'-3' sense strand comprises

[0038] I nvab*mG*mCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mG*mG;

[0039] g) The dsRNA duplex is 11002.10-23, wherein the 5'-3' sense strand comprises

[0040] I nvab*mC*mUmAmCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mA*mG.

[0041] In some of these embodiments, the dsRNA targeting the ANGPTL3 gene is modified and is selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0042] h) The dsRNA is 7061.18-14, wherein the 5'-3' sense strand comprises

[0043] I nvab*mU*mAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mG;

[0044] i) The dsRNA duplex is 7061.4-16, wherein the 5'-3' sense strand comprises

[0045] I nvab*mG*mCmCmAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mC.

[0046] Wherein, the above VPU-S is 2'-S-methyluridine-5'-(E)-vinyl phosphate-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, fU is 2'-fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, I nvab is an inverted abasic residue, and * is a phosphorothioate bond.

[0047] In some embodiments, the ligand is N-acetylgalactosamine (GalNAc) or a derivative thereof.

[0048] In some embodiments, the N-acetylgalactosamine or a derivative thereof is chemically linked to the 3'-ends of the sense strands of two siRNAs, preferably through a phosphate bond or a phosphorothioate bond.

[0049] In some embodiments, the structure of the ligand is as follows:

[0050]

[0051] In some embodiments, the ligand is linked to the 3'-end of the sense strand of the siRNA.

[0052] In some embodiments, the way in which the ligand is linked to the 3'-end of the sense strand of the siRNA is as follows:

[0053]

[0054] An siRNA representing a modified sequence targeting AGT, PCSK9 or ANGPTL3.

[0055] In some embodiments, when targeting the AGT and PCSK9 genes, each siRNA of the dual-targeting siRNA agent is selected from the sequences shown by any one of DT03081, DT03086, DT03103, DT03099, DT03085, DT03101, DT03082, DT03097, DT03100 or DT03102 in Table 45.

[0056] In some embodiments, when targeting the AGT and ANGPTL3 genes, each siRNA of the dual-targeting siRNA agent is selected from the sequences shown by any one of DT02043 or DT02047 in Table 45.

[0057] In some embodiments, when targeting the ANGPTL3 and PCSK9 genes, each siRNA of the dual-targeting siRNA agent is selected from the sequences shown by any one of DT09001, DT09003 and DT09005 in Table 45.

[0058] In a second aspect of the present invention, there is provided the use of any one of the above dual-targeting siRNA agents in the preparation of a product of a double-stranded siRNA that simultaneously inhibits the expression of two targets (target genes) of any combination of AGT, PCSK9 and ANGPTL3.

[0059] In some embodiments, the product is a biological agent or a pharmaceutical preparation.

[0060] The third aspect of the present invention is to provide the use of any of the above-mentioned dual-targeting siRNA agents in the preparation of a drug for preventing and / or treating hypertension or / and lipid disorder-related diseases.

[0061] The fourth aspect of the present invention is to provide a biological agent or pharmaceutical preparation for simultaneously inhibiting the expression of two target genes in any combination of AGT, PCSK9, and ANGPTL3, and the active ingredient thereof includes any of the above-mentioned dual-targeting siRNA agents.

[0062] The fifth aspect of the present invention is to provide a method for simultaneously inhibiting the expression of two target genes in any combination of AGT, PCSK9, and ANGPTL3, and the method includes:

[0063] (a) contacting cells in vivo or in vitro with any of the corresponding dual-targeting siRNA agents or the above-mentioned biological agent or pharmaceutical preparation; and

[0064] (b) maintaining the cells generated in step (a) for a time sufficient to obtain degradation of the mRNA transcripts of the two target expressions in any combination of AGT, PCSK9, and ANGPTL3, so as to simultaneously inhibit the expression of the two targets in any combination of AGT, PCSK9, and ANGPTL3 in the cells.

[0065] A method for treating a disorder related to the AGT gene and / or the PCSK9 gene and / or the ANGPTL3 gene, which includes administering a therapeutically effective amount of the above-mentioned dual-targeting siRNA agent or the above-mentioned biological agent or pharmaceutical preparation to the subject, so as to treat the subject.

[0066] In some embodiments, the cells are in vivo or in vitro in a subject. Preferably, the subject is a mammal.

[0067] In some embodiments, the subject is a human.

[0068] In some embodiments, the expression of AGT, PCSK9, and ANGPTL3 is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

[0069] Among them, the diseases related to hypertension are mediated by the AGT gene, including but not limited to borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, resistant hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and labile hypertension, or other diseases related to AGT gene mediation.

[0070] Among them, the diseases related to lipid disorders are mediated by the PCSK9 gene, including but not limited to hyperlipidemia, atherosclerosis, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, or other diseases related to PCSK9 gene mediation.

[0071] Among them, the diseases related to lipid disorders are mediated by the ANGPTL3 gene, including but not limited to hyperlipidemia, hypertriglyceridemia, abnormal lipid and / or cholesterol metabolism, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, cardiometabolic diseases, obesity, atherosclerosis, type II diabetes, cardiovascular diseases, coronary artery diseases, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis caused by hypertriglyceridemia, or other diseases related to ANGPTL3 gene mediation.

[0072] The sixth aspect of the present invention is to provide an siRNA targeting the AGT gene, PCSK9 gene or ANGPTL3 gene, which can be used as a single-target drug or for dual-target drugs.

[0073] An siRNA targeting the AGT gene or a pharmaceutically acceptable salt thereof, the sequence of which is selected from one of the following, or a sense strand or antisense strand sequence that differs from it by no more than 1 nucleotide:

[0074] A) The dsRNA is 1167f, wherein the sense strand contains UGACCAGCUUGUUUGUGAA (SEQ ID NO: 59), and the antisense strand contains UUCACAAACAAGCUGGUCGGG (SEQ ID NO: 60);

[0075] B) The dsRNA is 1167b, wherein the sense strand contains GCCGACCAGCUUGUUUGUGAA (SEQ ID NO: 51), and the antisense strand contains UUCACAAACAAGCUGGUCGGC (SEQ ID NO: 52);

[0076] C) The dsRNA is 1165d, wherein the sense strand comprises GAGAACCAGUGUUUAGCGA (SEQ ID NO: 39), and the antisense strand comprises UCGCUAAACACUGGUUCUUGG (SEQ ID NO: 40);

[0077] D) The dsRNA is 1165f, wherein the sense strand comprises CCAAGAACCAGUGUUUAGCGA (SEQ ID NO: 43), and the antisense strand comprises UCGCUAAACACUGGUUCUUGG (SEQ ID NO: 44);

[0078] In some embodiments thereof, the siRNA is modified and is selected from one of the following sequences, or a sense or antisense strand sequence that differs therefrom by no more than 1 nucleotide:

[0079] a) The dsRNA is 1167.25-19, wherein the 5'-3' sense strand comprises

[0080] I nvab*mU*mGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mG;

[0081] b) The dsRNA is 1167.27-21, wherein the 5'-3' sense strand comprises

[0082] I nvab*mG*mCmCmGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mC;

[0083] c) The dsRNA is 1165.5-14, wherein the 5'-3' sense strand comprises

[0084] I nvab*mG*mAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG;

[0085] d) The dsRNA is 1165.5-16, wherein the 5'-3' sense strand comprises

[0086] I nvab*mC*mCmAmAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAI nvab, and the 5'-3' antisense strand contains VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG;

[0087] An siRNA targeting the proprotein convertase subtilisin / kexin type 9 gene (PCSK9 gene) or a pharmaceutically acceptable salt thereof, the sequence of which is selected from one of the following, or a sense strand or antisense strand sequence that differs from it by no more than 1 nucleotide:

[0088] E) The dsRNA is 11040a, wherein the sense strand contains CUUAUUCUGGGUUUUGUAGCA (SEQ ID NO: 375), and the antisense strand contains UGCUACAAAACCCAGAAUAAG (SEQ ID NO: 376);

[0089] F) The dsRNA is 11002d, wherein the sense strand contains GCAGCCAACUUUUCUAGAA (SEQ ID NO: 259), and the antisense strand contains UUCUAGAAAAGUUGGCUGUGG (SEQ ID NO: 260);

[0090] G) The dsRNA is 11002a, wherein the sense strand contains CUACAGCCAACUUUUCUAGAA (SEQ ID NO: 253), and the antisense strand contains UUCUAGAAAAGUUGGCUGUAG (SEQ ID NO: 254);

[0091] In some embodiments, the siRNA targeting the proprotein convertase subtilisin / kexin type 9 gene (PCSK9 gene) is modified and is selected from one of the following sequences, or a sense strand or antisense strand sequence that differs from it by no more than 1 nucleotide:

[0092] e) The dsRNA is 11040.10-23, wherein the 5'-3' sense strand contains

[0093] I nvab*mC*mUmUmAmUmUmCmUfGfGfGfUmUfUmUmGmUmAmGmCmAI nvab, and the 5'-3' antisense strand contains VPU-S*fG*mCmUmAmCmAmAmAmAmCdCmCfAmGfAmAmUmA*mA*mG;

[0094] f) The dsRNA is 11002.17-21, wherein the 5'-3' sense strand contains

[0095] I nvab*mG*mCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mG*mG;

[0096] g) The dsRNA is 11002.10-23, wherein the 5'-3' sense strand comprises

[0097] I nvab*mC*mUmAmCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAI nvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mA*mG;

[0098] An siRNA targeting the ANGPTL3 gene or a pharmaceutically acceptable salt thereof, the sequence of which is selected from one of the following, or a sense strand or antisense strand sequence that differs from it by no more than 1 nucleotide:

[0099] H) The dsRNA is 7061f, wherein the sense strand comprises UACUUGAACUCAACUCAAA (SEQ ID NO: 579), and the antisense strand comprises UUUGAGUUGAGUUCAAGUGGG (SEQ ID NO: 580);

[0100] I) The dsRNA is 7061b, wherein the sense strand comprises GCCACUUGAACUCAACUCAAA (SEQ ID NO: 571), and the antisense strand comprises UUUGAGUUGAGUUCAAGUGGC (SEQ ID NO: 572);

[0101] In some of these embodiments, the siRNA is modified and is selected from one of the following sequences, or a sense strand or antisense strand sequence that differs from it by no more than 1 nucleotide:

[0102] h) The dsRNA is 7061.18-14, wherein the 5'-3' sense strand comprises

[0103] I nvab*mU*mAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAI nvab, and the antisense strand comprises VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mG;

[0104] i) The dsRNA is 7061.4 - 16, wherein the 5'-3' sense strand contains

[0105] I nvab*mG*mCmCmAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAI nvab, and the antisense strand contains VPU - S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mC;

[0106] The seventh aspect of the present invention is to provide an siRNA agent targeting the AGT gene, PCSK9 gene or ANGPTL3 gene, and its active ingredient is composed of the siRNA described in any one of the above or its pharmaceutically acceptable salt linked with a ligand.

[0107] In some embodiments, the ligand is an N - acetylgalactosamine derivative. Preferably, the structural formula of the ligand is as follows:

[0108]

[0109] In some embodiments, the ligand is linked to the 3' end of the sense strand through a chemical bond. Preferably, the chemical bonds are respectively a phosphoester bond or a phosphorothioate bond, and the connection mode is as follows:

[0110]

[0111] Or

[0112]

[0113] Through the study of the siRNA sequence and a large number of experiments, we have screened multiple dual - targeting siRNA agents that can be used to simultaneously inhibit the expression of any two targets among AGT, PCSK9, and ANGPTL3. On this basis, appropriate modifications have been made to improve the silencing ability of the target and reduce non - target activity. It can be used for single - target and, more importantly, dual - target applications. At the same time, the siRNA agent described in the present invention can be delivered to the liver through a suitable delivery system for two preferably combined targets to play a role and achieve better activity effects. It is expected to be applied clinically in diseases related to any two targets among AGT, PCSK9, and ANGPTL3, such as hypertension or / and lipid disorders. Brief Description of the Drawings

[0114] Figure 1It is the curve of the inhibitory effect of the AGT / PCSK9 dual-targeting siRNA DT03081 on the AGT target over time in AAV8-hAGT / hPCSK9 mice at a dose of 60 nmol / kg.

[0115] Figure 2 It is the curve of the inhibitory effect of the AGT / PCSK9 dual-targeting siRNA DT03081 on the PCSK9 target over time in AAV8-hAGT / hPCSK9 mice at a dose of 60 nmol / kg. Detailed implementation manners

[0116] For the convenience of understanding the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0117] For the experimental methods without specific conditions noted in the following examples, they are usually in accordance with conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or in accordance with the conditions recommended by the manufacturer. All common chemical reagents used in the examples are commercially available products.

[0118] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not used to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0119] The present invention provides a dual-targeting siRNA agent, which comprises two different siRNAs or their pharmaceutically acceptable salts targeting two different genes. The siRNA is a dsRNA composed of a sense strand and an antisense strand. Among them, it includes a first dsRNA targeting a first gene and a second dsRNA targeting a second gene. The first dsRNA and the second dsRNA are connected by a pharmaceutically acceptable ligand. The first target gene and the second target gene are respectively selected from angiotensinogen (AGT), angiopoietin-like 3 (ANGPTL3), and proprotein convertase subtilisin / kexin type 9 (PCSK9);

[0120] The expression of two targets in any combination of AGT, ANGPTL3, and PCSK9 can be evaluated based on the levels of any variables related to the expression of the AGT, ANGPTL3, and PCSK9 genes, such as the levels of AGT, ANGPTL3, and PCSK9 mRNA, AGT, ANGPTL3, and PCSK9 proteins, and related blood lipid levels in tissues or sera. Inhibition can be evaluated by a decrease in the absolute or relative levels of one or more of these variables compared to a control level. The control level can be any type of control level used in the art, such as a pre-dose baseline level, or a level measured from untreated or control-treated similar subjects, cells, or samples, and known population levels.

[0121] In some embodiments, the application is for diseases related to the expression of two targets in any combination of AGT, ANGPTL3, and PCSK9 in the treatment or prevention of hypertension and / or lipid disorders.

[0122] The application in a medicament for treating and / or preventing diseases related to hypertension, wherein the diseases related to hypertension are mediated by the AGT gene, including but not limited to borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, resistant hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and labile hypertension, or other diseases related to AGT gene mediation.

[0123] The application in a medicament for treating and / or preventing diseases related to lipid disorders, wherein the diseases related to lipid disorders are mediated by the PCSK9 gene, including but not limited to hyperlipidemia, atherosclerosis, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, or other diseases related to PCSK9 gene mediation.

[0124] The application in a medicament for treating and / or preventing diseases related to lipid disorders, wherein the diseases related to lipid disorders are mediated by the ANGPTL3 gene, including but not limited to hyperlipidemia, hypertriglyceridemia, abnormal lipid and / or cholesterol metabolism, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, cardiometabolic diseases, obesity, atherosclerosis, type II diabetes, cardiovascular diseases, coronary artery diseases, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis caused by hypertriglyceridemia, or other diseases related to ANGPTL3 gene mediation.

[0125] Delivery of the siRNA agents of the present invention to cells, such as cells within a subject (such as a human subject, such as a subject suffering from a related disorder such as AGT, ANGPTL3, and PCSK9, such as hemochromatosis), can be achieved through a variety of different routes. For example, delivery can be effected by contacting the cells with the siRNA of the present invention, either in vitro or in vivo. In vivo delivery can also be effected by administering a composition comprising the siRNA or a salt thereof to the subject.

[0126] Generally, any method of delivering a nucleic acid molecule (in vitro or in vivo) can refer to existing delivery techniques. For in vivo delivery, factors considered for delivering siRNA molecules include, for example, the biological stability of the molecule being delivered, prevention of non-specific effects, and accumulation of the molecule being delivered within the target tissue. The formulation can be administered locally (for example, by direct injection or implantation into the tissue or topical administration). Local administration to the treatment site maximizes the local concentration of the drug formulation, limits the exposure of the agent to systemic tissues that may be harmed by the agent or may degrade the agent, and allows for a lower total dose of the siRNA molecule to be administered.

[0127] For systemic administration of siRNA to treat a disease, the RNA can be modified or delivered using a drug delivery system; both methods act to prevent rapid degradation of the dsRNA by endonucleases and exonucleases in vivo. Modification of the RNA or the pharmaceutical carrier can also allow the siRNA composition to be targeted to the target tissue and avoid off-target effects. The siRNA molecule can be modified by chemically conjugating a lipophilic group such as cholesterol, for example, lipid particles, to enhance cellular uptake and prevent degradation.

[0128] The present invention also includes pharmaceutical compositions and formulations that comprise any of the siRNAs or salts thereof of the present invention. In some embodiments, the pharmaceutical formulation contains a pharmaceutical composition comprising the siRNA or a salt thereof described herein and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the siRNA is useful for treating diseases or disorders related to AGT, ANGPTL3, and PCSK9, such as hemochromatosis. These pharmaceutical compositions are formulated based on the mode of delivery.

[0129] In some embodiments, the composition is formulated for systemic administration via parenteral delivery such as intravenous (IV) delivery or subcutaneous (SC) delivery. In the methods of the present invention, the pharmaceutical formulation of the siRNA or a salt thereof can be administered in solution, preferably in a sterile solution, for example, by injection.

[0130] In the present invention, a "therapeutically effective amount" includes an amount of siRNA or a salt thereof that, when administered to a patient for treating diseases related to AGT, ANGPTL3, PCSK9, etc., is sufficient to effect treatment of the disease (e.g., by attenuating, alleviating, or maintaining an existing disease or one or more symptoms of the disease). The "therapeutically effective amount" may vary depending on the pharmaceutical formulation of the siRNA or a salt thereof, how the formulation is administered, the disease and its severity, and the medical history, age, weight, family history, genetic makeup of the patient to be treated, the stage of the pathological process mediated by the expression of AGT, ANGPTL3, PCSK9, etc., the type of previous treatment or combination treatment (if any), and other independent characteristics.

[0131] In the present invention, a "prophylactically effective amount" includes an amount of a pharmaceutical agent containing siRNA or a salt thereof that, when administered to a subject who has not yet experienced or manifested symptoms of a disease related to AGT, ANGPTL3, PCSK9, etc., but is likely to be susceptible to the disease, is sufficient to prevent or alleviate the disease or one or more symptoms of the disease. Alleviating the disease includes delaying the progression of the disease or reducing the severity of a disease that develops subsequently. The "prophylactically effective amount" may vary depending on how the pharmaceutical formulation of the siRNA or a salt thereof is administered, the degree of risk of the disease, and the medical history, age, weight, family history, genetic makeup of the patient to be treated, the stage of the pathological process mediated by the expression of AGT, ANGPTL3, PCSK9, etc., the type of previous treatment or combination treatment (if any), and other independent characteristics.

[0132] A "therapeutically effective amount" or a "prophylactically effective amount" also includes an amount of an siRNA with any reasonable benefit-risk ratio acceptable for treatment.

[0133] The targeted delivery ligand or other types of delivery vectors described in the present invention, the ligand is preferably an N-acetylgalactosamine derivative (GalNAc vector), and other types of delivery vectors such as liposomes specifically delivered to liver cells can be used in the present invention as long as they can achieve the delivery of siRNA.

[0134] In recent years, there has been relatively in-depth research on GalNAc vectors. GalNAc-nucleic acid is a single conjugate formed by a saccharide compound and a nucleic acid. N-acetylated galactosamine is covalently conjugated to the 3′ and / or 5′ ends of the sense strand of RNA with different sequences in a trivalent manner to form a GalNAc-siRNA drug, thereby achieving specific delivery to liver cells and enabling the drug to enter cells and exert its function through endocytosis.

[0135] In all siRNAs of the present invention, they all target human AGT, PCSK9 or ANGPTL3. In some embodiments, the use of hAGT, hPCSK9 or hANGPTL3 to represent the target is to emphasize that the genes or proteins detected in AAV8-transfected mice or humanized mice are human AGT, human PCSK9 or human ANGPTL3.

[0136] In the following partial embodiments, the structures of the dual-target GalNAc ligands are as follows:

[0137]

[0138]

[0139] The single-target GalNAc ligand is as follows:

[0140]

[0141] In the following partial embodiments, the structures of the dual-target GalNAc ligands after linking with siRNA are as follows:

[0142]

[0143]

[0144] The structure of the single-target GalNAc ligand after linking with siRNA is as follows:

[0145]

[0146]

[0147] In the nucleic acid sequence listing of the present invention, the abbreviations and structures of the nucleotide monomers used are as follows:

[0148]

[0149]

[0150]

[0151] Those skilled in the art know that based on the existing technology, the pharmaceutically acceptable salts of the siRNA can be sodium salts or potassium salts. For example, when purified, sodium salts are produced.

[0152] Human angiotensinogen (AGT) mRNA [NCBI reference sequence: NM_001384479.1].

[0153] Human proprotein convertase subtilisin / kexin type 9 gene (PCSK9) mRNA [NCBI reference sequence.

[0154] NM_174936.4]:

[0155] Human angiopoietin-like protein 3 (ANGPTL3) mRNA [NCBI Reference Sequence: NM_014495.4].

[0156] The present invention will be further described in detail below in conjunction with specific embodiments.

[0157] Example 1 siRNA targeting human AGT (hAGT)

[0158] On a 12-channel nucleic acid synthesizer of Beijing Tsingke Biotechnology Co., Ltd., solid-phase oligonucleotide synthesis was used to synthesize 0.2 - 1 μmol of oligonucleotides. The siRNA sequence needed to be synthesized on a CPG pre-filled column, and CPG coupled with GalNAc or general-purpose CPG was used as required. An ammonolysis reagent was added to the synthesized oligonucleotides and incubated at 45 - 80 °C to separate the oligonucleotides from the solid-phase carrier and free the oligonucleotides. Then, the crude oligonucleotides were precipitated with ethanol, the supernatant was discarded by high-speed centrifugation, and this was repeated twice to obtain the crude oligonucleotides, and the precipitate was resuspended in DEPC water. The crude oligonucleotides were purified by ion-pairing HPLC, and the collected product was dried to a powder in a vacuum centrifugal dryer. The purified product was dissolved in DEPC water and analyzed by TOF LC-MS. The concentration of the oligonucleotides was measured, and the volumes required for equimolar amounts of the sense strand and antisense strand were calculated. The equimolar amounts of the sense strand and antisense strand were mixed evenly, and a double strand was prepared by annealing at 95 °C for 5 minutes and then naturally cooling to room temperature.

[0159] Table 1: Sense and antisense strand sequences of unmodified siRNA targeting the AGT gene

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166] Next, we modified the siRNA to improve its stability in vitro and in vivo, enhance its activity against the target, and reduce its activity against non-targets. Unless otherwise specified, the L96 delivery method was used for in vivo and in vitro screening of single-target sequences to more realistically reflect the effect of liver-targeted siRNA. The siRNA was linked to L96 by connecting the 3'-end of the sense strand to L96.

[0167] The duplex 1000PM (AD-85481), the fastest progressing drug targeting the AGT gene, Zilebesiran, is currently in Phase II clinical trials with the patent number US11015201B2 and was used as a positive control sequence.

[0168] Table 2: Modified siRNA sequences targeting the AGT gene

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179] Example 2 In vitro screening of siRNA targeting AGT

[0180] Experimental method 1: In vitro screening of siRNA was performed by liposome transfection in Hep3B cells

[0181] Cell culture and transfection in 96-well plates: In vitro experiments were conducted in Hep3B cells using MEM + 10% FBS + 1X penicillin-streptomycin + 1X non-essential amino acids medium. When the cell monolayer reached 80% confluence, the cells were digested with trypsin, and the cell density was measured using a Scepter automated cell counter (Millipore, #PHCC00000). Meanwhile, siRNA, Opti-MEM, and INTERFERin (Polyplus) were mixed in a 96-well plate and incubated at room temperature for 10 minutes. Then, complete medium containing Hep3B cells was added to each well, and the 96-well plate was incubated in an incubator at 37°C and 5% CO2 for 24 hours.

[0182] RNA extraction and reverse transcription in 96-well plates: The mRNA of cells in the 96-well plates was extracted using Oligo d(T)25 Magnetic Beads reagent (NEB). The medium in the 96-well plates was aspirated, and the wells were washed once with DPBS. 100 μl of cell lysis buffer was added to each well, followed by 20 μl of beads. The plate was shaken on an oscillator and then placed on a magnetic separation rack. The lysate in the wells was aspirated. 100 μl of wash buffer A was added to each well, and after pipetting, the plate was placed on the magnetic separation rack again to aspirate wash buffer A. Then, the beads were resuspended with 100 μl of wash buffer B and transferred to a new 96-well plate. After placing on the magnetic separation rack, wash buffer B was aspirated. The beads were then resuspended with 100 μl of low-salt buffer and transferred to a 96-well PCR plate. The 96-well PCR plate was placed on the magnetic separation rack to aspirate the low-salt buffer. 10 μL of elution buffer was added to each well to resuspend the beads, and the plate was incubated at 50°C for 2 minutes to elute the mRNA from the beads. The reverse transcription reaction system was prepared using StarScript Pro one-tube genomic DNA removal and reverse transcription premix (genstar). 5 μL of the reaction system was aliquoted into each well of the 96-well PCR, and 5 μL of the mRNA solution obtained in the previous step was added and mixed well. After a brief centrifugation, the plate was sealed with a sealing film. 9) The plate was incubated at 37°C for 3 minutes, 50°C for 50 minutes, then 85°C for 2 minutes, and cooled to 4°C to complete the reverse transcription.

[0183] Real-time fluorescence quantitative PCR: After the reverse transcription was completed, the 96-well plate was placed on the magnetic separation rack until the beads were adsorbed at the bottom. The reverse transcription reagent was aspirated, and the prepared QPCR reaction system was added to the 96-well PCR plate, which was then sealed with a sealing film. PCR was performed on a StepOnePlus real-time PCR system (applied biosystems). The data were analyzed using the ΔΔCt method, and the cells transfected with the negative control sequence at the same concentration were used for normalization.

[0184] The sequence of the negative control AD-1955 is as follows:

[0185] Sense strand: CUUACGCUGAGUACUUCGAdTdT (SEQ ID NO: 703)

[0186] Antisense strand: UCGAAGUACUCAGCGUAAGdTdT (SEQ ID NO: 704).

[0187] The primers for detecting AGT are as follows:

[0188] Forward primer: ATTCTGCACACCGAGCTGAA (SEQ ID NO: 705)

[0189] Reverse primer: TCAAGCTCAAAAAAAATGCTGTTC (SEQ ID NO: 706)

[0190] Probe: CTGCAAAAATTGAGCAATGACCGCATC (SEQ ID NO: 707) (reporter gene 5' FAM, quenching group 3' MGB)

[0191] Experimental method 2: In vitro screening was carried out in primary hepatocytes of humanized AGT mice (purchased from Jicui Yaokang) or mice infected with AAV8 virus co-expressing human AGT (hAGT) and ANGPTL3 (h ANGPTL3).

[0192] Construction of mice infected with AAV8 virus stably expressing hAGT and hANGPTL3 (AAV8-hAGT / hANGPTL3 mice): Through 1x10 11 Ultra-purified recombinant AAV8-hAGT with a titer of 1x10 11 Ultra-purified recombinant AAV8-hANGPTL3 virus particles with a titer of 1x10 were used to infect mice to obtain transgenic mice stably expressing hAGT and hANGPTL3 simultaneously.

[0193] Extraction of mouse primary hepatocytes: Mouse hepatocytes were extracted by perfusion through the inferior vena cava and digested with collagenase. After filtration through a tissue cell strainer (BIOLOGIX, 15-1070), viable mouse primary hepatocytes were obtained and resuspended in DMEM medium + 10% FBS + 1X penicillin-streptomycin, and the cell density was measured using a Scepter automatic cell counter.

[0194] The methods of siRNA transfection, RNA extraction, reverse transcription and real-time fluorescence quantitative PCR were the same as those in method 1. For free uptake delivery of siRNA, INTERFERin was not required to be added.

[0195] Table 3: Experimental results of 0.1 nM modified siRNA transfected by liposome in Hep3B cells

[0196]

[0197] We performed activity screening on some sequences targeting AGT using Hep3B cells. As shown in Table 3, at a concentration of 0.1 nM, the activities of multiple sequences such as 1131.21-11, 1165.1-1, 1167.1-1, and 1172.1-1 were similar to or better than that of the positive reference.

[0198] Table 4: Experimental results of 1 nM modified siRNA delivered by L96 in primary hepatocytes of humanized AGT mice

[0199]

[0200]

[0201] We further used primary hepatocytes of humanized AGT mice to evaluate the in vitro activity of modified siRNA. As can be seen from Table 4, when delivered by L96, the activities of multiple siRNAs such as 1131.21-11 and 1167.1-1 were superior to the positive reference sequence.

[0202] Table 5: Experimental results of 0.1 nM modified siRNA delivered by L96 in primary hepatocytes of AAV8-hAGT / hANGPTL3 mice

[0203]

[0204]

[0205] From the experimental data in Table 5, we found that the activities of multiple siRNAs such as 1165.4-13 and 1167.3-14 were superior to the positive reference of 1000 PM at a concentration of 0.1 nM in primary hepatocytes of AAV8-hAGT / hANGPTL3 mice under the condition of delivery by L96. Moreover, we found that even with the same seed region, the activity of 1165.4-13 was superior to that of 1165.2-3, and the activity of the 19 / 21 paired 1167.3-14 sequence was superior to that of the 21 / 21 paired 1167.2-4, indicating that some changes in the ending bases of siRNA would also greatly affect the activity of the sequence. Next, we evaluated the sequences with better activities in the above several in vitro experiments in mice.

[0206] Example 3 Evaluation of the effect of preferred sequences on AGT protein expression in AAV8-hAGT mice

[0207] Experimental method:

[0208] 1. Adenovirus integration of hAGT

[0209] Through 1x1011 The titer of ultra-purified recombinant AAV8 virus particles was used to infect mice, and transgenic mice stably expressing hAGT were obtained.

[0210] 2. Experimental grouping and drug administration

[0211] Fourteen days after the mice were injected with the virus, blood was collected from the submandibular vein, left to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, the supernatant serum was taken, aliquoted and stored frozen at -80 °C. The serum samples were diluted 1000-fold, and the expression of hAGT in the mouse serum was detected by Human Angiotensinogen / AGT / SerpinA8 ELISA Kit (Linkage Biotechnology, product number: EK1202–96). Based on the expression level of hAGT, the mice were evenly grouped, with 4 mice in each group. The siRNA was dissolved in PBS, and the concentration was adjusted to 0.2 mg / kg. The mice were subcutaneously injected with the siRNA solution at a dose of 1 mg / kg.

[0212] 3. ELISA detection

[0213] After the injection of siRNA, blood was collected from the submandibular vein at regular intervals, left to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, the supernatant serum was taken, diluted 1000-fold, and the expression level of hAGT was detected by ELISA. The remaining amount of AGT (%) = the hAGT protein concentration on the Nth day / the hAGT protein concentration on the 0th day * 100%.

[0214] Table 6: Experimental results of the change in hAGT protein expression level over time after hAGT-targeted siRNA was delivered into AAV8-hAGT mice through L96 at a dose of 1 mg / kg

[0215]

[0216]

[0217] NA indicates not detected

[0218] As can be seen from Table 6, some sequences with good in vitro activity do not have better activity in vivo than the positive control. The activities of several siRNAs such as 1161.3-7, 1165.3-11, 1167.4-14, 1172.2-17 and 1172.9-28 are equivalent to or better than that of the positive reference 1000PM. Especially at the 56th day, it can be clearly seen that the hAGT protein expression level in the positive reference sequence 1000PM group shows a significant rebound, while the hAGT protein expression levels in the groups of 1165.3-11, 1167.4-14, 1172.2-17 and 1172.9-28 still remain below 50%. In addition, the AGT expression of 1161.3-7 only remains 24% at the 30th day, while 1161.3-11 remains 45.1% at the 30th day. This indicates that after different modifications of the same naked sequence, its activity difference is significant, further proving that the modification has an extremely important impact on the activity of siRNA.

[0219] Example 4 Safety Test of siRNA

[0220] SiRNA was subcutaneously injected into 7-8-week-old mice (Vital River) at a dose of 400 mg / kg every two weeks for 4 weeks, with a total of 3 injections. The control group of mice was subcutaneously injected with normal saline every two weeks for 4 weeks, with a total of 3 injections, and there were 4-6 mice in each group. Serum was collected 24 hours after the last injection for detecting the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST).

[0221] Table 7: Results of Safety Experiment of AGT-Targeting siRNA

[0222] siRNA ALT (U / L) AST (U / L) Normal saline 42 135 1167.3-14 31 75 1172.2-17 221 219 1191.1-1 325 347

[0223] As can be seen from Table 7, different siRNA sequences have different effects on the liver function of mice. 1167.3-14 has no effect on liver function in mice, while 1172.2-17 and 1191.1-1 have great effects.

[0224] Example 5 Effects of Different Modifications on the Activity and Stability of Preferred Sequences Targeting AGT

[0225] The method for sequence activity refers to Example 2.

[0226] The experimental method for siRNA stability study is as follows:

[0227] The tested compound sequence was accurately diluted with DEPC water to a working solution with a concentration of 10 μM.

[0228] Preparation of liver homogenate: Weigh 200 mg of mouse liver, add 1 mL of potassium phosphate buffer solution and 5 magnetic beads, and homogenize 3 times in a grinder under the conditions of 60 HZ and 30 s / time to obtain 200 mg / mL liver homogenate.

[0229] Preparation of 72h samples: Take 17 μL of 10 μM test compound / positive compound working solution, add 153 μL of liver homogenate and mix well by vortexing for 30 s. Take 75 μL of the compound and liver homogenate mixture into an EP tube, with 2 parallel samples, and incubate in a 37 °C incubator for 72 h. After incubation, take out 50 μL.

[0230] Preparation of 0h samples: Take 75 μL of liver homogenate into an EP tube, with 2 parallel samples, and incubate in a 37 °C incubator for 72 h. After incubation, take out 45 μL of liver homogenate, add 5 μL of 10 μM test compound / positive compound, and mix well.

[0231] Add 5 μL of 50 μg / ml internal standard to each incubated sample and mix well. Then add 100 μL of lysis solution to each tube, vortex for 30 s, and let stand for 20 min.

[0232] After all samples are treated with appropriate pretreatment methods, take the supernatant for instrumental analysis. Then calculate, relative remaining rate (%) = (compound content at 72 h / compound content at 0 h) × 100%.

[0233] Next, we explored whether all sequences near 1167 have high activity. Therefore, we selected sequences with a difference of 1 - 2 nucleotides from 1167 near 1167 and evaluated their activities in primary humanized AGT mouse hepatocytes. The results are shown in Table 8.

[0234] Table 8: Experimental results of 1 nM modified siRNA delivered by L96 in primary mouse hepatocytes

[0235]

[0236] We found that sequences such as 1198.1 - 1, 1222.1 - 1, 1223.1 - 1, 1224.1 - 1 have much lower activity compared to 1167.3 - 5. At the same time, we also found that even in the same seed region, 1167.3 - 5 with 19 / 21 pairing has much higher activity than 1167.2 - 4 and 1167.11 - 15 with 21 / 21 pairing.

[0237] Next, we explored the effect of different modifications on the activity of 1167. The results are shown in Table 9.

[0238] Table 9: Experimental results of different concentrations of modified siRNA transfected by different methods in different cells

[0239]

[0240] NA indicates not detected

[0241] For the preferred sequence 1167, different modified siRNAs were designed, and their activities were compared in vitro in Hep3B cells, primary hepatocytes of AAV8-hAGT / hPCSK9 mice, and primary hepatocytes of humanized AGT mice by liposome transfection and free uptake, respectively. The experimental method was referred to Example 2. As can be seen from Table 9, different modifications have a great impact on the activity of the sequence. The activity of 1167.17-19 with the highest activity is much higher than that of the positive reference, while the activity of 1167.12-14 with the worst activity is much worse than that of the positive reference, further illustrating the importance of modification for the activity of siRNA. Next, we tested the stability of the sequences with good activity in liver homogenate to evaluate their stability in vivo.

[0242] Table 10: Experimental results of the stability of different modified siRNAs in liver homogenate

[0243] siRNA Residual ratio of antisense strand at 72 h (%) 1167.3-5 70.74 1167.3-16 58.98 1167.16-5 79.27 1167.16-16 68.00 1167.17-17 90.89 1167.17-19 91.16

[0244] As can be seen from Table 10, different modifications result in different stabilities of the sequences in liver homogenate. The most active 1167.17-19 is also more stable in liver homogenate compared to other modified 1167 sequences.

[0245] Table 11: Experimental results of 0.1 nM modified siRNA delivered by liposome in primary hepatocytes of humanized AGT mice

[0246]

[0247] Table 12: Experimental results of the stability of different modified siRNAs in liver homogenate

[0248] siRNA Residual ratio of antisense strand at 72 h (%) 1167.17-19 81.96 1167.22-19 86.08 1167.23-19 68.25 1167.24-19 59.74

[0249] From Table 11 and Table 12, we found that different endings have a great impact on the activity and stability of the 1167 sequence. When 1167 uses the mGmG ending, both the activity and stability are much higher than those with mCmC, dTdT, or mAmA endings.

[0250] Table 13: Experimental results of 0.3 nM modified siRNA delivered by L96 in primary hepatocytes of AGT / PCSK9 double humanized mice

[0251]

[0252] As can be seen from Table 13, the activity of 1167.25-19 modified by VPU-S is comparable to that of 1167.17-19 modified by VPU.

[0253] We further optimized the two sequences 1165 and 1161 with good activity and high safety, and detected the in vitro activity changes with different modifications and different base changes.

[0254] Table 14: Experimental results of the delivery of 0.3 nM modified siRNA duplexes by L96 in primary hepatocytes of AGT / PCSK9 dual-humanized mice

[0255]

[0256]

[0257] Preferred sequences 1161 and 1165 were further optimized by changing bases and modifications. It was found that the VPU-S modification had a very significant impact on the activity of these two sequences. Among them, for sequence 1161, the three modifications 1161.4-13, 1161.5-14, and 1161.7-15 had the best activity. For sequence 1165, the three modifications 1165.8-17, 1165.5-14, and 1165.5-16 all had good activity. And the activity of these preferred sequences was much higher than that of the positive reference 1000 PM.

[0258] Table 15: Experimental results of the delivery of different concentrations of modified siRNA by SL01 in primary hepatocytes of AAV8-AGT / ANGPTL3 mice

[0259]

[0260] For the preferred sequences 1161.7-15, 1161.7-17, 1165.5-14, 1165.5-16, 1167.25-19, and 1167.27-21, the in vitro activity evaluation of the siRNA duplexes delivered by SL01 was carried out at concentrations of 1 nM and 0.1 nM. As can be seen from Table 15, at 1 nM and 0.1 nM, the activity of the preferred sequences was higher than that of the Alnylam positive reference. Among them, the best activities were 1167.25-19, 1165.5-14, and 1165.5-16.

[0261] Next, we evaluated multiple preferred sequences in vivo.

[0262] Table 16: Experimental results of the hAGT protein expression level after the delivery of AGT-targeted siRNA into AAV8-hAGT mice by L96 at a dose of 1 mg / kg

[0263]

[0264] As can be seen from Table 16, the in vivo activities of 1167.25-19, 1167.27-21, and 1165.5-16 are far superior to the positive reference, especially in terms of long-acting property. At day 74, the inhibitory rate of the positive reference 1000PM on AGT expression remained only 20%, while the inhibitory rates of the preferred sequences 1167.25-19, 1167.27-21, and 1165.5-16 on AGT expression were still about 50%. Next, we tested the in vivo activity of delivering the preferred sequences using SL01.

[0265] Table 17: Experimental results of hAGT protein expression levels after hAGT-targeting siRNA was delivered into AAV8-hAGT / hPCSK9 mice at a dose of 1 mg / kg by SL01

[0266]

[0267]

[0268] For the two sequences with the best activity, their activities were further verified in vivo. Among them, the positive reference was delivered using L96, and 1167.25-19 and 1165.5-16 were delivered using SL01. It can be seen that the activities of the two preferred sequences are far superior to the positive reference.

[0269] Example 6 Synthesis of siRNA Targeting PCSK9

[0270] The synthesis method refers to Example 1. The double-stranded 11000PM is the approved drug inclisiran, with the patent number CN108220295B, and is used as the positive control sequence.

[0271] Table 18: Sense and antisense strand sequences of unmodified siRNA targeting PCSK9

[0272]

[0273]

[0274]

[0275]

[0276] Next, we modified the siRNA to improve its stability in vivo and in vitro, enhance its activity against the target, and reduce its activity against non-targets. Unless otherwise specified, when performing in vivo and in vitro screening of single-target sequences, the L96 delivery method was used to more truly reflect the effect of liver-targeting siRNA. The connection method between the siRNA and L96 is that the 3'-end of the sense strand is connected to L96.

[0277] Table 19: Modified siRNA sequences targeting PCSK9

[0278]

[0279]

[0280]

[0281]

[0282]

[0283]

[0284]

[0285] Experimental results of the in vitro activity and stability of siRNA targeting PCSK9 in Example 7

[0286] Humanized PCSK9 mice were purchased from Shanghai Model Organisms Center, Inc. The experimental method for extracting primary hepatocytes and the method for qPCR detection of cell target genes refer to Example 2.

[0287] The primers for detecting PCSK9 are as follows:

[0288] Forward primer: ACGTGGCTGGCATTGCA (SEQ ID NO: 708)

[0289] Reverse primer: AAGTGGATCAGTCTCTGCCTCAA (SEQ ID NO: 709)

[0290] Probe: CATGATGCTGTCTGCCGAGCCG (SEQ ID NO: 710) (reporter gene 5'NED, quenching group 3'BHQ1)

[0291] Table 20: Experimental results of transfection of different concentrations of modified siRNA in Hep3B cells by liposomes

[0292]

[0293]

[0294] NA indicates not detected

[0295] Table 21: Experimental results of transfection of different concentrations of modified siRNA in primary hepatocytes of humanized PCSK9 mice by liposomes or L96 delivery

[0296]

[0297] Table 22: Experimental results of 10 nM modified siRNA delivered by L96 in primary hepatocytes of humanized PCSK9 mice

[0298]

[0299]

[0300] In vitro activity data of Hep3B and primary hepatocytes of humanized PCSK9 mice showed that the activities of multiple sequences, including 11002.1-1, 11040.1-1, and 11042.1-1, were better than that of the positive control. Next, we tested the activities of these sequences in humanized PCSK9 mice.

[0301] Example 8 Evaluation of the effect of single subcutaneous injection of 1 mg / kg siRNA on PCSK9 protein expression in humanized PCSK9 mice

[0302] Experimental method:

[0303] 1. Experimental grouping and drug administration

[0304] Before the experiment, whole blood was obtained from mice by submandibular vein blood collection. The blood sample was allowed to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, and the supernatant serum was taken, aliquoted and stored frozen at -80 °C. The serum sample was diluted 1000-fold, and the expression of PCSK9 in mouse serum was detected by Human PCSK9 ELISA Kit (proteintech, Cat No: KE00278). Based on the PCSK9 expression level, the mice were evenly grouped, with 4 mice in each group. The siRNA was dissolved in normal saline, and the concentration was adjusted to 0.1 mg / ml. The mice were injected subcutaneously with the siRNA solution at a dose of 1 mg / kg.

[0305] 2. ELISA detection

[0306] After siRNA injection, a small amount of blood was taken from the submandibular vein at regular intervals. The blood sample was allowed to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, and the supernatant serum was taken. After dilution 1000-fold, the expression level of PCSK9 was detected by ELISA.

[0307] The experimental results are shown in Table 23.

[0308] Table 23: Experimental results of the inhibition of PCSK9 protein expression level in humanized PCSK9 mice by PCSK9-targeted siRNA at a dose of 1 mg / kg

[0309]

[0310] Data showed that the inhibitory rate of serum PCSK9 protein reached the maximum on the 30th day after drug administration and then rebounded. In the positive reference group, about 89.7% of PCSK9 protein remained on the 40th day, and the inhibitory rate was about 10.3%. The inhibitory rates of the other experimental groups were higher than that of the positive reference group. In particular, for 11040.1-6 and 11042.1-15, the inhibitory rates were both greater than 50%. The inhibitory rate of 11002.1-8 was also 46.8%. On the 55th day, the inhibitory rate of the 11042.1-15 group was still 50%. The activity of 11040.1-6 was higher than that of 11040.1-8, indicating that even for the same sequence, different modifications have different activities in vivo.

[0311] Example 9 Safety Test of Targeted PCSK9 siRNA

[0312] For the siRNA safety test method, refer to Example 4, and the experimental results are shown in Table 24.

[0313] Table 24: Experimental Results of the Safety of Targeted PCSK9 siRNA

[0314] siRNA ALT (U / L) AST (U / L) Normal saline 47 154 11002.7-14 47 172 11040.3-10 39 85 11042.1-15 526 320

[0315] Note: The data of 11042.1-15 were tested 10 days after the second injection.

[0316] As can be seen from Table 24, 11002.7-14 and 11040.3-10 have good safety in mice, while 11042.1-15 has a great impact on liver function in mice.

[0317] Example 10 Effects of Different Modifications and Base Changes of 11002 and 11040 on Sequence Activity and Stability

[0318] Table 25: Experimental Results of 1 nM Modified siRNA Delivered by L96 in Primary Hepatocytes of Humanized PCSK9 Mice

[0319]

[0320] As can be obtained from Table 25, for the same sequence, different modifications of the sense strand have a great impact on activity. The modification of 11040.1-23 has the best activity.

[0321] Table 26: Experimental Results of 3 nM Modified siRNA Delivered by L96 in Primary Hepatocytes of Humanized PCSK9 Mice

[0322]

[0323] As can be obtained from Table 26, for different sequences with base and modification changes, the activity changes are different.

[0324] Table 27: Metabolic stability data of different modified siRNAs in liver homogenate

[0325] siRNA Residual ratio of antisense strand at 72 h (%) 11000PM 68.26 11002.1-1 73.45 11002.3-10 70.31 11002.5-14 63.18 11002.7-14 86.41 11040.1-1 107.97 11040.3-10 48.69 11040.5-10 24.93 11040.7-18 25.32

[0326] It can be concluded from Table 27 that different sequence modifications and base changes have different effects on stability. Among them, 11002.7-14 and 11040.1-1 are very stable in liver homogenate, while the stability of 11002.5-14 and 11040.5-10 decreases significantly.

[0327] Table 28: Experimental results of different concentrations of modified siRNAs delivered by L96 or liposome transfection in primary hepatocytes of humanized PCSK9 mice

[0328]

[0329] Table 29: Experimental results of different concentrations of modified siRNAs delivered by L96 or liposome transfection in primary hepatocytes of humanized PCSK9 mice

[0330]

[0331] Table 30: Experimental results of 0.3 nM modified siRNA delivered by liposome in primary hepatocytes of AVV8-hPCSK9 mice

[0332]

[0333] Table 31: Experimental results of 0.1 nM modified siRNA transfected by liposome in primary hepatocytes of AVV8-hPCSK9 mice

[0334]

[0335] Table 32: Experimental results of different concentrations of modified siRNAs delivered by L96 in primary hepatocytes of AVV8-hPCSK9 mice

[0336]

[0337]

[0338] The experimental data in Tables 28-32 show that we optimized the 11002 and 11040 sequences from multiple aspects such as the sense strand and the antisense strand. The results indicate that the activities of the preferred sequences 11002.17-21, 11002.10-23 and 11040.10-23 are all better than the positive reference 11000PM. We will next verify the activity of the preferred sequences in vivo.

[0339] Table 33: Experimental results of PCSK9-targeted siRNA inhibiting PCSK9 protein expression level in humanized PCSK9 mice at a dose of 1 mg / kg

[0340]

[0341] It can be concluded from Table 33 that 11002.17-21 and 11040.10-23 are far superior to the positive reference 1000PM in vivo activity.

[0342] Example 11 Synthesis of siRNA Targeting ANGPTL3

[0343] For the specific synthesis method, refer to Example 1.

[0344] Table 34: Sense and Antisense Strand Sequences of Unmodified siRNA Targeting ANGPTL3

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352] Next, we modified the siRNA to improve its stability in vivo and in vitro, enhance its activity against the target, and reduce its activity against non-targets. Unless otherwise specified, the L96 delivery method was used for in vivo and in vitro screening of single-target sequences to more realistically reflect the effect of liver-targeted siRNA. The siRNA was linked to L96 by connecting the 3'-end of the sense strand to L96.

[0353] 7000PM (AD-1331212) is the optimal sequence in US11613751B2 patent. ARO-ANG3 is the optimal sequence in US10995335B2 patent and is used as a positive comparison sequence. The sequence information is shown in Table 34. To investigate the sequence activity, the same GalNAc was used for delivery.

[0354] Table 35: Modified siRNA Sequences Targeting ANGPTL3

[0355]

[0356]

[0357]

[0358]

[0359]

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366]

[0367]

[0368] Example 12 In vitro Activity Evaluation of siRNA Targeting ANGPTL3

[0369] The method for evaluating the in vitro activity of Hep3B cells refers to Example 2. When evaluating the in vitro activity using primary hepatocytes, the method for obtaining transgenic mice stably expressing hANGPTL3 and extracting primary hepatocytes refers to Example 2.

[0370] The primers for detecting ANGPTL3 are as follows:

[0371] Forward primer: ACATGTGGCTGAGATTGCTGG (SEQ ID NO: 711)

[0372] Reverse primer: CCTTTGCTCTGTGATTCCATGTAG (SEQ ID NO: 712)

[0373] Probe: CCTCCCAGAGCACACAGACCTGATGTTT (SEQ ID NO: 713) (reporter gene 5' NED, quenching group 3' MGB)

[0374] Table 36: Experimental Results of Different Concentrations of Modified siRNA Transfected by Liposome or Delivered by L96 in Hep3B and Primary Hepatocytes of Humanized ANGPTL3 Mice

[0375]

[0376]

[0377] NA indicates not detected

[0378] The activities of the modified siRNAs were evaluated by liposome transfection and free uptake in Hep3B cells and primary hepatocytes of humanized ANGPTL3 mice, respectively. From the data in the table, it can be seen that the activities of multiple sequences are better than those of the positive reference. Next, we evaluated their in vivo activities. The results are shown in Table 37 below.

[0379] Example 13 Evaluation of the effect of in vitro preferred sequences on hANGPTL3 expression in the liver in AAV8-hANGPTL3 mice Evaluate the effect of in vitro preferred sequences on hANGPTL3 expression in the liver in mice expressing hANGPTL3.

[0380] Experimental method:

[0381] 1. Adenovirus integration of hANGPTL3

[0382] Through 1 - 10x10 11 Purified recombinant AAV8 virus particles with a titer were used to infect mice to obtain transgenic mice stably expressing hANGPTL3.

[0383] 2. Administration

[0384] Fourteen days after the mice were injected with the virus, the mice were evenly divided into groups of 4. The siRNA was dissolved in physiological saline and injected subcutaneously at a dosage of 1 mg / kg or 3 mg / kg.

[0385] 3. Liver sampling for detection

[0386] The liver was sampled at different time points after the siRNA injection. RNA in the liver tissue was extracted using TRI REAGENT (MRC, catalog number: TR118), and the extracted RNA was reverse transcribed into cDNA using PrimeScript RT regent Kit (Takara, catalog number: RR047A). The prepared QPCR system was added to a 96-well PCR plate, sealed with a sealing film, and QPCR was performed on a StepOnePlus real-time PCR system (appliedbiosystems) to detect the expression level of hANGPTL3.

[0387] Table 37: Experimental results of the inhibition of hANGPTL3 gene expression level in the liver of AAV8-hANGPTL3 mice by ANGPTL3-targeting siRNA at a dose of 1 mg / kg

[0388]

[0389]

[0390] NA indicates not detected

[0391] SiRNAs with good in vitro activity were screened for in vivo activity at a dose of 1 mg / kg. The experimental results are shown in Table 37. The activity of 7061.1-11 was the best, far better than that of the positive reference ARO-ANG3.

[0392] Table 38: Experimental results of 0.3 nM modified siRNA delivered by L96 in primary mouse hepatocytes of AAV8-hAGT / hANGPTL3

[0393]

[0394] It can be seen from Table 38 that the activities of both 7061.9-13 and 7061.1-11 were much higher than that of the positive reference ARO-ANG3

[0395] Table 39: Experimental results of 0.3 nM modified siRNA transfected by liposome in Hep3B cells

[0396]

[0397] It can be seen from Table 39 that the in vitro activities of multiple sequences were better than or equivalent to that of the positive reference. Among them, the activity of the 7061.9-13 sequence was the best. We selected the sequences with good activity in the table and evaluated their activities in AAV8-hANGPTL3 mice.

[0398] Table 40: Experimental data in AAV8-hANGPTL3 mice

[0399]

[0400]

[0401] In vivo activity screening was carried out at a dose of 1 mg / kg. The experimental results are shown in Table 40. On the 28th day, the activities of sequences 7061.9-13 and 7083.1-1 were better than that of the positive reference ARO-ANG3. Sequence 7061 was further optimized, and the activities of its adjacent sequences were also detected.

[0402] Table 41: Experimental results of 1 nM modified siRNA delivered by L96 in primary hepatocytes of humanized ANGPTL3 mice

[0403]

[0404] For sequence 7061, further optimization was carried out on the basis of its modified siRNA 7061.9-13, and in vitro activity evaluation was performed in primary hepatocytes of humanized ANGPTL3 mice. As can be seen from Table 41, different modifications of 7061 showed significant differences in activity. Among them, 7061.4-16 had the highest activity. We also compared the activities of sequences 7094.1-1, 7095.1-1, and 7096.1-1 adjacent to sequence 7061. It can be seen that under the same modification, the activity of 7061 was significantly better than that of its adjacent sequences.

[0405] We further evaluated the activities of 7061.18-14 and 7061.4-16 in primary hepatocytes of humanized ANGPTL3 mice, and the results are shown in Table 42.

[0406] Table 42: Experimental results of 1 nM modified siRNA delivered by L96 in primary hepatocytes of humanized ANGPTL3 mice

[0407]

[0408] As can be seen from Table 42, the activities of 7061.18-14 and 7061.4-16 were much higher than those of the positive reference ARO-ANG3.

[0409] Next, we detected the safety of sequences 7061 and 7083. The experimental results are shown in Table 43

[0410] Table 43: Experimental results of the safety of siRNA targeting ANGPTL3

[0411] siRNA ALT (U / L) AST (U / L) Normal saline 31 121 7061.1-11 38 133 7083.9-2 484 639

[0412] As can be seen from Table 43, 7061.1-11 had good safety in mice, while 7083.9-2 had a great impact on the liver function of mice.

[0413] Next, we will conduct further in vivo activity evaluation.

[0414] Example 14 Activity evaluation of the optimized siRNA of sequence 7061 in AAV8-hANGPTL3 mice

[0415] Table 44: Results of in vivo activity evaluation of the selected sequences

[0416]

[0417]

[0418] In AAV8-hANGPTL3 mice, at a dose of 1 mg / kg, the activity of sequence 7061.4-16 was evaluated in vivo by SL01 delivery. As can be seen from Table 44, the activity of 7061.4-16 is superior to that of the positive control.

[0419] Through the above single-target screening, we have found relatively good sequences for their respective targets. Next, we connected the single-target sequences with relatively good activity into a whole through the following structure, enabling the simultaneous inhibition of the expression of two genes.

[0420] Example 15 Preparation of SL01-CPG

[0421]

[0422]

[0423] Preparation of Compound 1a-1: (3R,5S)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3-ol (10 g, 23.84 mmol, 1.0 eq), 12-methoxy-12-oxodecanoic acid (5.8 g, 23.84 mmol, 1.0 eq), N,N-diisopropylethylamine (12.3 g, 95.36 mmol, 4.0 eq) in dichloromethane

[0424] (100 mL) The mixture was stirred at room temperature for 2.0 h. The mixture was washed with sodium carbonate solution, and the aqueous phase was extracted with dichloromethane (50 mL x 3). The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 20 / 1) to obtain the yellow oily product 1a-1 (16.7 g, yield: 79.3%).

[0425] Preparation of Compound 1a-2: Lithium hydroxide monohydrate (3.1 g, 64.73 mmol, 2.5 eq) was added to a mixture of Compound 1a-1 (16.7 g, 25.89 mmol, 1.0 eq) in tetrahydrofuran / methanol / water (80 mL / 16 mL / 16 mL). The mixture was reacted at 40 °C for 4 h. The solvent of the reaction solution was removed under reduced pressure. The aqueous residue was freeze-dried. The residue was dissolved in dichloromethane and filtered. The filtrate was concentrated under reduced pressure to obtain the white solid product 1a-2 (14.3 g, yield: 85.3%). LCMS (ESI): m / z = 630 [M-1] - 。

[0426] Preparation of Compound 1a-3: To a mixture of tert-butyl (azanediyldi(ethane-2,1-diyl))carbamate (3.0 g, 9.9 mmol, 1.0 equiv) and sodium carbonate (1.57 g, 14.85 mmol, 1.5 equiv) in tetrahydrofuran (20 mL) and water (10 mL) was added benzyl chloroformate (2.03 g, 11.88 mmol, 1.2 equiv). The mixture was stirred overnight at room temperature. The mixture was diluted with water (50 mL) and then extracted with ethyl acetate (20 mL × 3). The combined organic layers were washed with saturated brine (20 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was subjected to column chromatography on silica gel (petroleum ether∶ethyl acetate = 3∶1) to give the white solid product 1a-3 (3.80 g, yield: 88%). LCMS (ESI): m / z = 438 [M+1] +.

[0427] Preparation of Compound 1a-4: To a mixture of Compound 1a-3 (3.74 g, 8.55 mmol, 1.0 equiv) in methanol (10 mL) was added hydrogen chloride - dioxane solution (4 mol / L, 15 mL). The mixture was stirred at room temperature for 1.5 h. The solvent was removed under reduced pressure. The residue was dried under vacuum to give the white solid product 1a-4 (2.92 g, crude). LCMS (ESI): m / z = 238 [M+1] + .

[0428] Preparation of Compound 1a-5: At -20 °C, isobutyl chloroformate (20.17 mL, 155.54 mmol, 1.0 equiv) was added dropwise to a mixture of (S)-4-(tert-butoxy)-3-((tert-butoxycarbonyl)amino)-4-oxobutanoic acid (45 g, 155.54 mmol, 1.0 equiv) and N-methylmorpholine (15.7 g, 155.54 mmol, 1.0 equiv) in tetrahydrofuran (220 mL). After the mixture was stirred for 10 min, the mixture was filtered. At -30 °C, a solution of sodium borohydride (11.8 g, 311.08 mmol, 2.0 equiv) in water (70 mL) was slowly added to the filtrate. The mixture was warmed to 0 °C and stirred for 0.5 h. The mixture was diluted with water (200 mL) and then extracted with ethyl acetate (100 mL × 3). The combined organic layers were washed with saturated brine (100 mL × 1), dried over anhydrous sodium sulfate and concentrated to give a colorless oil 1a-5 (43.67 g, crude). LCMS (ESI): m / z = 276 [M+1] + .

[0429] Preparation of Compound 1a-6: At 0 °C, Dess-Martin periodinane (79.2 g, 186.65 mmol, 1.2 eq) was added to a mixture of compound 1a-5 (42.8 g, 155.54 mmol, 1.0 eq) and sodium bicarbonate (39.2 g, 466.62 mmol, 3.0 eq) in dichloromethane (300 mL). The mixture was warmed to room temperature and stirred for 2 h. The mixture was filtered. The filtrate was concentrated under reduced pressure. The residue was diluted with ethyl acetate (200 mL) and washed successively with saturated sodium thiosulfate solution (100 mL×1), saturated sodium bicarbonate solution (100 mL×1) and saturated brine (100 mL×1), dried over anhydrous sodium sulfate and concentrated to give a pale yellow oil of 1a-6 (40 g, crude). LCMS (ES I): m / z = 274 [M+1] + .

[0430] Preparation of Compound 1a-7: A mixture of benzylamine (6.1 g, 57.01 mmol, 1.0 eq), compound 1a-6 (38 g, 139.2 mmol, 2.44 eq) and acetic acid (3.26 mL, 57.01 mmol, 1.0 eq) in methanol (200 mL) was stirred at room temperature for 10 min. The mixture was cooled to 0 °C and then sodium cyanoborohydride (12.53 g, 199.54 mmol, 3.5 eq) was added slowly. The mixture was warmed to room temperature and stirred overnight. The solvent was removed under reduced pressure and the residue was diluted with water (150 mL). Solid sodium bicarbonate was added to adjust the pH to 9 and the aqueous layer was extracted with ethyl acetate (60 mL×3). The combined organic layers were washed with saturated brine (50 mL×1), dried over anhydrous sodium sulfate and concentrated. The residue was purified by column chromatography on silica gel (petroleum ether∶ethyl acetate = 50∶1 to 5∶1) to give a colorless oil of 1a-7 (24.1 g, yield: 68%). LCMS (ESI): m / z 622 [M+1] + .

[0431] Preparation of Compound 1a-8: At 0 °C, 1-chloroethyl chloroformate (7.16 mL, 66.34 mmol, 1.0 eq) was added dropwise to a mixture of Compound 1a-7 (27.5 g, 44.23 mmol, 1.0 eq) and N,N-diisopropylethylamine (1.54 mL, 8.85 mmol, 0.2 eq) in acetonitrile (125 mL). The mixture was warmed to room temperature and stirred for 2 hours. The solvent was removed under reduced pressure. The residue was diluted with methanol (20 mL). The mixture was heated to 63 °C and stirred for 1.5 hours. The solvent was removed under reduced pressure, and the residue was diluted with dichloromethane (150 mL). The organic layer was washed with saturated sodium bicarbonate solution (30 mL × 1) and saturated brine (50 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was purified by column chromatography on silica gel (dichloromethane∶methanol = 200∶1 to 20∶1) to give Compound 1a-8 as a pale yellow oil (11.5 g, yield: 49%). LCMS (ESI): m / z = 532 [M+1] + .

[0432] Preparation of Compound 1a-9: To a mixture of Compound 1a-8 (4.3 g, 22.7 mmol, 1.05 eq), 3-(tert-butoxycarbonyl)amino)propanoic acid (4.3 g, 22.7 mmol, 1.05 eq) and N,N-diisopropylethylamine (5.58 g, 43.24 mmol, 2.0 eq) in dichloromethane (70 mL) was added 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (9.84 g, 23.78 mmol, 1.1 eq). The mixture was stirred at room temperature for 2.5 hours. The solvent was removed under reduced pressure. The residue was purified by column chromatography on silica gel (petroleum ether∶ethyl acetate = 4∶1 to 2∶1) to give Compound 1a-9 as a pale yellow solid (14.98 g, yield: 99%). LCMS (ESI): m / z = 703 [M+1] + .

[0433] Preparation of Compound 1a-10: A mixture of Compound 1a-9 (14.9 g, 21.19 mmol, 1.0 equiv) in hydrogen chloride-dioxane (4 mol / L, 90 mL) was stirred overnight at room temperature. The solvent was removed under reduced pressure. The residue was dissolved in tetrahydrofuran (100 mL) and water (100 mL). Sodium carbonate (13.48 g, 127.14 mmol, 6.0 equiv) and di-tert-butyl dicarbonate (24.36 mL, 105.95 mmol, 5.0 equiv) were added. The mixture was stirred at room temperature for 48 h. Tetrahydrofuran was removed under reduced pressure. The residue was diluted with water (200 mL) and then washed with dichloromethane (60 mL × 4). The pH of the aqueous layer was adjusted to 3 by adding 2 mol / L dilute hydrochloric acid solution, and then extracted with ethyl acetate (60 mL × 4). The combined organic layers were washed with saturated brine (50 mL × 1), dried over anhydrous sodium sulfate and concentrated to give a pale yellow solid product 1a-10 (10.5 g, yield: 84%). LCMS (ESI): m / z = 592 [M+1] + .

[0434] Preparation of Compound 1a-11: At 0 °C, a solution of Compound 1a-10 (3.76 g, 6.36 mmol, 1.0 equiv), Compound 1a-4 (1.97 g, 6.36 mmol, 1.0 equiv) and N,N-diisopropylethylamine (4.92 g, 38.16 mmol, 6.0 equiv) in dichloromethane (60 mL) was added dropwise to a mixture of 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (6.58 g, 15.9 mmol, 2.5 equiv) in dichloromethane (570 mL) over 30 min. The mixture was warmed to room temperature and stirred for 20 min. The solvent was removed under reduced pressure. The residue was diluted with saturated sodium bicarbonate solution (50 mL) and then extracted with ethyl acetate (30 mL × 3). The combined organic layers were washed with saturated brine (50 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was subjected to column chromatography on silica gel (ethyl acetate∶methanol = 50∶1 to 30∶1) to give a white solid product 1a-11 (1.97 g, yield: 39%). LCMS (ESI): m / z = 792 [M+1] + .

[0435] Preparation of Compound 1a-13: A mixture of 1a-11 (1.97 g, 2.49 mmol, 1.0 equiv) and hydrogen chloride-dioxane (4 mol / L, 13 mL) was stirred at room temperature for 1.5 h. The solvent was removed under reduced pressure. The residue was diluted with dichloromethane (60 mL). Compound 1a-12 (3.34 g, 7.47 mmol, 3.0 equiv), N,N-diisopropylethylamine (2.57 g, 19.92 mmol, 8.0 equiv) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (3.03 g, 7.97 mmol, 3.2 equiv) were added. The mixture was stirred at room temperature for 1.5 h. The mixture was washed with saturated sodium bicarbonate solution (30 mL × 2) and saturated brine (30 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was purified by column chromatography on silica gel (dichloromethane∶methanol = 30∶1, with 1% triethylamine) to give the pale yellow solid product 1a-13 (3.43 g, yield: 77%). LCMS (ESI): m / z = 1780 [M+1] + .

[0436] Preparation of Compound 1a-14: Palladium hydroxide / carbon (10%, 0.69 g) was added to a mixture of compound 1a-13 (3.47 g, 1.95 mmol, 1.0 equiv) and trifluoroacetic acid (0.15 mL, 1.95 mmol, 1.0 equiv) in isopropanol (50 mL) and ethanol (25 mL). The mixture was stirred at room temperature for 20 h under the pressure of a hydrogen balloon. The mixture was filtered. The filtrate was concentrated under reduced pressure to give the white solid product 1a-14 (3.45 g, crude). LCMS (ESI): m / z = 1646 [M+1] + .

[0437] Preparation of Compound 1a-15 (Compound 31): 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (0.26 g, 0.68 mmol, 1.2 equiv) was added to a mixture of compound 1a-14 (1.0 g, 0.57 mmol, 1.0 equiv), compound 1a-2 (0.396 g, 0.63 mmol, 1.1 equiv) and N,N-diisopropylethylamine (0.441 g, 3.42 mmol, 6.0 equiv) in dichloromethane (15 mL). The mixture was stirred at room temperature for 2.5 h. The solvent was removed under reduced pressure. The residue was purified by preparative high performance liquid chromatography (A: phosphate buffer with pH = 7, B: acetonitrile, acetonitrile concentration 50%-70% within 30 min) to give the white solid product 1a-15 (Compound 31) (0.45 g, yield: 35%). LCMS (ESI): m / z = 980 [(M-302+2) / 2] + .

[0438] Preparation of Compound 1a-16: To a mixture of Compound 1a-15 (130 mg, 0.058 mmol, 1.0 equiv), triethylamine (70 mg, 0.696 mmol, 12.0 equiv) and 4-dimethylaminopyridine (3.5 mg, 0.029 mmol, 0.5 equiv) in dichloromethane (1 mL) was added succinic anhydride (34.5 mg, 0.348 mmol, 6.0 equiv). The mixture was stirred at room temperature for 2 days. The mixture was diluted with dichloromethane (10 mL), then washed with saturated sodium bicarbonate solution (5 mL × 2) and saturated brine (5 mL × 1), dried over anhydrous sodium sulfate and concentrated to give the white solid product 1a-16 (111 mg, yield: 81%). LCMS (ESI): m / z = 1030.5 [(M - 302) / 2 + H] + . 1H NMR (500 MHz, DMSO) δ 8.42–8.25 (m, 2H), 8.06 (t, J = 25.8 Hz, 2H), 7.89–7.70 (m, 4H), 7.30 (dd, J = 14.4, 6.9 Hz, 4H), 7.20 (dd, J = 10.1, 6.9 Hz, 5H), 6.93–6.84 (m, 4H), 6.58 (d, J = 5.9 Hz, 1H), 5.76 (s, 1H), 5.21 (s, 3H), 4.97 (d, J = 13.1 Hz, 3H), 4.50 (d, J = 8.2 Hz, 3H), 4.20 (s, 3H), 4.02 (s, 9H), 3.87 (dd, J = 18.8, 9.5 Hz, 3H), 3.80–3.63 (m, 11H), 3.41 (d, J = 8.7 Hz, 10H), 3.24 (s, 2H), 3.20–3.12 (m, 3H), 3.03 (dd, J = 26.7, 13.8 Hz, 3H), 2.47 (d, J = 9.6 Hz, 3H), 2.44–2.36 (m, 4H), 2.31–2.18 (m, 5H), 2.11 (d, J = 10.6 Hz, 13H), 2.07 (s, 2H), 2.03 (d, J = 7.3 Hz, 3H), 1.99 (s, 9H), 1.89 (s, 9H), 1.77 (s, 12H), 1.47 (s, 16H), 1.25 (s, 11H).

[0439] Preparation of Compound SL01-CPG: To a mixture of compound 1a-16 (111 mg, 0.047 mmol, 1.0 equiv) and N,N-diisopropylethylamine (36 mg, 0.282 mmol, 6.0 equiv) in N,N-dimethylformamide (5.5 mL) was added 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (21 mg, 0.056 mmol, 1.2 equiv) and 1-hydroxybenzotriazole (9 mg, 0.066 mmol, 1.4 equiv). The mixture was shaken at room temperature for 5 minutes. CPG-NH2 (0.167 mmol / g, 550 mg, 0.092 mmol, 1.95 equiv) was added, and the mixture was shaken at room temperature for 22 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, dichloromethane and dried under vacuum for 1 hour. The residue was added to pyridine / acetic anhydride (3 mL / 1 mL), and the mixture was shaken at room temperature for 3 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, dichloromethane and dried under vacuum for 1 hour to obtain the white solid product SL01-CPG (578 mg, loading: 35 μmol / g).

[0440] Preparation of Intermediate M in Example 16

[0441]

[0442] To a mixture of 11-aminoundecanoic acid (5 g, 24.8 mmol, 1.0 equiv) and triethylamine (2.5 g, 24.8 mmol, 1.0 equiv) in methanol (50 mL) was added ethyl 2,2,2-trifluoroacetate (4.4 g, 31.0 mmol, 1.25 equiv). The mixture was stirred overnight at room temperature. Methanol was removed under vacuum, and the residue was dissolved in water and the pH was adjusted to 1-2 with 1 M hydrochloric acid solution. It was extracted with ethyl acetate, and the organic phase was washed with saturated brine and concentrated under vacuum to obtain the yellow oily product 11-(2,2,2-trifluoroacetamido)undecanoic acid (Intermediate M-1, 6.16 g, yield: 83.4%). LCMS (ESI): m / z = 298 [M+H] + .

[0443] To a mixture of 11-(2,2,2-trifluoroacetamido)undecanoic acid (6.06 g, 20.4 mmol, 1.0 equiv), (3R,5S)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3-ol (8.55 g, 20.4 mmol, 1.0 equiv) and N,N-diisopropylethylamine (7.8 g, 61.2 mmol, 3.0 equiv) in N,N-dimethylformamide (60 mL) was added 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.1 g, 21.4 mmol, 1.05 equiv). The mixture was stirred at room temperature for 1 h. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and concentrated in vacuo. The residue was purified by silica gel column chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1 - 3 / 1, plus 0.5% triethylamine) to give the product N-(11-((2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-11-oxoundecyl)-2,2,2-trifluoroacetamide as a white solid (Intermediate M-2, 11.6 g, yield: 80.7%). LCMS (ESI): m / z = 699 [M+H] + .

[0444] A mixture of N-(11-((2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-11-oxoundecyl)-2,2,2-trifluoroacetamide (11.6 g, 16.5 mmol, 1.0 equiv) and potassium hydroxide (9.3 g, 165 mmol, 10.0 equiv) in methanol (110 mL) was stirred overnight at room temperature. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and concentrated in vacuo. The residue was purified by silica gel column (eluent: dichloromethane / methanol = 50 / 1, plus 0.5% triethylamine) to give the product Intermediate M as a yellow oil (9.24 g, yield: 92.4%). LCMS (ESI): m / z = 603 [M+H] + .

[0445] Preparation of Example 17 DL07-CPG

[0446]

[0447]

[0448] Preparation of Compound 2b-2: A mixture of compound 2b-1 (22.02 g, 50.00 mmol, 1.0 equiv), benzyl (2-aminoethyl)carbamate (9.71 g, 50.00 mmol, 1.0 equiv), N,N-diisopropylethylamine (12.90 g, 100.00 mmol, 2.0 equiv) and 6-chlorobenzotriazol-1-yl-1,1,3,3-tetramethyluronium hexafluorophosphate (21.72 g, 52.50 mmol, 1.05 equiv) in N,N-dimethylformamide (250 mL) was stirred at room temperature for 30 minutes. The mixture was diluted with water and then filtered. The filter cake was washed with water. The filter cake was dried to obtain the white solid product 2b-2 (crude). LCMS (ESI): m / z = 617 [M+H] + . 1 H NMR (500 MHz, DMSO) δ 7.87 (t, J = 8.1 Hz, 3H), 7.67 (d, J = 6.9 Hz, 2H), 7.42 (d, J = 7.4 Hz, 2H), 7.37–7.26 (m, 7H), 7.19 (d, J = 4.7 Hz, 2H), 6.84 (d, J = 7.2 Hz, 1H), 5.00 (s, 2H), 4.34–4.15 (m, 3H), 3.90 (d, J = 5.0 Hz, 1H), 3.19–2.94 (m, 6H), 1.78 (d, J = 6.6 Hz, 1H), 1.62 (dd, J = 13.1, 6.6 Hz, 1H), 1.37 (s, 9H).

[0449] Preparation of Compound 2b-3: A mixture of the crude compound 2b-2 in piperidine / acetonitrile (50 mL / 200 mL) was stirred at room temperature for 1 hour. The mixture was filtered, the filtrate was concentrated, and the residue was purified by silica gel column chromatography (eluent: dichloromethane to dichloromethane / methanol = 20 / 1) to obtain the yellow solid product 2b-3 (15.0 g, yield: 76.14%).

[0450] LCMS (ESI): m / z = 395 [M+H] + .

[0451] Preparation of Compound 2b-4: A mixture of compound 2b-3 (7.80 g, 19.80 mmol, 1.5 eq), tert-butyl (2-bromoethyl)carbamate (2.96 g, 13.20 mmol, 1.0 eq), and potassium carbonate (3.64 g, 26.40 mmol, 2.0 eq) in N,N-dimethylformamide (80 mL) was stirred at room temperature overnight. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 50 / 1) to give the product 2b-4 as a colorless oil (4.0 g, yield: 56.43%). LCMS (ESI): m / z = 538 [M+H] + . 1 H NMR (500 MHz, DMSO) δ 7.92 (s, 1H), 7.42–7.28 (m, 5H), 7.19 (s, 1H), 6.93 (d, J = 7.3 Hz, 1H), 6.75 (s, 1H), 5.01 (s, 2H), 3.95 (d, J = 5.4 Hz, 1H), 3.14 (ddd, J = 18.3, 12.5, 6.1 Hz, 2H), 3.05 (d, J = 5.5 Hz, 4H), 2.68–2.56 (m, 4H), 1.79 (s, 1H), 1.72–1.60 (m, 1H), 1.37 (s, 18H).

[0452] Preparation of Compound 2b-6: A mixture of compound 2b-4 (4.0 g, 7.45 mmol, 1.0 eq), compound 2b-5 (2.39 g, 7.08 mmol, 0.95 eq), N,N-diisopropylethylamine (1.92 g, 14.90 mmol, 2.0 eq), and 6-chlorobenzotriazol-1-yl-1,1,3,3-tetramethyluronium hexafluorophosphate (3.08 g, 7.45 mmol, 1.0 eq) in N,N-dimethylformamide (50 mL) was stirred at room temperature for 1 h. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 60 / 1) to give the product 2b-6 as a white solid (4.4 g, yield: 72.52%). LCMS (ESI): m / z = 858 [M+H] + . 11H NMR (500 MHz, DMSO) δ 7.88 (d, J = 12.6 Hz, 1H), 7.32 (d, J = 22.7 Hz, 10H), 7.26–7.13 (m, 2H), 7.01–6.65 (m, 2H), 5.25–5.03 (m, 2H), 5.00 (s, 2H), 4.10–3.96 (m, 1H), 3.82 (s, 1H), 3.17 (d, J = 43.7 Hz, 6H), 3.03 (d, J = 22.8 Hz, 4H), 2.43–2.21 (m, 2H), 2.03–1.86 (m, 1H), 1.79 (s, 2H), 1.63 (s, 1H), 1.44–1.29 (m, 27H).

[0453] Preparation of Compound 2b-7: A solution of Compound 2b-6 (4.4 g, 5.13 mmol, 1.0 equiv) in hydrogen chloride-dioxane (40 mL) was stirred at room temperature for 1 hour. The solvent was removed under vacuum. The residue was used directly in the next step without purification (crude product). LCMS (ESI): m / z = 557 [M + H] + .

[0454] Preparation of Compound 2b-8: A mixture of 2b-7 (crude product), N,N-diisopropylethylamine (6.60 g, 51.16 mmol, 10.0 equiv), Compound 1a-12 (7.10 g, 15.87 mmol, 3.1 equiv) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (6.20 g, 16.31 mmol, 3.2 equiv) in acetonitrile (70 mL) was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 50 / 1 to 25 / 1) to give the yellow solid product 2b-8 (6.0 g, yield: 63.39%). LCMS (ESI): m / z = 923 [M / 2 + H] + .

[0455] Preparation of Compound 2b-9: Under a hydrogen atmosphere, a mixture of Compound 2b-8 (6.0 g, 3.25 mmol, 1.0 equiv), palladium hydroxide / carbon (1.5 g, 25% mass fraction) and trifluoroacetic acid (371 mg, 3.25 mmol, 1.0 equiv) in ethanol (100 mL) was stirred at room temperature overnight. The mixture was filtered through diatomaceous earth. The filter cake was washed with ethanol and the filtrate was concentrated. The residue was used directly in the next step without purification (5.0 g, yield: 94.93%). LCMS (ESI): m / z = 811 [M / 2 + H] + .

[0456] Preparation of Compound 2b-10: Under nitrogen protection, 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (40.2 g, 210 mmol, 1.1 eq) was added to a mixture of 6-azidohexanoic acid (30 g, 190.8 mmol, 1.0 eq) and 1-hydroxypyrrolidine-2,5-dione (24 g, 210 mmol, 1.1 eq) in dichloromethane / N,N-dimethylformamide (270 / 30 mL). The mixture was stirred overnight at room temperature. Dichloromethane was removed under vacuum, 1 M hydrochloric acid solution and methyl tert-butyl ether were added, and the layers were separated. The organic layer was washed with sodium bicarbonate solution and saturated brine. The organic phase was dried and concentrated under vacuum to give the yellow oily product 2b-10 (46.8 g, yield: 96.8%). LCMS (ESI): m / z = 255 [M+1] + .

[0457] Preparation of Compound 2b-11: A mixture of Compound 2b-9 (5.0 g, 3.09 mmol, 1.0 eq), Compound 2b-10 (824 mg, 3.24 mmol, 1.05 eq) and N,N-diisopropylethylamine (1.19 g, 9.22 mmol, 3.0 eq) in acetonitrile (60 mL) was stirred at room temperature for 1 hour. The reaction was directly carried out in the next step without post-treatment. LCMS (ESI): m / z = 881 [M / 2+H] + .

[0458] Preparation of Compound 2b-12 (Compound 54): A mixture of Compound 2b-11 (crude), Intermediate M (2.04 g, 3.39 mmol, 1.1 eq), N,N-diisopropylethylamine (796 mg, 6.17 mmol, 2.0 eq) and 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (1.4 g, 3.39 mmol, 1.1 eq) in acetonitrile (60 mL) was stirred for 1 hour. The mixture was directly purified by high performance liquid chromatography (column: UniSil 10-120C18, 30×250 mm) to give the white solid product 2b-12 (Compound 54) (3.1 g, yield: 42.79%). LCMS (ESI): m / z = 1022 [(M-302) / 2+H] +. 1H NMR (500 MHz, DMSO) δ 8.04–7.72 (m, 9H), 7.30 (dd, J = 17.9, 8.1 Hz, 4H), 7.23–7.10 (m, 5H), 6.93–6.81 (m, 4H), 5.76 (s, 1H), 5.21 (d, J = 2.3 Hz, 3H), 5.02–4.83 (m, 4H), 4.49 (d, J = 8.2 Hz, 3H), 4.15 (s, 3H), 4.02 (s, 9H), 3.87 (q, J = 9.5 Hz, 3H), 3.72 (d, J = 12.9 Hz, 9H), 3.41 (s, 3H), 3.29 (d, J = 6.8 Hz, 2H), 3.07 (ddd, J = 23.5, 22.3, 17.2 Hz, 14H), 2.22 (dd, J = 22.2, 15.1 Hz, 4H), 2.11 (d, J = 13.0 Hz, 13H), 2.04 (dd, J = 14.3, 6.9 Hz, 5H), 1.99 (s, 10H), 1.89 (s, 9H), 1.84 (d, J = 13.3 Hz, 3H), 1.77 (s, 9H), 1.68 (d, J = 35.4 Hz, 2H), 1.50 (dd, J = 14.8, 7.4 Hz, 19H), 1.35 (s, 3H), 1.30–1.18 (m, 13H).

[0459] Preparation of Compound 2b-13: A mixture of Compound 2b-12 (3.1 g, 1.32 mmol, 1.0 equiv), succinic anhydride (793 mg, 7.93 mmol, 6.0 equiv), triethylamine (1.60 g, 15.84 mmol, 12.0 equiv) and 4-dimethylaminopyridine (16 mg, 0.13 mmol, 0.1 equiv) in dichloromethane (25 mL) was stirred at room temperature for 6 h. The mixture was washed with 10% sodium bicarbonate solution and acetonitrile. The organic phase was concentrated to give the light purple solid product 2b-13 (3.4 g, crude). LCMS (ESI): m / z = 1072 [(M - 302) / 2 + H] + .

[0460] Preparation of Compound DL07-CPG: 2-(7-Azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate was added to a solution of Compound 2b-13 (300 mg, 0.12 mmol, 1.0 equiv) in N,N-dimethylformamide

[0461] (56 mg, 0.15 mmol, 1.2 eq), 1-hydroxybenzotriazole (23 mg, 0.17 mmol, 1.4 eq) and N,N-diisopropylethylamine (63 mg, 0.49 mmol, 4.0 eq), the mixture was shaken for 5 minutes at room temperature. 1.5 g of CPG-NH2 was added to the mixture and shaken overnight at room temperature. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, dichloromethane and dried under vacuum for 1 hour. The residue was added to pyridine / acetic anhydride (12 mL / 4 mL) and shaken for 3 hours at room temperature. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, dichloromethane and dried under vacuum for 1 hour to obtain a light yellow solid product DL07-CPG (1.61 g, loading: 41.1 μmol / g).

[0462] Example 18 Preparation of DL09-CPG

[0463]

[0464] Preparation of Compound 4a-2: Under nitrogen protection, a mixture of Compound 4a-1 (10 g, 62 mmol, 1.0 eq), Compound 2b-10 (17 g, 68 mmol, 1.1 eq) and N,N-diisopropylethylamine (18 g, 136 mmol, 2.2 eq) in acetonitrile (100 mL) was stirred overnight at room temperature. Acetonitrile was removed under vacuum, 1 M hydrochloric acid solution and methyl tert-butyl ether were added, and the layers were separated. The organic layer was washed with water and saturated brine. The organic phase was dried and concentrated under vacuum to obtain a yellow oily product 4a-2 (18.5 g, yield: 99.4%). LCMS (ESI): m / z = 301 [M+1] + .

[0465] Preparation of Compound 4a-3: To a mixture of Compound 4a-2 (18.5 g, 61.5 mmol, 1.0 eq), tert-butyl 3-(2-aminoethoxy)propionate (11.6 g, 61.5 mmol, 1.0 eq) and N,N-diisopropylethylamine (17.4 g, 135.2 mmol, 2.0 eq) in N,N-dimethylformamide (180 mL) was added 6-chlorobenzotriazol-1-yl-1,1,3,3-tetramethyluronium hexafluorophosphate (28 g, 67.6 mmol, 1.1 eq). The mixture was stirred for 1 hour at room temperature. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and concentrated under vacuum. The residue was purified by silica gel column chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1 to dichloromethane / methanol = 20 / 1) to obtain a white solid product 4a-3 (14.8 g, yield: 51.4%). LCMS (ESI): m / z = 472 [M+1] + .

[0466] Preparation of Compound 4a-4: A mixture of Compound 4a-3 (8.86 g, 20.7 mmol, 1.0 equiv) in trifluoroacetic acid / dichloromethane (10 / 50 mL) was stirred at room temperature for 5.0 h. The mixture was concentrated under vacuum to give the product 4a-4 as a yellow oil (8 g, crude). LCMS (ESI): m / z = 416 [M+1] + .

[0467] Preparation of Compound 4a-5: To a mixture of Compound 4a-4 (8.86 g, 18.7 mmol, 1.0 equiv), (3R,5S)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3-ol (7.8 g, 18.7 mmol, 1.0 equiv) and N,N-diisopropylethylamine (9.6 g, 75 mmol, 4.0 equiv) in N,N-dimethylformamide (90 mL) was added 6-chlorobenzotriazol-1-yl-1,1,3,3-tetramethyluronium hexafluorophosphate (8.1 g, 19.7 mmol, 1.1 equiv). The mixture was stirred at room temperature for 1 h. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and concentrated under vacuum. The residue was purified by silica gel column chromatography (eluent: petroleum ether / dichloromethane / methanol = 50 / 50 / 1 to 30 / 30 / 1) to give the product 4a-5 as a white solid (7.5 g, yield: 49%). LCMS (ESI): m / z = 817 [M+1] + .

[0468] Preparation of Compound 4a-6: A mixture of Compound 4a-5 (7.5 g, 9.19 mmol, 1.0 equiv) and lithium hydroxide monohydrate (1.1 g, 27.5 mmol, 3.0 equiv) in tetrahydrofuran / methanol / water (60 / 30 / 30 mL) was stirred overnight at room temperature. The mixture was diluted with water and washed with methyl tert-butyl ether. The aqueous phase was extracted with dichloromethane. The organic phase was concentrated under vacuum to give the product 4a-6 as a light white solid (4.68 g, yield: 63.4%). LCMS (ESI): m / z = 801 [M-1] - .

[0469] Preparation of Compound 4a-7 (Compound 53): To a mixture of Compound 1a-14 (570 mg, 0.32 mmol, 1.0 equiv), Compound 4a-6 (260 mg, 0.32 mmol, 1.0 equiv) and N,N-diisopropylethylamine (146 mg, 1.13 mmol, 3.5 equiv) in N,N-dimethylformamide (2.5 mL) was added 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (148 mg, 0.39 mmol, 1.2 equiv). The mixture was stirred overnight at room temperature. The mixture was purified by preparative high performance liquid chromatography (A: phosphate buffer with pH = 7, B: acetonitrile, acetonitrile concentration 30%-90% within 30 minutes) to give the white solid product 4a-7 (Compound 53) (245 mg, yield: 31%). LCMS (ESI): m / z = 1065 [(M - 302 + 2) / 2] + .

[0470] Preparation of Compound 4a-8: To a mixture of Compound 4a-7 (245 mg, 0.10 mmol, 1.0 equiv), triethylamine (121 mg, 1.2 mmol, 12.0 equiv) and 4-dimethylaminopyridine (12 mg, 0.10 mmol, 1.0 equiv) in dichloromethane (2 mL) was added succinic anhydride (60.5 mg, 0.60 mmol, 6.0 equiv). The mixture was stirred at room temperature for 20 h. The mixture was diluted with dichloromethane (10 mL), then washed with saturated sodium bicarbonate solution (10 mL × 2) and saturated brine (10 mL × 1), dried over anhydrous sodium sulfate and concentrated to give the white solid product 4a-8 (275 mg, crude). LCMS (ESI): m / z = 1115 [(M - 302 + 2) / 2] + .

[0471] Preparation of Compound DL09-CPG: To a mixture of compound 4a-8 (253 mg, 0.10 mmol, 1.0 equiv) and N,N-diisopropylethylamine (77 mg, 0.60 mmol, 6.0 equiv) in N,N-dimethylformamide (10 mL) was added 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (57 mg, 0.15 mmol, 1.5 equiv) and 1-hydroxybenzotriazole (20 mg, 0.15 mmol, 1.5 equiv). The mixture was shaken at room temperature for 5 minutes. CPG-NH2 (0.167 mmol / g, 1.27 g, 0.21 mmol, 2.1 equiv) was added, and the mixture was shaken at room temperature for 22 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane and dried under vacuum for 1 hour. The residue was added to pyridine / acetic anhydride (12 mL / 4 mL), and the mixture was shaken at room temperature for 3 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane and dried under vacuum for 1 hour to obtain white solid DL09-CPG (1.36 g, loading: 30 μmol / g).

[0472] Example 19 Preparation of DL15-CPG

[0473]

[0474] Preparation of Compound 15a-1: To a mixture of compound 10a-5 (6.0 g, 14.7 mmol, 1.5 equiv) and tert-butyl (2-bromoethyl)carbamate (2.2 g, 9.8 mmol, 1.0 equiv) in 30 mL of dimethylformamide was added potassium carbonate (5.07 g, 36.75 mmol, 2.5 equiv) at room temperature, and the mixture was stirred overnight. The mixture was diluted with ethyl acetate and washed with water and saturated brine. The organic phase was concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 30 / 1 to 10 / 1, with ammonia added) to obtain white solid compound 15a-1 (3.29 g, yield: 60.8%). LCMS (ESI): m / z = 552 (M+H) + .

[0475] Preparation of Compound 15a-2: Compound 15a-1 (1.7 g, 3.08 mmol, 1.0 equiv), compound 10a-2 (3.2 g, 9.97 mmol, 3.2 equiv), acetic acid (185 mg, 3.08 mmol, 1.0 equiv) and sodium cyanoborohydride (626 mg, 9.97 mmol, 3.2 equiv) were added to 24 mL of methanol. The mixture was stirred at room temperature for 96 h, concentrated under reduced pressure, sodium carbonate solution was added, and the mixture was extracted with ethyl acetate. The organic phase was washed with water and saturated brine, and concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 40 / 1 to 10 / 1, with ammonia added) to obtain white solid compound 15a-2 (1.72 g, yield: 54.0%). LCMS (ESI): m / z = 857.5 (M+H) + .

[0476] Preparation of Compound 15a-3: Compound 15a-2 (1.72 g, 2.01 mmol, 1.0 equiv) was added to 20 mL of 4M hydrogen chloride-dioxane solution. The mixture was stirred at room temperature for 1 h. The mixture was concentrated under reduced pressure to obtain compound 15a-3 (1.57 g, crude product). LCMS (ESI): m / z = 557 (M+H) + .

[0477] Preparation of Compound 15a-4: The crude compound 15a-3 (1.57 g, 2.01 mmol, 1.0 equiv), compound 1a-12 (2.87 g, 6.41 mmol, 3.2 equiv), diisopropylethylamine (2.58 g, 20.1 mmol, 10.0 equiv) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (2.87 g, 6.41 mmol, 3.2 equiv) were added to 35 mL of acetonitrile. The mixture was stirred at room temperature for 1 h. Ethyl acetate was added. The organic phase was washed with water and saturated brine, and concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 40 / 1 to 15 / 1, with triethylamine added) to obtain white solid compound 15a-4 (2.01 g, yield: 54.1%). LCMS (ESI): m / z = 1845 (M+H) + .

[0478] Preparation of Compound 15a-5: Dissolve Compound 15a-4 (2.0 g, 1.08 mmol, 1.0 eq) in 45 mL of ethanol, add trifluoroacetic acid (160 mg, 1.41 mmol, 1.3 eq) and 300 mg of 10% palladium hydroxide / carbon. The mixture was stirred overnight at room temperature under a hydrogen atmosphere. The mixture was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure to obtain white solid Compound 15a-5 (2.0 g, crude). LCMS (ESI): m / z = 1621 (M+H) + .

[0479] Preparation of Compound 15a-6: Add Compound 15a-5 (2.0 g, 1.08 mmol, 1.0 eq), diisopropylethylamine (418 mg, 3.24 mmol, 3.0 eq) and Compound 2b-10 (307 mg, 1.21 mmol, 1.12 eq) to 15 mL of acetonitrile. The mixture was stirred at room temperature for 1.5 h. Add diisopropylethylamine (209 mg, 1.62 mmol, 1.5 eq), 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (538 mg, 1.30 mmol, 1.2 eq) and Intermediate M (783 mg, 1.30 mmol, 1.2 eq). The mixture was stirred at room temperature for 1 h. Add ethyl acetate. The organic phase was washed with water and saturated brine, and concentrated to dryness under reduced pressure. The residue was purified by preparative liquid chromatography (eluent: potassium dihydrogen phosphate-potassium hydroxide buffer solution with pH 7.0 / acetonitrile) to obtain white solid Compound 15a-6 (1.81 g, yield: 37.1%). LCMS (ESI): m / z = 1022 ((M-302) / 2+H) + .

[0480] Preparation of Compound 15a-7: Under nitrogen protection, add Compound 15a-6 (300 mg, 0.128 mmol, 1.0 eq), triethylamine (155 mg, 1.54 mmol, 12.0 eq), succinic anhydride (77 mg, 0.768 mmol, 6.0 eq) and p-dimethylaminopyridine (1.6 mg, 0.013 mmol, 0.1 eq) to 1.5 mL of dichloromethane. The mixture was stirred overnight at room temperature. The mixture was diluted with dichloromethane / acetonitrile and washed with 10% sodium bicarbonate solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain white solid Compound 15a-7 (375 mg, crude). LCMS (ESI): m / z = 1072 ((M-302) / 2+H) + .

[0481] Preparation of Compound DL15-CPG: Compound 15a-7 (375 mg, 0.128 mmol, 1.0 equiv), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (68 mg, 0.179 mmol, 1.4 equiv), 1-hydroxybenzotriazole (28 mg, 0.205 mmol, 1.6 equiv) and diisopropylethylamine (76 mg, 0.59 mmol, 4.6 equiv) were added to 13 mL of dimethylformamide. The mixture was stirred at room temperature for 5 minutes. 1.735 g of CPG-NH2 was added and the mixture was shaken overnight at room temperature. The mixture was filtered, and the solid phase was washed with dichloromethane and acetonitrile, and dried under reduced pressure. 10 mL of pyridine and 3.4 mL of acetic anhydride were added, and the mixture was shaken for 3 hours. It was filtered, and the solid phase was washed with dichloromethane and acetonitrile, and dried under reduced pressure to obtain the yellow solid compound DL15-CPG (1.39 g, 37.5 μmol / g).

[0482] Example 20 Preparation of DL16-CPG

[0483]

[0484] Preparation of Compound 16a-1: Under nitrogen protection and in an ice bath, a solution of 2,4-dinitrobenzenesulfonyl chloride (2.6 g, 9.7 mmol, 1.2 equiv) in tetrahydrofuran (10 mL) was added dropwise to a mixture of compound 2b-3 (3.2 g, 8.1 mmol, 1.0 equiv) and N,N-diisopropylethylamine (2.0 g, 16.2 mmol, 2.0 equiv) in tetrahydrofuran (40 mL). The mixture was stirred in the ice bath for 1 hour. Ethyl acetate was added to the mixture, and it was washed with water, dilute hydrochloric acid, aqueous sodium bicarbonate, brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the brown solid 16a-1 (6.0 g, crude product). LCMS (ESI): m / z = 582 [M+H] + .

[0485] Preparation of Compound 16a-2: Compound 16a-1 (1 g, 1.6 mmol, 1.0 equiv), (tert-butoxycarbonyl)-L-homoserine benzyl ester (1.24 g, 4.0 mmol, 2.5 equiv) and triphenylphosphine (1.26 g, 4.8 mmol, 3.0 equiv) were added to 30 mL of toluene and stirred at room temperature for 5 minutes. Diethyl azodicarboxylate (0.835 g, 4.8 mmol, 3.0 equiv) was added dropwise in an ice bath, and the mixture was stirred at room temperature for 2 hours. The mixture was filtered. The residue was dissolved in 30 mL of dichloromethane, and 30 mL of petroleum ether was added. The mixture was stirred at room temperature for 1 hour. The mixture was filtered. The residue was washed with dichloromethane / petroleum ether (1 / 1). It was dried to obtain the yellow solid compound 16a-2 (1.42 g, yield: 96.59%). LCMS (ESI): m / z = 916 (M+H)+ .

[0486] Preparation of Compound 16a-3: Compound 16a-2 (1.6 g, 1.75 mmol, 1.0 equiv) and triethylamine (530 mg, 5.25 mmol, 3.0 equiv) were added to 10 mL of dichloromethane. 2-Mercaptoacetic acid (322 mg, 3.5 mmol, 2.0 equiv) was added, and the mixture was stirred at room temperature for 10 minutes. Ethyl acetate was added for extraction. The organic phase was washed with aqueous sodium carbonate solution and saturated brine. It was concentrated under reduced pressure to obtain Compound 16a-3 as a yellow oil (1.2 g, crude product). LCMS (ESI): m / z = 686 (M+H) + .

[0487] Preparation of Compound 16a-4: Compound 16a-3 (1.2 g, 1.75 mmol, 1.0 equiv), 3-(tert-butoxycarbonyl)amino)propanoic acid (331 mg, 1.75 mmol, 1.0 equiv), diisopropylethylamine (451 mg, 3.5 mmol, 2.0 equiv) and 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate (798 mg, 2.1 mmol, 1.2 equiv) were added to 30 mL of dichloromethane. The mixture was stirred at room temperature for 1 hour. Ethyl acetate was added for extraction. The organic phase was washed with water and saturated brine, and concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 25 / 1 to 10 / 1, adding triethylamine) to obtain Compound 16a-4 as a white solid (740 mg, yield: 49.33%). LCMS (ESI): m / z = 858 (M+H) + .

[0488] Preparation of Compound 16a-5: Compound 16a-4 (740 mg, 0.86 mmol, 1.0 equiv) was added to 5 mL of 4M hydrogen chloride-dioxane solution. The mixture was stirred at room temperature for 1 hour. The mixture was concentrated under reduced pressure to obtain Compound 16a-5 as a yellow solid (482 mg, crude product). LCMS (ESI): m / z = 557 (M+H) + .

[0489] Preparation of Compound 16a-6: Compound 16a-5 (482 mg, 0.86 mmol, 1.0 eq), Compound 1a-12 (1.2 g, 2.68 mmol, 3.1 eq), diisopropylethylamine (1.12 g, 8.64 mmol, 10.0 eq) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.05 g, 2.76 mmol, 3.2 eq) were added to 10 mL of acetonitrile. The mixture was stirred at room temperature for 1 hour. Ethyl acetate was added for extraction. The organic phase was washed with water and saturated brine, and concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 25 / 1 to 10 / 1, with triethylamine added) to obtain white solid Compound 16a-6 (879 mg, yield: 55.28%). LCMS (ESI): m / z = 1844 (M+H) + .

[0490] Preparation of Compound 16a-7: Compound 16a-6 (879 mg, 0.476 mmol, 1.0 eq) was dissolved in 5 mL of ethanol. Trifluoroacetic acid (54 mg, 0.476 mmol, 1.0 eq) and 88 mg of 10% palladium hydroxide / carbon were added. The mixture was stirred overnight at room temperature under a hydrogen atmosphere. The mixture was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure to obtain white solid Compound 16a-7 (800 mg, crude product). LCMS (ESI): m / z = 1621 (M+H) + .

[0491] Preparation of Compound 16a-8 (Compound 65): Compound 16a-7 (800 mg, 0.476 mmol, 1.0 eq), diisopropylethylamine (184 mg, 1.428 mmol, 3 eq) and Compound 2b-10 (133 mg, 0.523 mmol, 1.1 eq) were added to 10 mL of acetonitrile. The mixture was stirred at room temperature for 1.5 hours. Diisopropylethylamine (184 mg, 1.428 mmol, 3 eq), 6-chlorobenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (236 mg, 0.57 mmol, 1.2 eq) and Intermediate M (343 mg, 0.57 mmol, 1.2 eq) were added, and the mixture was stirred at room temperature for 1 hour. Ethyl acetate was added for extraction. The organic phase was washed with water and saturated brine, and concentrated to dryness under reduced pressure. The residue was purified by preparative liquid chromatography (eluent: potassium dihydrogen phosphate-potassium hydroxide buffer solution (pH 7.0) / acetonitrile) to obtain yellow solid Compound 16a-8 (343 mg, yield: 30.90%). LCMS (ESI): m / z = 1022 ((M - 302) / 2 + H) + .

[0492] Preparation of Compound 16a-9: Compound 16a-8 (343 mg, 0.146 mmol, 1.0 eq), triethylamine (177 mg, 1.752 mmol, 12.0 eq), succinic anhydride (88 mg, 0.878 mmol, 6.0 eq) and 4-dimethylaminopyridine (2 mg, 0.014 mmol, 0.1 eq) were added to 5 mL of dichloromethane. The mixture was stirred overnight at room temperature. The mixture was diluted with dichloromethane and washed with 10% sodium bicarbonate solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain yellow solid Compound 16a-9 (396 mg, crude product). LCMS (ESI): m / z = 1072 ((M - 302) / 2 + H) + .

[0493] Preparation of Compound DL16-CPG: Compound 16a-9 (396 mg, 0.162 mmol, 1.0 eq), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (74 mg, 0.194 mmol, 1.2 eq), 1-hydroxybenzotriazole (30 mg, 0.226 mmol, 1.4 eq) and diisopropylethylamine (84 mg, 0.648 mmol, 4.0 eq) were added to 10 mL of dimethylformamide. The mixture was stirred at room temperature for 5 minutes. 1.58 g of CPG-NH2 was added and the mixture was shaken overnight at room temperature. The mixture was filtered and the solid phase was washed with dichloromethane and acetonitrile, and the solid phase was dried under reduced pressure. 9 mL of pyridine and 3 mL of acetic anhydride were added and the mixture was shaken for 3 hours. Filtered, the solid phase was washed with dichloromethane and acetonitrile, and the solid phase was dried under reduced pressure to obtain yellow solid Compound DL16-CPG (1.68 g, loading: 45.7 μmol / g).

[0494] Preparation of Example 21 DL18-CPG

[0495]

[0496]

[0497] Preparation of Compound 18a-2: Benzyl bromide (13.1 mL, 109.89 mmol, 2.5 eq) was added to a mixture of compound 18a-1 (4.0 g, 43.96 mmol, 1.0 eq) and potassium carbonate (18.2 g, 131.88 mmol, 3.0 eq) in ethanol (40 mL). The mixture was heated to reflux for 3 h. The solvent was removed under reduced pressure. The residue was diluted with water (60 mL) and then extracted with dichloromethane (50 mL × 2). The combined organic layers were washed with saturated brine (50 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was purified by column chromatography on silica gel (dichloromethane∶methanol 80∶1) to give compound 18a-2 as a white solid (9.89 g, yield: 83%). LCMS (ESI): m / z 272 [M+1] + ; TLC: Rf 0.5 (dichloromethane:methanol acetate = 50:1).

[0498] Preparation of Compound 18a-3: Sodium hydroxide (15 g, 375 mmol, 15 eq) was added to a mixture of compound 18a-2 (6.7 g, 24.72 mmol, 1.0 eq), tert-butyl bromoacetate (28.78 g, 147.55 mmol, 6.0 eq) and tetrabutylammonium hydrogensulfate (1.26 g, 3.71 mmol, 0.15 eq) in water (50 mL) and toluene (65 mL). The mixture was heated to 50 °C for 40 h. The mixture was diluted with water (50 mL) and then extracted with dichloromethane (50 mL × 2). The combined organic layers were washed with saturated brine (50 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was purified by column chromatography on silica gel (petroleum ether∶ethyl acetate 50∶1) to give compound 18a-3 as a colorless oil (3.61 g, yield: 29%). LCMS (ESI): m / z 500 [M+1] + ; TLC: Rf 0.5 (petroleum ether:ethyl acetate = 30:1).

[0499] Preparation of Compound 18a-4: A mixture of Compound 18a-3 (3.73 g, 7.46 mmol, 1.0 equiv) and hydrogen chloride-dioxane (4 M, 20 mL) was stirred overnight at room temperature. The solvent was removed under reduced pressure. The residue was diluted with dichloromethane (40 mL). Ammonium chloride (2.39 g, 44.76 mmol, 6.0 equiv), N,N-diisopropylethylamine (7.7 g, 59.68 mmol, 8.0 equiv) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.51 g, 22.38 mmol, 3.0 equiv) were added. The mixture was stirred at room temperature for 7 h. The solvent was removed under reduced pressure. The residue was diluted with saturated sodium carbonate solution (50 mL) and then extracted with ethyl acetate (20 mL × 3). The combined organic layers were washed with saturated brine (30 mL × 1), dried over anhydrous sodium sulfate and concentrated to give Compound 18a-4 as a pale yellow oil (3.5 g, crude). LCMS (ESI): m / z 386 [M+1] + ; TLC: Rf 0.5 (dichloromethane:methanol = 20:1).

[0500] Preparation of Compound 18a-5: Borane dimethyl sulfide complex (10 M, 5.97 mL,, 59.7 mmol, 8.0 equiv) was added to a mixture of Compound 18a-4 (2.87 g, 7.46 mmol, 1.0 equiv) in tetrahydrofuran (40 mL,). The mixture was heated to 65 °C and reacted for 5 h. The mixture was quenched with water (25 mL). Sodium carbonate (2.37 g, 22.38 mmol, 3.0 equiv) and di-tert-butyl dicarbonate (4.88 g, 22.38 mmol, 3.0 equiv) were added. The mixture was stirred at room temperature for 3 h. The mixture was diluted with water (50 mL) and then extracted with ethyl acetate (30 mL, × 2). The combined organic layers were washed with saturated brine (30 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was subjected to column chromatography on silica gel (petroleum ether∶ethyl acetate 8∶1 to 3∶1) to give Compound 18a-5 as a pale yellow oil (741 mg, yield: 18%). LCMS (ESI): m / z 558 [M+1] + ; TLC: Rf 0.5 (petroleum ether:ethyl acetate = 5:1).

[0501] Preparation of Compound 18a-6: Hydrogen chloride-dioxane solution (4 M, 5 mL) was added to a mixture of Compound 18a-5 (741 mg, 1.33 mmol, 1.0 equiv) in methanol (2 mL). The mixture was stirred at room temperature for 1 h. The solvent was removed under reduced pressure. The residue was dried under vacuum to give crude Compound 18a-6 as a white solid. LCMS (ESI): m / z 358 [M+1] +; TLC: Rf 0.2 (dichloromethane:methanol = 10:1).

[0502] Preparation of Compound 18a-7: At 0 °C, a solution of Compound 1a-10 (786 mg, 1.33 mmol, 1.0 equiv), Compound 18a-6 (616 mg, 1.33 mmol, 1.0 equiv) and N,N-diisopropylethylamine (1.03 g, 7.98 mmol, 6.0 equiv) in dichloromethane (15 mL) was added dropwise to a mixture of 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (1.38 g, 3.33 mmol, 2.5 equiv) in dichloromethane (85 mL) over 30 minutes. The mixture was warmed to room temperature and stirred for 20 minutes. The solvent was removed under reduced pressure. The residue was diluted with saturated sodium carbonate solution (30 mL) and then extracted with ethyl acetate (20 mL × 3). The combined organic layers were washed with saturated brine (20 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was purified by column chromatography on silica gel (ethyl acetate∶methanol 50∶1 to 30∶1) to give Compound 18a-7 as a white solid (0.42 g, yield: 35%). LCMS (ESI): m / z 911 [M+1] + ; TLC: Rf 0.3 (ethyl acetate:dichloromethane = 1:1).

[0503] Preparation of Compound 18a-8: Compound 18a-7 (0.42 g, 0.46 mmol, 1.0 equiv) was stirred in a mixture of hydrogen chloride-dioxane (4M, 4 mL) at room temperature for 1 hour. The solvent was removed under reduced pressure. The residue was diluted with dichloromethane (10 mL). Compound 1a-12 (618 mg, 1.38 mmol, 3.0 equiv), N,N-diisopropylethylamine (475 mg, 3.68 mmol, 8.0 equiv) and 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate (525 mg, 1.38 mmol, 3.0 equiv) were added. The mixture was stirred at room temperature for 1 hour. The mixture was diluted with dichloromethane (20 mL), washed with saturated sodium bicarbonate solution (20 mL × 2) and saturated brine (20 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was purified by column chromatography on silica gel (dichloromethane∶methanol∶triethylamine 30∶1∶0.3) to give Compound 18a-8 as a white solid (778 mg, yield: 89%). LCMS (ESI): m / z 1900 [M+1] + ; TLC: Rf 0.5 (dichloromethane:methanol = 10:1).

[0504] Preparation of Compound 18a-9: To a mixture of Compound 18a-8 (778 mg, 0.409 mmol, 1.0 equiv) and trifluoroacetic acid (47 mg, 0.409 mmol, 1.0 equiv) in a mixture of methanol (10 mL) and ethanol (5 mL) was added palladium hydroxide / carbon (10%, 0.5 g). The mixture was stirred at room temperature overnight under a hydrogen balloon pressure. The mixture was filtered. The filtrate was concentrated under reduced pressure to give a pale yellow solid Compound 18a-9 (600 mg, crude). LCMS (ESI): m / z 1720 [M+1] + ; TLC: Rf 0.3 (dichloromethane:methanol = 10:1).

[0505] Preparation of Compound 18a-10: To a mixture of Compound 18a-9 (600 mg, 0.33 mmol, 1.0 equiv), Compound 4a-6 (265 mg, 0.33 mmol, 1.0 equiv) and N,N-diisopropylethylamine (255 mg, 1.98 mmol, 6.0 equiv) in N,N-dimethylformamide (2 mL) was added 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (188 mg, 0.495 mmol, 1.5 equiv). The mixture was stirred at room temperature for 0.5 h. The mixture was purified by preparative liquid chromatography (A: phosphate buffer with pH = 7, B: acetonitrile, acetonitrile concentration 30% - 90% within 30 min) to give a white solid Compound 18a-10 (180 mg, yield: 22%). LCMS (ESI): m / z 1102 [(M - 302 + 2) / 2] + ; TLC: Rf 0.5 (dichloromethane:methanol = 10:1).

[0506] Preparation of Compound 18a-11: To a mixture of Compound 18a-10 (180 mg, 0.072 mmol, 1.0 equiv), triethylamine (87 mg, 0.862 mmol, 12.0 equiv) and 4-dimethylaminopyridine (4.4 mg, 0.036 mmol, 0.5 equiv) in dichloromethane (2 mL) was added succinic anhydride (43 mg, 0.43 mmol, 6.0 equiv). The mixture was stirred at room temperature for 20 h. The mixture was diluted with dichloromethane (10 mL), then washed with saturated sodium bicarbonate solution (10 mL × 2) and saturated brine (10 mL × 1), dried over anhydrous sodium sulfate and concentrated to give a white solid Compound 18a-11 (155 mg, yield: 83%). LCMS (ESI): m / z 1152 [(M - 302 + 2) / 2] + ; TLC: Rf 0.3 (dichloromethane:methanol = 10:1).

[0507] Preparation of Compound DL18-CPG: To a mixture of compound 18a-11 (155 mg, 0.06 mmol, 1.0 equiv) and N,N-diisopropylethylamine (46 mg, 0.36 mmol, 6.0 equiv) in N,N-dimethylformamide (8 mL) was added 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (34 mg, 0.09 mmol, 1.5 equiv) and 1-hydroxybenzotriazole (12 mg, 0.09 mmol, 1.5 equiv). The mixture was stirred at room temperature for 5 minutes. CPG-NH2 (0.167 mmol / g, 775 mg, 0.13 mmol, 2.2 equiv) was added. The mixture was stirred at room temperature overnight. The mixture was filtered. The solid was washed with dichloromethane (8 mL × 5). Pyridine (6 mL) and acetic anhydride (2 mL) were added. The mixture was stirred at room temperature for 3 hours. The mixture was filtered. The solid was washed with dichloromethane (8 mL × 5) and dried under vacuum to obtain the white solid compound DL18-CPG (785 mg, 21.5 μmol / g, yield: 29%).

[0508] Example 22 Preparation of DL20-CPG

[0509]

[0510] Preparation of Compound 20a-1: Di-tert-butyl dicarbonate (5.0 g, 16.48 mmol, 1.00 equiv), ethyl 2-bromoacetate (3.1 g, 18.13 mmol, 1.1 equiv), and potassium carbonate (4.5 g, 32.96 mmol, 2.0 equiv) were reacted in N,N-dimethylformamide (40 mL) at room temperature overnight. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to obtain the yellow oily product 20a-1 (6.4 g, crude). LCMS (ESI): m / z = 390 [M+H] + .

[0511] Preparation of Compound 20a-2: Compound 20a-1 (6.2 g, 15.94 mmol, 1.0 equiv) and lithium hydroxide monohydrate (1.6 g, 39.85 mmol, 2.5 equiv) in a mixture of tetrahydrofuran + methanol + water solution (40 mL + 10 mL + 10 mL) were stirred at 40 °C for 2.5 hours. Water was added to the mixture, and the pH was adjusted to 5 with 2 M dilute hydrochloric acid. The aqueous phase was extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to obtain compound 20a-2 (5.1 g, crude). LCMS (ESI): m / z = 362 [M+H] + 。

[0512] Preparation of Compound 20a-3: Compound 2b-2 (13.6 g, 22.05 mmol, 1.00 equiv) was reacted in trifluoroacetic acid / dichloromethane solution (50 mL / 100 mL) at room temperature for 1 hour. The mixture was concentrated by rotary evaporation. The residue was adjusted to pH 8 by adding water. The organic phase was washed with brine, dried over anhydrous sodium sulfate and concentrated to obtain the white solid product 20a-3 (6.1 g, yield: 53.6%). LCMS (ESI): m / z = 517 [M+H] + .

[0513] Preparation of Compound 20a-4: Compound 20a-2 (4.3 g, 11.82 mmol, 1.0 equiv), Compound 20a-3 (6.1 g, 11.82 mmol, 1.0 equiv), 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate (5.4 g, 14.18 mmol, 1.2 equiv), and diisopropylethylamine (3.1 g, 23.04 mmol, 2.0 equiv) were stirred in N,N-dimethylformamide (50 mL) at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate and concentrated. The residue was stirred with dichloromethane / petroleum ether = 1:1. The mixture was filtered to obtain the yellow solid compound 20a-4 (10 g, crude). LCMS (ESI): m / z = 861 [M+H] + .

[0514] Preparation of Compound 20a-5: A solution of Compound 20a-4 (9.5 g, 11.05 mmol, 1.0 equiv) in diethylamine / acetonitrile (20 / 80 mL) was stirred at room temperature for 1 hour. The mixture was purified by silica gel column chromatography (eluent: dichloromethane to dichloromethane / methanol = 10 / 1) to obtain the yellow solid product 20a-5 (5.1 g, yield: 72.5%). LCMS (ESI): m / z = 638 [M+H] + 。

[0515] Preparation of Compound 20a-6: At 0 °C, Dess-Martin periodinane (4.7 g, 11.17 mmol, 1.5 equiv) was added to a solution of (tert-butoxycarbonyl)-L-homoserine benzyl ester (2.3 g, 7.44 mmol, 1.0 equiv) in tetrahydrofuran (30 mL). The mixture was stirred at room temperature for 2 hours. The mixture was quenched with saturated sodium thiosulfate solution and then extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate and concentrated to obtain the yellow oily product 20a-6 (3.5 g, crude). LCMS (ESI): m / z = 308 [M+H] + 。

[0516] Preparation of Compound 20a-7: A methanol solution (50 mL) of Compound 20a-5 (3.65 g, 5.72 mmol, 1.0 equiv), Compound 20a-6 (1.8 g, 6.01 mmol, 1.05 equiv), and acetic acid (343 mg, 5.72 mmol, 1.0 equiv) was stirred at room temperature for 30 minutes. Sodium cyanoborohydride was added at 0 °C. The mixture was stirred at room temperature for 1.5 hours. The mixture was quenched with water and extracted with ethyl acetate. The organic phase was washed with saturated sodium carbonate solution and brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane to dichloromethane / methanol = 100 / 1 to 30 / 1) to give the white solid product 20a-7 (2.65 g, yield: 49.9%). LCMS (ESI): m / z = 930 [M+H] + .

[0517] Preparation of Compound 20a-8: Compound 20a-7 (3 g, 3.23 mmol, 1.0 equiv), 3-(tert-butoxycarbonyl)aminopropionic acid (611 mg, 3.23 mmol, 1.0 equiv), diisopropylethylamine (835 mg, 6.46 mmol, 2.0 equiv), and 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 mg, 3.88 mmol, 1.2 equiv) were added to dichloromethane (36 mL). The mixture was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 20 / 1, adding 1% triethylamine) to give the white solid compound 20a-8 (1.5 g, yield: 42.1%). LCMS (ESI): m / z = 1101 [M+H] + .

[0518] Preparation of Compound 20a-9: Compound 20a-8 (1.5 g, 1.36 mmol, 1.0 equiv) was added to 20 mL of 4M hydrogen chloride-dioxane solution. The mixture was stirred at room temperature for 1 hour. The mixture was concentrated under reduced pressure to give the yellow solid product 20a-9 (1.1 g, crude). LCMS (ESI): m / z = 700 [M+H] + .

[0519] Preparation of Compound 20a-10: Compound 20a-9 (1.1 g, 1.27 mmol, 1.0 equiv), Compound 1a-12 (2.3 g, 5.21 mmol, 4.1 equiv), diisopropylethylamine (2 g, 15.24 mmol, 12.0 equiv) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (2 g, 5.33 mmol, 4.2 equiv) were added to 15 mL of acetonitrile. The mixture was stirred at room temperature for 1 h. After dilution with water, the mixture was extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 10 / 1, with triethylamine added) to obtain white solid Compound DL20-8 (1.8 g, yield: 58.6%). LCMS (ESI): m / z = 1209 [M / 2 + H] + .

[0520] Preparation of Compound 20a-11: Compound 20a-10 (800 mg, 0.331 mmol, 1.0 equiv) was dissolved in 8 mL of ethanol. Trifluoroacetic acid (38 mg, 0.331 mmol, 1.0 equiv) and 80 mg of 10% palladium hydroxide / carbon were added. The mixture was stirred at room temperature for two days under a hydrogen atmosphere. The mixture was filtered and the filtrate was concentrated under reduced pressure to obtain white solid Compound 20a-11 (890 mg, crude product). LCMS (ESI): m / z = 1097 [M / 2 + H] + .

[0521] Preparation of Compound 20a-12: Compound 20a-11 (760 mg, 0.346 mmol, 1.0 equiv), diisopropylethylamine (134 mg, 1.038 mmol, 3.0 equiv) and Compound 2b-10 (97 mg, 0.381 mmol, 1.1 equiv) were added to 10 mL of acetonitrile. The mixture was stirred at room temperature for 1.5 h. Diisopropylethylamine (134 mg, 1.038 mmol, 3.0 equiv), 6-chlorobenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (171 mg, 0.415 mmol, 1.2 equiv) and Intermediate M (249 mg, 0.415 mmol, 1.2 equiv) were added, and the mixture was stirred at room temperature for 1 h. The solvent of the mixture was removed under reduced pressure. The residue was purified by preparative liquid chromatography (eluent: potassium dihydrogen phosphate-potassium hydroxide buffer solution at pH 7.0 / acetonitrile) to obtain yellow solid Compound DL20-10 (272 mg, yield: 27.2%). LCMS (ESI): m / z = 1308 [(M - 302) / 2 + H] + .

[0522] Preparation of Compound 20a-13: Compound 20a-12 (172 mg, 0.0589 mmol, 1.0 equiv), triethylamine (71 mg, 0.707 mmol, 12.0 equiv), succinic anhydride (35 mg, 0.354 mmol, 6.0 equiv) and p-dimethylaminopyridine (1 mg, 0.00589 mmol, 0.1 equiv) were added to 1 mL of dichloromethane. The mixture was stirred overnight at room temperature. The mixture was diluted with dichloromethane and washed with 10% sodium bicarbonate solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain yellow solid Compound 20a-13 (167 mg, crude). LCMS (ESI): m / z = 1358 [(M - 302) / 2 + H]+.

[0523] Preparation of Compound DL20-CPG: Compound 20a-13 (167 mg, 0.0554 mmol, 1.0 equiv), 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (29 mg, 0.0775 mmol, 1.2 equiv), 1-hydroxybenzotriazole (12 mg, 0.0886 mmol, 1.6 equiv) and diisopropylethylamine (29 mg, 0.222 mmol, 4.0 equiv) were added to 2 mL of dimethylformamide. The mixture was stirred at room temperature for 5 minutes. 501 mg of CPG-NH2 was added and the mixture was shaken overnight at room temperature. The mixture was filtered and the solid phase was washed with dichloromethane and acetonitrile, and dried under reduced pressure. 6 mL of pyridine and 2 mL of acetic anhydride were added and the mixture was shaken for 3 hours. It was filtered, the solid phase was washed with dichloromethane and acetonitrile, and dried under reduced pressure to obtain yellow solid Compound DL20-CPG (532 mg, loading: 28.6 μmol / g).

[0524] Preparation of Example 23 Q20-CPG

[0525]

[0526] Preparation of Compound 8a-2: A mixture of Compound 8a-1 (2.72 g, 18.99 mmol, 1.0 equiv), methyl 4-piperidinecarboxylate (2.72 g, 18.99 mmol, 1.0 equiv), N,N-diisopropylethylamine (4.90 g, 37.98 mmol, 2.0 equiv) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.47 g, 22.28 mmol, 1.2 equiv) in dichloromethane (50 mL) was stirred at room temperature for 30 minutes. The mixture was concentrated under reduced pressure, and the residue was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate and concentrated to obtain yellow oily product 8a-2 (12.7 g, crude). LCMS (ESI): m / z = 389 [M + H] +.

[0527] Preparation of Compound 8a-3: A solution of Compound 8a-2 (crude) in hydrogen chloride-dioxane (40 mL) was stirred at room temperature for 1 hour. The solvent was removed under vacuum. The residue was used directly in the next step without purification (crude). LCMS (ESI): m / z = 289 [M+H] + .

[0528] Preparation of Compound 8a-4: A mixture of Compound 8a-3 (crude), hept-6-ynoic acid (2.35 g, 18.69 mmol, 1.0 equiv), N,N-diisopropylethylamine (7.23 g, 56.06 mmol, 3.0 equiv) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.52 g, 22.42 mmol, 1.2 equiv) in dichloromethane (50 mL) was stirred at room temperature for 30 minutes. The mixture was concentrated under reduced pressure, and the residue was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel column chromatography (eluent: ethyl acetate to dichloromethane / methanol = 20 / 1) to give the product 8a-4 as a yellow oil (8.19 g, crude). LCMS (ESI): m / z = 397 [M+H] + .

[0529] Preparation of Compound 8a-5: A mixture of Compound 8a-4 (8.19 g, 18.69 mmol, 1.0 equiv) and sodium hydroxide (1.24 g, 30.94 mmol, 1.5 equiv) in tetrahydrofuran / methanol / water (20 mL / 10 mL / 10 mL) was stirred at room temperature for 1 hour. The mixture was concentrated under reduced pressure, diluted with water, adjusted to pH = 3 with dilute hydrochloric acid and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated to give the product 8a-5 as a yellow oil (6.0 g, crude). LCMS (ESI): m / z = 383 [M+H] + .

[0530] Preparation of Compound 8a-6: A mixture of compound 8a-5 (1.1 g, 2.87 mmol, 1.0 equiv), compound 2a-6 (1.22 g, 2.15 mmol, 0.75 equiv), N,N-diisopropylethylamine (1.11 g, 8.62 mmol, 3.0 equiv) and 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.31 g, 3.45 mmol, 1.2 equiv) in N,N-dimethylformamide (10 mL) was stirred at room temperature for 1 h. The mixture was purified by preparative high performance liquid chromatography (A: phosphate buffer with pH = 7, B: acetonitrile, acetonitrile concentration 30%-90% within 30 min) to give the white solid product 8a-6 (320 mg, yield: 16%). LCMS (ESI): m / z = 627 [(M - 302)+H] + .

[0531] Preparation of Compound 8a-7: A mixture of compound 8a-6 (320 mg, 0.34 mmol, 1.0 equiv), succinic anhydride (207 mg, 2.07 mmol, 6.0 equiv), triethylamine (418 mg, 4.14 mmol, 12.0 equiv) and 4-dimethylaminopyridine (5 mg, 0.034 mmol, 0.1 equiv) in dichloromethane (5 mL) was stirred overnight at room temperature. The mixture was diluted with dichloromethane and washed with 10% sodium bicarbonate solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated in vacuo to give the yellow solid product 8a-7 (380 mg, crude). LCMS (ESI): m / z = 727 [(M - 302)+H] + . 1 HNMR (500 MHz, MeOD) δ 7.42–7.12 (m, 9H), 6.93–6.71 (m, 4H), 5.55–5.28 (m, 1H), 4.40 (dd, J = 44.2, 7.2 Hz, 2H), 4.32–4.16 (m, 3H), 3.91–3.82 (m, 2H), 3.77 (s, 6H), 3.72–3.60 (m, 8H), 3.54 (td, J = 13.4, 6.2 Hz, 6H), 3.35 (dd, J = 14.8, 9.4 Hz, 4H), 3.18–3.05 (m, 6H), 3.02–2.82 (m, 1H), 2.64–2.41 (m, 6H), 2.39–2.24 (m, 1H), 2.17 (dtd, J = 17.2, 12.8, 5.6 Hz, 5H), 1.81–1.60 (m, 5H), 1.51 (dt, J = 14.4, 7.0 Hz, 3H).

[0532] Preparation of Compound Q20-CPG: To a solution of Compound 8a-7 (380 mg, 0.37 mmol, 1.0 equiv) in N,N-dimethylformamide (10 mL) were added 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (169 mg, 0.44 mmol, 1.2 equiv), 1-hydroxybenzotriazole (70 mg, 0.52 mmol, 1.4 equiv) and N,N-diisopropylethylamine (191 mg, 1.48 mmol, 4.0 equiv). The mixture was shaken at room temperature for 5 minutes. Then CPG-NH2 (1.9 g) was added to the reaction mixture, and the mixture was shaken overnight at room temperature. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, dichloromethane and dried under vacuum for 1 hour. The residue was added to pyridine / acetic anhydride (7.5 mL / 2.5 mL), and the mixture was shaken at room temperature for 3 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, dichloromethane and dried under vacuum for 1 hour to obtain a light yellow solid product Q20-CPG (2.08 g, loading: 101 μmol / g).

[0533] Synthesis of Dual-Targeting siRNA in Example 24

[0534]

[0535] 1. Synthesis of Two Sense Strands of siRNA for Dual-Targeting siRNA Conjugation

[0536] Firstly, by the solid-phase oligonucleotide synthesis method in Example 1, replacing the solid-phase carrier with DL07-CPG and Q20-CPG, DL07-siRNA-1-SS containing an azide group and Q20-siRNA-2-SS containing an alkyne group were synthesized respectively; at the same time, the corresponding antisense strands were synthesized using general CPG.

[0537] 2. Synthesis of Dual-Targeting siRNA-SS Strand

[0538] Take a certain amount of DL07-siRNA-1-SS and Q20-siRNA-2-SS respectively, dissolve them in DEPC water, mix them at an equivalent ratio of 1:1.5, add CuSO4·5H2O (45 equiv.), THPTA (225 equiv.), NaVc (205 equiv.), aqueous MgCl2 solution (100 mM, 50 equiv.), TEAA Buffer (2 M, 1000 equiv.) and DMSO (1 / 2 the volume of DEPC water), and react overnight at room temperature. After monitoring the reaction to completion by LC-MS, add anhydrous ethanol with a volume three times that of the reaction solution and 3M NaCl solution with a volume of 1 / 3 to the reaction solution. After shaking well, place it at -20°C for about 30 min; centrifuge at 4°C and 15,000 rpm for 3 min. After sucking off the solution, dissolve it in DEPC water again. After detecting the concentration, purify it by HPLC to obtain the dual-targeted siRNA-SS strand (siRNA-1-SS-DL07-Q20-siRNA-2-SS).

[0539] 3. Synthesis of Dual-Targeted siRNA

[0540] Dissolve a certain amount of the dual-targeted siRNA-SS (siRNA-1-SS-DL07-Q20-siRNA-2-SS) strand in DEPC water, and add two antisense strands siRNA-1-AS and siRNA-2-AS with equal equivalents to it; heat at 95°C for 5 mins, and then cool to room temperature naturally to obtain the dual-targeted siRNA (siRNA-1-DL07-Q20-siRNA-2).

[0541] When changing to other linkers and delivery systems, the synthesis of the dual-targeted siRNA can refer to this example.

[0542] Table 45: Structural Information of Dual-Target Sequences and Delivery Systems

[0543]

[0544]

[0545]

[0546]

[0547]

[0548]

[0549]

[0550]

[0551]

[0552]

[0553]

[0554] The structural schematic diagrams of the dual-targeting siRNA linking ligands listed in the above table are as follows:

[0555]

[0556] Example 25 Evaluation of the effects of dual-targeting siRNAs with different structures delivered on the expression of AGT and PCSK9 in primary hepatocytes of AAV8-hAGT / hPCSK9 mice

[0557] Table 46: Experimental results of different delivery methods of dual-targeting siRNAs at different concentrations in primary hepatocytes of AAV8-hAGT / hPCSK9 mice

[0558]

[0559]

[0560] It can be known from the experiments that the activities of all dual-targeting siRNAs are much higher than those of two independent positive reference activities by the mixing method. At the same time, we found that different delivery systems also have different effects on the activities of the two targets. Among them, the siRNAs delivered by DL07-Q20, DL09-Q20, and DL20-Q20 have the best activities, far higher than the positive reference of 1000 pM mixed with 11000 pM. Next, we tested the IC50 values of the dual-target structure DT03081 with good activity for knocking down the two targets in primary hepatocytes of AAV8-hAGT / hPCSK9 mice.

[0561] Table 47: IC50 experimental results of DT03081 in primary hepatocytes of AAV8-hAGT / hPCSK9 mice

[0562]

[0563] It can be seen from Table 47 that the inhibitory IC50 values of DT03081 for both the AGT target and the PCSK9 target have reached about 44 pM, with extremely high activities. At the same time, the inhibitory activities for the two targets are comparable, indicating that DT03081 can simultaneously and persistently inhibit the expression of the two targets in vivo.

[0564] Some other combinations of the preferred sequences for the AGT and PCSK9 targets were evaluated for activity in vitro using the same delivery system, and the results are as follows.

[0565] Table 48: Experimental results of different delivery methods of dual-targeting siRNA at different concentrations in primary hepatocytes of AAV8-hAGT / hPCSK9 mice

[0566]

[0567]

[0568] It can be seen from the data that the activities of dual-targeting siRNAs with multiple preferred sequence combinations are better than those of the positive reference 1000PM mixture 11000PM

[0569] Example 26 Evaluation of the effects of different dual-target sequences on the expression levels of hAGT and hPCSK9 proteins in mice co-expressing hAGT and hPCSK9

[0570] Experimental method:

[0571] 1. Adenovirus integration of hAGT / hPCSK9

[0572] Through 1.5x10 11 Titer ultra-purified recombinant AAV8-hAGT and 1.5x10 11 Titer ultra-purified recombinant AAV8-hPCSK9 virus particles co-infected mice to obtain transgenic mice stably expressing hAGT / hPCSK9

[0573] 2. Experimental grouping and drug administration

[0574] 14 days after the mice were injected with the virus, blood was collected from the submandibular vein, left to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, the supernatant serum was taken, aliquoted and stored frozen at -80 °C. The serum samples were diluted 1000 times, and the expressions of hAGT and hPCSK9 in the mouse serum were detected by Human Angiotensinogen / AGT / SerpinA8 ELISA Kit (Linkage Biotechnology, product number: EK1202–96) and Human PCSK9 ELISA Kitproteintech (Cat No: KE00278) respectively. Based on the expression levels of hAGT and hPCSK9, the mice were evenly grouped, with 4 mice in each group. The siRNA was dissolved in physiological saline, the concentration was adjusted to 10 μM, and the mice were subcutaneously injected with the siRNA solution at a dose of 60 nmol / kg or 180 nmol / kg

[0575] 3. ELISA detection

[0576] After siRNA injection, a small amount of blood was collected from the submandibular vein every other week, allowed to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, and the supernatant serum was taken. After dilution 1000 times, the expression level of hPCSK9 was detected by ELISA.

[0577] The experimental results are shown in the table and Figure 1

[0578] Table 49: Inhibitory effects of AGT / PCSK9 dual-targeted siRNA DT03081 on two targets in AAV8-hAGT / hPCSK9 mice at a dose of 60 nmol / kg

[0579]

[0580] From Table 49 and Figure 1 and Figure 2 we can see that at a dosing dose of 60 nmol / kg, DT03081 has good in vivo knockdown effects on both the AGT target and the PCSK9 target, and is far better than the efficacy of the mixture of Zilebesiran and Inclisiran. And from the duration of the combined administration of the two positive drugs, we can see that the inhibition rate of 1000PM was still about 50% at day 56, while the inhibition rate of 11000PM on PCSK9 had recovered to about 50% at day 27. The inhibition duration of the two sequences on the target is inconsistent. And DT03081 obtained through sequence optimization and delivery structure optimization has a basically consistent trend of inhibition level change over time in the two targets. Therefore, it is more controllable for the dosing time and frequency clinically.

[0581] Table 50: Inhibitory effects of AGT / PCSK9 dual-targeted siRNA on two targets in AAV8-hAGT / hPCSK9 mice at different doses

[0582]

[0583] We further compared the activities of our optimized sequences after forming dual targets. It can be seen from the data that the activities of DT03081, DT03082, DT03085 and DT03086 are comparable.

[0584] The activities of other optimized sequence combinations after forming dual targets were also compared at a dosing dose of 60 nmol / kg.

[0585] Experimental method:

[0586] 1. Adenovirus integration of hAGT / hPCSK9

[0587] Through 1.5x10 11The titer of ultra-purified recombinant AAV8-hAGT virus particles was used to infect humanized PCSK9 mice to obtain transgenic mice stably expressing hAGT / hPCSK9.

[0588] 2. Experimental grouping and drug administration

[0589] Fourteen days after the mice were injected with the virus, blood was collected from the submandibular vein, left to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, the supernatant serum was taken, aliquoted and stored frozen at -80 °C. The serum samples were diluted 1000-fold, and the expression of hAGT and hPCSK9 in the mouse serum was detected by Human Angiotensinogen / AGT / SerpinA8 ELISA Kit (Linkage Biotechnology, product number: EK1202–96) and Human PCSK9 ELISA Kit proteintech (Cat No: KE00278), respectively. Based on the expression levels of hAGT and hPCSK9, the mice were evenly grouped, with 4 mice in each group. The siRNA was dissolved in normal saline, and the concentration was adjusted to 10 uM. The mice were subcutaneously injected with the siRNA solution at a dose of 60 nmol / kg.

[0590] 3. ELISA detection

[0591] After the siRNA injection, a small amount of blood was collected from the submandibular vein every week, left to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, the supernatant serum was taken, diluted 1000-fold, and the expression level of hPCSK9 was detected by ELISA.

[0592] The experimental results are shown in the table.

[0593] Table 51: Inhibition effects of AGT / PCSK9 dual-targeted siRNA on two targets in humanized PCSK9 mice infected with AAV8 hAGT virus at a dose of 60 nmol / kg

[0594]

[0595]

[0596] It can be seen from the data that the activities of multiple dual-targeted siRNAs are equivalent to or slightly better than that of DT03081. Example 27 evaluated the effects of different dual-target sequences on the expression of hAGT and hANGPTL3 in the liver of mice co-expressing hAGT and hANGPTL3

[0597] Experimental method:

[0598] 1. Adenovirus integration of hAGT and hANGPTL3

[0599] Through 1x10 11Ultra-purified recombinant AAV8 hAGT at a titer of 1x10 11 Transgenic mice stably expressing both hAGT and hANGPTL3 were obtained by infecting mice with ultra-purified recombinant AAV8 hANGPTL3 virus particles at a titer of 1x10. 100 μl of the virus was added to 5.9 ml of PBS, and 200 μl of the virus dilution was intravenously injected into each mouse.

[0600] 2. Administration

[0601] Fourteen days after the mice were injected with the virus, the mice were evenly divided into groups of 4. The siRNA was dissolved in physiological saline and subcutaneously injected at a dose of 60 nmol / kg.

[0602] 3. Liver sampling for detection

[0603] The liver was sampled at different time points after the siRNA injection. RNA in the liver tissue was extracted using TRI REAGENT (MRC, catalog number: TR118), and the extracted RNA was reverse transcribed into cDNA using PrimeScript RT regent Kit (Takara, catalog number: RR047A). The prepared QPCR system was added to a 96-well PCR plate, sealed with a sealing film, and QPCR was performed on a StepOnePlus real-time PCR system (appliedbiosystems) to detect the expression levels of hAGT and hANGPTL3.

[0604] Table 52: Inhibitory effects of AGT / ANGPTL3 dual-targeted siRNA on two targets in AAV8-hAGT / hANGPTL3 mice at a dose of 60 nmol / kg

[0605]

[0606] The preferred sequences of the AGT target, 1167.25-19, 1167.27-21, 1165.5-16, 1161.7-17, were combined with the preferred sequences of the ANGPTL3 target, 7061.18-14, 7061.4-16, to obtain the AGT / ANGPTL3 dual-targeting siRNAs DT02042, DT02043, DT02047, DT02058, and DT02059, which were evaluated for activity in vivo together with the positive reference sequences. As can be seen from Table 52, there were significant differences in the activity of different sequence combinations. The sequence with the best activity was DT02043, and the activity of both of its two targets was far better than that of the positive reference 1000PM mixed ARO-ANG3, while the activity of the dual-targeting siRNA DT02042 with the worst activity was worse than that of the positive reference. Further comparison of DT02043 and DT02047 showed that although the sequence targeting ANGPTL3 in both of the two dual-target siRNAs was 7061.4-16, due to the different sequences targeting AGT connected, there were significant differences in the activity targeting ANGPTL3.

[0607] Example 28 Evaluate the effects of different dual-target sequences on the expression levels of hANGPTL3 and hPCSK9 in mice co-expressing hANGPTL3 and hPCSK9

[0608] Experimental method:

[0609] 1. Adenovirus integration of hANGPTL3 / hPCSK9

[0610] Through 1.5x10 11 Ultra-purified recombinant AAV8-hANGPTL3 with a titer and 1.5x10 11 Ultra-purified recombinant AAV8-hPCSK9 virus particles were co-infected into mice to obtain transgenic mice stably expressing hANGPTL3 / hPCSK9.

[0611] 2. Experimental grouping and drug administration

[0612] Fourteen days after the mice were injected with the virus, blood was collected from the submandibular vein, left to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, the supernatant serum was taken, aliquoted and stored frozen at -80 °C. The serum samples were diluted 1000-fold, and the expression of hPCSK9 in the mouse serum was detected by the Human PCSK9 ELISA Kit proteintech (Cat No: KE00278). Based on the expression level of hPCSK9, the mice were evenly grouped, with 4 mice in each group. The siRNA was dissolved in physiological saline, and the concentration was adjusted to 10 uM. The mice were subcutaneously injected with the siRNA solution at a dose of 60 nmol / kg.

[0613] 3. ELISA detection

[0614] After siRNA injection, a small amount of blood was collected from the submandibular vein every other week, left standing at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, the supernatant serum was taken, and the expression level of hPCSK9 was detected by ELISA after dilution 1000 times.

[0615] 4. Liver sampling for detection

[0616] At different time points after siRNA injection, the liver was taken, and RNA in the liver tissue was extracted by TRI REAGENT (MRC, product number: TR118), and the extracted RNA was reverse transcribed into cDNA using PrimeScript RT regent Kit (Takara, product number: RR047A). The prepared QPCR system was added to a 96-well PCR plate, sealed with a sealing film, and QPCR was performed on a StepOnePlus real-time PCR system (appliedbiosystems) to detect the expression levels of hPCSK9 and hANGPTL3.

[0617] Table 53: Inhibitory effects of PCSK9 / ANGPTL3 dual-targeted siRNA on two targets in AAV8-hPCSK9 / hANGPTL3 mice at a dose of 60 nmol / kg

[0618]

[0619] The optimized siRNAs 7061.4-16 and 7061.18-14 targeting ANGPTL3 sequence 7061 were combined with the PCSK9 targeting sequences 11040.10-23 and 11002.17-21 to obtain ANGPTL3 / PCSK9 dual-targeted siRNAs DT09001, DT09003, and DT09005, and their activities were evaluated in AAV8-hANGPTL3 / hPCSK9 mice. Blood and liver were taken at different time points, and the expression levels of PCSK9 and ANGPTL3 were detected by ELISA and QPCR respectively. It can be seen from the data that DT09001 and DT09005 have the best knockdown activities on the two targets. In this experiment, we also found that even though both dual-target siRNAs DT09003 and DT09005 used the 11002.17-21 sequence to target PCSK9, due to the different sequences targeting ANGPTL3 connected, the activities targeting PCSK9 were very different.

[0620] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A dual-targeting siRNA agent, characterized in that, The dual-targeting siRNA agent comprises two different siRNAs targeting two different genes or pharmaceutically acceptable salts thereof, and the two different siRNAs or pharmaceutically acceptable salts thereof are integrated by linking with a ligand for delivering nucleic acids. Each of the siRNAs is a dsRNA composed of a sense strand and an antisense strand, and the two different genes are angiotensinogen (AGT) and proprotein convertase subtilisin / kexin type 9 (PCSK9); The siRNA targeting the angiotensinogen gene is modified, and its 5'-3' sense strand sequence is Invab*mU*mGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, and its 5'-3' antisense strand sequence is VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mG; Or the siRNA targeting the angiotensinogen gene is modified, and its 5'-3' sense strand sequence is Invab*mC*mCmAmAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, and its 5'-3' antisense strand sequence is VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG; The siRNA targeting the proprotein convertase subtilisin / kexin type 9 gene is modified, and its 5’-3’ sense strand sequence is Invab*mC*mUmUmAmUmUmCmUfGfGfGfUmUfUmUmGmUmAmGmCmAInvab, and its 5’-3’ antisense strand sequence is VPU-S*fG*mCmUmAmCmAmAmAmAmCdCmCfAmGfAmAmUmA*mA*mG; Wherein, VPU-S is 2’-S-methyluridine-5’-(E)-vinyl phosphate-3’-phosphate, mA is 2’-O-methyladenosine-3’-phosphate, mU is 2’-O-methyluridine-3’-phosphate, mC is 2’-O-methylcytidine-3’-phosphate, mG is 2’-O-methylguanosine-3’-phosphate, fA is 2’-fluoroadenosine-3’-phosphate, fU is 2’-fluorouridine-3’-phosphate, fC is 2’-fluorocytidine-3’-phosphate, fG is 2’-fluoroguanosine-3’-phosphate, dG is 2’-deoxyguanosine-3’-phosphate, dT is 2’-deoxythymidine-3’-phosphate, dC is 2’-deoxycytidine-3’-phosphate, Invab is an inverted abasic residue, and * is a phosphorothioate bond.

2. The dual-targeting siRNA agent according to claim 1, wherein The pharmaceutically acceptable salt is a sodium salt or a potassium salt.

3. The dual-targeting siRNA agent according to claim 1 or 2, characterized in that, The ligand is an N-acetylgalactosamine ligand.

4. The dual-targeting siRNA agent according to claim 3, wherein The N-acetylgalactosamine ligand is respectively linked to the 3' ends of the sense strands of the two siRNAs through chemical bonds, and the chemical bonds are respectively a phosphate ester bond or a phosphorothioate bond.

5. The dual-targeting siRNA agent according to claim 4, wherein The N-acetylgalactosamine ligand has the following structure:

6. The dual-targeting siRNA agent according to claim 5, wherein The ligation mode of the ligand to the 3'-end of the sense strand of siRNA is as follows: Among them represents siRNA of a modified sequence targeting the AGT gene and the PCSK9 gene.

7. Use of the dual-targeting siRNA agent according to any one of claims 1-6 in the preparation of a product for simultaneously inhibiting the expression of two target genes, AGT and PCSK9, in cells.

8. The application according to claim 7, wherein The product is a biological agent or a pharmaceutical preparation.

9. Use of the dual-targeting siRNA agent according to any one of claims 1-6 in the preparation of a medicament for preventing and / or treating hypertension and / or lipid disorders, characterized in that, The hypertension is mediated by the AGT gene, and the lipid disorder is mediated by the PCSK9 gene.

10. The application according to claim 9, wherein The hypertension is any one of borderline hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-induced hypertension, diabetic hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, pulmonary hypertension, portal hypertension.

11. The application according to claim 9, wherein The lipid disorder is selected from hyperlipidemia, atherosclerosis, non-alcoholic steatohepatitis.

12. A method for simultaneously inhibiting the expression of two target genes, AGT and PCSK9, in vitro cells, characterized in that, The method comprises: (a) contacting in vitro cells with the dual-targeting siRNA agent according to any one of claims 1-6; and (b) maintaining the cells produced in step (a) for a time sufficient to degrade the mRNA transcripts of the two target genes, AGT and PCSK9, so as to simultaneously inhibit the expression of the two target genes, AGT and PCSK9, in the cells.

Images