A crRNA, a primer set, a detection system and a detection method for SARS-CoV-2

Abstract

The application discloses a crRNA, a primer group, a detection system and a detection method of SARS-CoV-2, and belongs to the technical field of virus detection. The CRISPR-Cas13a detection system established by the application utilizes the non-specific cleavage activity of the Cas13a protein, combines with the recombination polymerase amplification technology which can efficiently amplify the target fragment, and the system comprises the Cas13a, the sgRNA corresponding to the target virus to be detected and the reporter RNA chain comprising a cleavage fluorescence; when the Cas13 protein recognizes the target RNA chain, the corresponding template is cleaved, then the collateral cleavage accessory activity thereof is activated, and then the reporter RNA is cleaved and the detectable fluorescence signal is released, so that the rapid, inexpensive and high-sensitivity detection of trace nucleic acid is realized, and the minimum detection limit for SARS-CoV-2 is 1 copy / muL.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of virus detection, in particular to a crRNA, a primer set, a detection system and a detection method for SARS-CoV-2. BACKGROUND

[0002] Coronaviruses (CoV) are a large family of viruses that resemble a "crown" under electron microscopy, with a diameter of about 80-120 nm. They have four major structural proteins: Spike (S), Envelope (E), Membrane (M), and Nucleocapsid (N). The coronavirus genome is a linear single-stranded positive-sense RNA ((+)ssRNA) with a full-length size of 26-32 kb, which is one of the largest known RNA viruses. Coronaviruses belong to the order Nidovirales, family Coronaviridae, subfamily Coronavirinae. The current classification divides the subfamily Coronavirinae into four genera: alpha coronavirus, beta coronavirus, gamma coronavirus, and delta coronavirus. Coronaviruses can infect mammals and birds, mainly causing various respiratory and intestinal infections in humans and animals. Seven coronaviruses have been found to cause human diseases: HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-Cov, and SARS-CoV-2. The first four coronaviruses have been widely transmitted and can cause mild respiratory diseases in humans. However, SARS-CoV, MERS-Cov, and SARS-CoV-2 can cause severe respiratory diseases and even death.

[0003] SARS-CoV-2 is a linear single-stranded RNA (ssRNA) virus with a full-length genome sequence of 29903 bp (accession number MN908947). It contains 14 major open reading frames (ORFs). Among them, 21536-25384 bp is the "S" gene, which can encode the virus surface glycoprotein S; 28274-29533 bp is the "N" gene, which can encode the virus nucleocapsid phosphoprotein N. The SARS-CoV-2 genome sequence has a similarity of 79.5% with the SARS-Cov genome sequence, and the highest similarity with the bat SARS coronavirus (Bat SARS coronavirus) bat-SL-CoVZC45 genome sequence, with a similarity of 84%.

[0004] According to the different virulence of SARS-CoV-2 variants and the different risk factors, the World Health Organization (WHO) divides SARS-CoV-2 variants into two categories: variant of concern (VOC) and variant of interest (VOI). So far, the variants of concern are as follows: Alpha: its infectivity is about 50% higher than that of the original SARS-CoV-2 virus, and it became the mainstream virus variant in the first half of 2021, but the Alpha variant can be neutralized by therapeutic monoclonal antibodies, antibodies produced after vaccination, or antibodies produced after COVID-19 recovery; Beta: has very strong immune escape ability, and this strain has higher infectivity. Although the neutralizing effect of convalescent serum has been reduced, it is still possible to be infected again after recovering from COVID-19. Gamma: significantly reduces the susceptibility to the combination of bamlanivimab and etesevimab monoclonal antibody therapy, but other EUA monoclonal antibody therapies are available. Delta: the most contagious variant so far, Delta is 50% more contagious than Alpha and twice as contagious as the original SARS-CoV-2. Due to the high mutation rate of RNA viruses, more and more recombinant strains have appeared and are spreading globally.

[0005] Rapidly identifying the source of infection is the key to major epidemic prevention and control. Currently, the detection methods for SARS-CoV-2 mainly include nucleic acid detection, antibody detection, and antigen detection. Among them, nucleic acid detection is the "gold standard" for SARS-CoV-2 detection. It uses PCR technology, nucleic acid sequencing technology, and molecular hybridization technology to detect nucleic acids in patient samples, providing medical detection evidence for the diagnosis of infected cases, winning the best treatment time for infected persons, preventing the further spread of the virus, and reducing virus mortality. Since SARS-CoV-2 is an RNA virus, the kit detection basically uses reverse transcription and real-time polymerase chain reaction (RT-PCR) to amplify the nucleic acid (RNA) of the pathogen, and to detect the amplification product in real time by fluorescent probe. In the PCR reaction system, a pair of specific primers and a TaqMan probe are included. The probe is a specific oligonucleotide sequence, with a reporter fluorescent group and a quenched fluorescent group labeled at both ends. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quenched group; if the target sequence exists in the reaction system, the probe binds to the template during PCR reaction, and the DNA polymerase degrades the probe by using the exonuclease activity along the template, the reporter group and the quenched group are separated, and fluorescence is emitted. Each amplification of a DNA strand produces one fluorescent molecule. The fluorescence quantitative PCR instrument can monitor the cycle number (Ct value) when the fluorescence reaches the pre-set threshold, which is related to the concentration of viral nucleic acid. The higher the concentration of viral nucleic acid, the smaller the Ct value.

[0006] The fluorescence quantitative PCR method has high requirements for detection equipment or platform, the high-sensitivity RT-PCR instrument is expensive, and the cleanliness of the laboratory and the operator are also required, the PCR instrument has limitations such as detection sample, detection space and detection flux, and it is impossible to carry out large-scale detection, which leads to a relatively low efficiency of effective diagnosis. Due to the limitations of many factors (site-technology-personnel-equipment), the major epidemic areas are facing great pressure of clinical molecular diagnosis. In addition, the nucleic acid detection takes a long time, considering the sample transportation and sample backlog, the result can be reported at the fastest speed of 4 hours; and the antibody detection, generally, IgM and IgG antibodies appear in the serum of patients after being infected for 7-14 days, and cannot achieve the purpose of early diagnosis, the detection speed is slow, the pollution step is relatively complicated; the colloidal gold immunization method has low flux, and the accuracy of the test paper is highly dependent on the specificity of the antibody. If the quality of the antibody is not good, cross reaction is easy to occur, resulting in misjudgment. Rapid, accurate and economical are the basic requirements for the ideal diagnosis method, in addition, the simplicity of operation (operation does not require professional personnel, simple training can be achieved), and the professional equipment and strong infrastructure requirements (such as power conditions) should be considered as much as possible. SUMMARY

[0007] The purpose of the present application is to provide a crRNA, a primer set, a detection system and a detection method of SARS-CoV-2, so as to solve the problems existing in the prior art.

[0008] In order to achieve the above-mentioned purpose, the present application provides the following solutions:

[0009] One of the technical solutions of the present application is a crRNA, the nucleotide sequence of which is shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0010] The second technical solution of the present application is a RAA amplification primer set, which consists of an upstream primer shown in SEQ ID NO. 3 and a downstream primer shown in SEQ ID NO. 4; or consists of an upstream primer shown in SEQ ID NO. 5 and a downstream primer shown in SEQ ID NO. 6.

[0011] The third technical solution of the present application is a CRISPR-Cas13a detection system of SARS-CoV-2, which comprises the CrRNA and the Cas13a protein.

[0012] The fourth technical scheme of the present application is a detection method for SARS-CoV-2 for non-disease detection or treatment purposes, comprising the following steps: using DNA of a sample to be tested as a template, performing an amplification reaction using the RAA amplification primer set, and performing an enzyme cutting reaction on the amplification product using the CRISPR-Cas13a detection system, and determining whether the sample to be tested contains SARS-CoV-2 according to the fluorescence color after the reaction is completed.

[0013] The fifth technical scheme of the present application is a product for detecting SARS-CoV-2, comprising the RAA amplification primer set and / or the CRISPR-Cas13a detection system.

[0014] Based on the above technical scheme, the present application has the following technical effects:

[0015] 1. The detection method established by the present application can improve the fluorescence value by increasing the reaction time or using two CrRNAs in combination for a sample suspected to be positive for viral nucleic acid, thereby determining the sample to be positive or negative, and greatly improving the early monitoring of SARS-CoV-2 at the front line of the epidemic.

[0016] 2. Another advantage of the detection method established by the present application is that the best crRNA is screened, which further improves the sensitivity of the method established by the present application. The core of the CRISPR / Cas13a detection method is the crRNA, so the crRNA is directly related to the sensitivity and accuracy. Among the 20 crRNAs, the fluorescence value of crRNA5 and crRNA15 is the highest through CRISPR / Cas13a detection, indicating that these two are the best and have the highest sensitivity. The present application uses a eukaryotic expression system, expression and purification of eukaryotic Cas13a protein, and reduces the cost of reagents.

[0017] 3. Another advantage of the detection method established by the present application is low cost and does not require expensive instruments and equipment. Currently, fluorescent quantitative PCR instruments are expensive, and the price of ordinary domestic products is about 150,000 yuan, while the detection method suggested by the present application only requires a water bath or a constant temperature incubator and a fluorescence detector, and the cost of all instruments and equipment is less than 10,000 yuan, and it is suitable for use at the front line and does not require a professional and standardized laboratory.

[0018] 4. Another advantage of the detection method established by the present application is short detection time. Currently, the reaction time of fluorescent quantitative PCR is 1.5-2h, while the method established by the present application is 10min for constant temperature amplification, and 50min for Cas13a detection of fluorescence, for a total of 60min. Therefore, the detection method established by the present application is more conducive to early and rapid detection of SARS-CoV-2, which is very important for early prevention and control of SARS-CoV-2.

[0019] 5.The detection method established by the application selects a high-conservation region as a target region, which remains unchanged in all kinds of mutant strains in the world at present, so that all SARS-CoV-2 mutant strains can be detected.

[0020] The CRISPR-Cas13a detection system established by the application utilizes the non-specific cleavage activity of Cas13a protein and combines with the recombination polymerase amplification technology which can efficiently amplify the target fragment, and the system comprises Cas13a, sgRNA corresponding to the target virus to be detected, and a reporter RNA chain which can emit fluorescence after being cleaved; when the Cas13 protein recognizes the target RNA chain, it will cleave the corresponding template, and then activate its collateral cleavage accessory activity, thereby cleaving the reporter RNA and releasing the detectable fluorescence signal, realizing rapid, inexpensive and high-sensitivity detection of trace nucleic acids, and the minimum detection limit for SARS-CoV-2 is 1 copy / μL. The application can directly detect clinically treated samples, the sample usage is extremely small, and no expensive instrument equipment is needed, and the operation is extremely simple, in addition, the application also has extremely high sensitivity and specificity. The application has the potential to develop into an ideal rapid and accurate nucleic acid detection technology. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0022] Figure 1 A is the calculation docking score to evaluate the stability of the crRNA-RNA-Cas 13a complex, and the crRNA with a low docking score is considered to be a potential best crRNA; B is the spatial position of the LwaCas13a protein and the crRNA simulated docking displayed by pymol 3.1; C is the secondary structure of the RNA of Covid-19 amplified by RT-RAA; D is the position of the crRNA targeting coronavirus (MN 908947); and E is the sequence alignment of N1-crRNA and N2-crRNA with different subtypes of COVID-19 epidemic strains.

[0023] Figure 2 A is the schematic diagram of the CRISPR / Cas13a detection system, B is the system specificity detection of the CRISPR / Cas13a detection system, and C is the real-time fluorescence detection fluorescence signal of Fig. B.

[0024] Figure 3 For comparison of the reaction system conditions of the CRISPR / Cas13a system; wherein A is the optimal temperature of Cas13a detection, B is the RT-RAA amplification time, C is the sensitivity of RT-RAA detection of novel coronavirus COVID-19 nucleic acid, and D is the sensitivity of crRNA combination better than that of single crRNA.

[0025] Figure 4 For detection specificity of the CRISPR / Cas13a system; wherein A is sequence alignment of N1-crRNA and N2-crRNA with non-COVID-19 respiratory virus strains, B is specific imaging of CRISPR / Cas13a detection of SARS-CoV-2 N gene at the end point, C is real-time fluorescence detection of Fig. B, and D is fluorescence quantification of CRISPR / Cas13a detection of SARS-CoV-2 N gene at the end point.

[0026] Figure 5 For comparison of RT-qPCR and CRISPR / Cas13a detection system; wherein A is imaging of nucleic acid results of 10 cases of coronavirus infection pharyngeal swabs determined by RT-RAA-CRISPR-Cas13a, B is fluorescence intensity measurement of nucleic acid results of 10 cases of coronavirus infection pharyngeal swabs determined by RT-RAA-CRISPR-Cas13a, and C is nucleic acid results of 10 cases of coronavirus infection pharyngeal swabs determined by RT-qPCR. DETAILED DESCRIPTION

[0027] A number of exemplary embodiments of the present application will now be described in detail with reference to the drawings. Such embodiments are described herein for illustrative purposes only and are not intended to limit the scope of the present application, as described herein. Furthermore, for simplicity and clarity of illustration, the drawing figures depict the same or similar functional operations of a given process for one or more exemplary embodiments. In addition, descriptions and details of well-known functions and constructions can be omitted for clarity and conciseness.

[0028] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, for numerical ranges that are expressed in a range format, it is to be understood that every numerical value within the range is also specifically disclosed. In addition, every narrower range that falls within a broader range is also specifically disclosed. Moreover, any one of the individual values included in the range is also specifically disclosed. These are only method of disclosure followed as substantiated by the patent statutes and rules. Accordingly, the phrase "between X and Y" should be understood to include the values X and Y themselves.

[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials which are described therein. In the case of conflict between the present specification and any document incorporated herein by reference, the present specification will control.

[0030] Many modifications and variations of the present application described in the specific embodiments of the application can be made by those skilled in the art without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application. The specification and examples given are exemplary only.

[0031] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and methods.

[0032] The technical solutions described in the present application are conventional solutions in the art, and the reagents or raw materials used are commercially available or have been disclosed, unless otherwise specified.

[0033] The CRISPR / Cas system is an immune system of bacteria and archaea against the invasion of foreign DNA or RNA. At present, three types of CRISPR / Cas systems have been found in bacteria. Type I and type III systems require the participation of numerous proteins, while type II system is relatively simple. A Cas9 nuclease can complete the recognition and cutting of target double-stranded DNA by using a guide RNA (gRNA). Type II system is also called CRISPR / Cas9 system, which has been widely used in the field of gene editing and has triggered a revolution in genetic engineering. The discovery of various Cas proteins has broadened the application range of CRISPR / Cas. A new type of nuclease Cas13a can target ssRNA, which lays a foundation for RNA targeting and RNA editing. Cas13a belongs to type VI CRISPR system, and the recognition of target depends on PFS sequence (Protospacer flanking site, equivalent to PAM sequence) composed of A, U or C base. After Cas13a specifically cuts the target ssRNA under the guidance of crRNA, it shows ribonuclease activity and can cut the non-specific ssRNA near the target. The CRISPR / Cas13a system has very important application value in nucleic acid detection.

[0034] The application develops a nucleic acid detection technology with an emolevel (single copy) sensitivity and single-base specificity, i.e., a visual nucleic acid detection platform based on CRISPR-Cas13a, by using gene editing technology. The platform uses the accessory cleavage activity of Cas13a protein after target activation in eukaryotic expression, combines recombinase aided amplification technology (Recombinase Aided Amplification) which can efficiently amplify the target fragment, and sgRNA which can accurately recognize the sequence, and has realized rapid, inexpensive, high-sensitivity and visual detection of trace SARS-CoV-2 clinical sample extracted nucleic acid. Based on the technology platform, a visual rapid detection method for a plurality of different respiratory pathogens can be developed by designing two sgRNAs. The application can directly detect the clinical sample after simple processing, the sample usage is extremely small, and no expensive instrument equipment is needed, the operation is extremely simple, and the application is suitable for on-site instant detection, especially for screening virus-infected people in resource-poor areas or in the wild, and preventing the further spread of the virus.

[0035] The present application provides a technology based on CRISPR / Cas13a for simultaneously and rapidly detecting multiple epidemic strains of Covid-19, which can be used as a detection method for early monitoring and diagnosis of ASFV. The biggest advantage of the technology is high sensitivity.

[0036] Currently, the best detection method for Covid-19 is fluorescence quantitative PCR. Through comparison, the detection method established in the application is at least 10 times higher than fluorescence quantitative PCR (the minimum detection concentration of fluorescence quantitative PCR is 10 copies / μL of virus particles, while the minimum detection concentration based on CRISPR / Cas13a technology is 1 copy / μL of virus particles). Therefore, the detection method established in the application has the advantage of being able to efficiently detect weak positive and suspected positive samples with very low virus content. Only by appropriately increasing the reaction time, the Covid-19 nucleic acid positive or negative can be determined. The defect of the current fluorescence quantitative PCR is that it cannot determine the Covid-19 nucleic acid positive or negative for samples with very low virus content, i.e., Ct value in the range of 30-37. Even if the reaction time is extended, the result is still questionable, which brings uncertainty to the early monitoring and prevention and control of Covid-19.

[0037] The detection method established in the application can increase the fluorescence value by increasing the reaction time or using two CrRNAs for suspected virus nucleic acid positive samples, thereby determining the positive or negative of the sample, and greatly improving the early monitoring of Covid-19 at the front line of the epidemic.

[0038] Another advantage of the detection method established by the application is that the best crRNA is screened, so that the sensitivity of the method established by the application is further improved. The core of the CRISPR / Cas13a detection method is crRNA, so crRNA is directly related to sensitivity and accuracy. Among the 20 crRNAs, the fluorescence value of crRNA5 and crRNA15 is the highest through CRISPR / Cas13a detection, which indicates that the two have the best effect and the highest sensitivity.

[0039] Another advantage of the detection method established by the application is low cost and no need for expensive instruments and equipment. At present, the fluorescence quantitative PCR instrument is expensive, and the general domestic price is about 150,000 yuan, while the detection method suggested by the application only needs a water bath kettle or a constant temperature incubator and a fluorescence detector, and the cost of all instruments and equipment is less than 10,000 yuan, and it is suitable for the front line of pig farms and does not need a professional and standardized laboratory.

[0040] Another advantage of the detection method established by the application is short detection time. At present, the fluorescence quantitative PCR reaction time is 1.5-2h, while the method established by the application is 10min for constant temperature amplification, and then 50min for Cas13a detection of fluorescence, a total of 60min. Therefore, the detection method established by the application is more conducive to early and rapid detection of ASFV, which is very important for early ASFV prevention and control.

[0041] The target region selected by the detection method established by the application is a highly conserved region, which remains unchanged in various mutant strains in the world at present, so it can detect all COVID-19 mutant strains.

[0042] The embodiment of the application provides a crRNA, and the nucleotide sequence is as shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0043] The embodiment of the application also provides a RAA amplification primer group, which consists of an upstream primer as shown in SEQ ID NO. 3 and a downstream primer as shown in SEQ ID NO. 4; or consists of an upstream primer as shown in SEQ ID NO. 5 and a downstream primer as shown in SEQ ID NO. 6.

[0044] The embodiment of the application also provides a CRISPR-Cas13a detection system of SARS-CoV-2, which comprises the CrRNA and the Cas13a protein.

[0045] The embodiment of the present application also provides a detection method for non-disease detection or treatment destination SARS-CoV-2, comprising the following steps: taking DNA of a sample to be tested as a template, performing amplification reaction by using the RAA amplification primer group, and performing enzyme cutting reaction on the amplification product by using the CRISPR-Cas13a detection system, and judging whether the sample to be tested contains SARS-CoV-2 according to the fluorescence color after the reaction is completed.

[0046] In some specific embodiments, the fluorescence color is the fluorescence color observed after the reaction is completed under blue light or ultraviolet excitation.

[0047] In some specific embodiments, the judgment of whether the sample to be tested contains SARS-CoV-2 is specifically: reading by using a blue light gel cutting instrument, taking a negative control as a reference, and observing that the light-emitting group is positive.

[0048] Or diluting the reaction result into 300 muL by using nuclease free water, and then detecting the fluorescence intensity at an excitation light of 490 nm and an emission light of 520 nm by using a fluorescence spectrophotometer, when the fluorescence intensity value of the experimental group is more than 3 times higher than the fluorescence intensity value of the negative control, it is determined as a positive result.

[0049] Or the fluorescence intensity is greater than or equal to 600 a.u. at any time, which is determined as a positive result.

[0050] In some specific embodiments, the reaction system of the amplification reaction is 50 muL, including: reaction dry powder 1 tube, A Buffer 41.5 muL, Forward primer 2 muL, Reverse primer 2 muL, RNA sample 2 muL and B Buffer 2.5 muL.

[0051] The reaction condition is: after being fully mixed, incubating at 42 DEG C for 1 h.

[0052] In some specific embodiments, the reaction system of the enzyme cutting reaction is 20 muL, including: Cleavage Buffer 2 muL, LwaCas13a protein 2 muL, crRNA 2 muL, Reporter 1 muL, SUPERase·In RNase Inhibitor 1 muL, T7 RNA polymerase (5 U / muL) 0.6 muL, Ribonucleotide Solution 0.8 muL, MgCl2 2.4 muL and amplification product 8.2 muL.

[0053] The reaction condition is: after being fully mixed, reacting at 37 DEG C for 30 min, and then observing fluorescence by using blue light or ultraviolet excitation.

[0054] The application also provides a product for detecting SARS-CoV-2, comprising the RAA amplification primer set and / or the CRISPR-Cas13a detection system.

[0055] Example 1 Design and screening of optimal candidate CrRNA that can stably bind to Cas13a and viral RNA

[0056] Using the novel coronavirus reference sequence (accession number MN908947) in NCBI as a template, the application designed a crRNA library, and selected crRNAs with GC content between 0.4 and 0.6. Subsequently, molecular docking simulation was performed to analyze the interaction between the candidate crRNA, target RNA and Cas13a. The docking score was calculated to evaluate the stability of the crRNA-RNA-Cas13a complex, and crRNAs with low docking scores were considered as potential optimal crRNAs.

[0057] First, the target RNA sequence was analyzed, and by comparing the sequence with its similar species, the non-conserved fragments in the conserved region were screened out. The fragment was subjected to secondary structure prediction, and the fragment sequence with relatively simple structure was selected to design crRNA. Since the GC content is positively correlated with the stability of double-stranded DNA or RNA, the application selected the crRNA sequence with the highest GC content (≥0.4) as the candidate sequence for subsequent binding simulation. In order to preliminarily evaluate the specificity of these crRNA sequences, the application used NCBI database for nblast comparison, and the results showed that the designed crRNA had good specificity.

[0058] The obtained crRNA was subjected to 3D structure in the RNAComposer (rnacomposer.cs.put.poznan.pl) website, and the Pdb format file was obtained. The pdb format file of the Cas13a protein and the crRNA complex (ID: 5XWY) was obtained in the PDB database, and then the Autodock Tool software was used to separate the Cas13a protein and the crRNA bound thereto, and the pdb format file containing only the Cas13a protein was obtained. The cas13a protein was used as the receptor, and the crRNA was used as the ligand. MPRDock (huanglab.phys.hust.edu.cn) was used for molecular simulation docking, and the crRNA with the lowest docking score was selected as the optimal candidate crRNA. Figure 1In the middle A, the docking score of the crRNA designed according to the SARS-Cov-19 reference sequence N fragment (28261-28446 and 29100-29279) is obtained by molecular modeling docking, and the lower the score, the better the binding with the Cas13a protein, so the present application selects N1-crRNA1 and N2-crRNA1 two crRNAs for subsequent experiments. Figure 1 In the middle B, the Cas13a and crRNA are combined and visualized by Pymol, Figure 1 In the middle C, D, the secondary structure diagram of N1 crRNA and N2 crRNA and the corresponding target RNA, Figure 1 In the middle D, N1-crRNA1 and N2-crRNA1 target and bind to the position on SARS-Cov 2.

[0059] The designed crRNA is synthesized by Hu Zhou He Ma Biological Technology Co., Ltd. Further sequence comparison proves that the crRNA designed by the present application can completely target and bind to all mutant strains, see Figure 1 In the middle E, but cannot combine with other coronavirus and respiratory virus strain sequences that infect humans, see Figure 4 In the middle A.

[0060] Example 2 Establishment of SARS-CoV-2 detection system based on CRISPR-Cas13a system

[0061] CRISPR-Cas13a detection system

[0062] 1. Preparation of standard sample.

[0063] The sequence from SARS-CoV-2 (accession number MN908947) (see Appendix for sequence) was added with a T7 promoter on its forward primer, and after PCR amplification, the PCR product was purified with phenol chloroform isoamyl alcohol, and the target RNA was generated in vitro using an in vitro transcription kit-T7 (Promega). The RNA was purified by Trizol method, and the band was verified by running gel. The concentration measured by Nanodrop was 1715.9 ng / μL, 1731.4 ng / μL, OD 260 / 280 2.04, and stored at -80℃.

[0064] Use the formula: copies / μL = 6.02 x 10 23 (ng / μL) x 10 -9 / RNA Length x 330;

[0065] The calculated RNA copy number is 1.5 x 10 13 copies / μL, and this is used as a reference gradient dilution to prepare the detection standard.

[0066] 2. Design of RT-RAA amplification primers

[0067] The design of RT-RAA primers is extremely strict, and the substitution or addition of individual bases will have an important influence on the experimental results. The primers must be screened after experimental verification and detection. The design principle is as follows: the length of the primer is 25-35 nt, the size of the amplicon is 80-140 bp, and the Tm value is between 54°C and 67°C. The T7 RNA polymerase promoter is attached to the 5' end of the forward primer, and the amplified DNA contains the T7 promoter. After adding T7 RNA polymerase to the reaction system, the amplified DNA can be transcribed into RNA. The primer sequence is shown in Table 1, which is synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd.

[0068] Table 1. RAA amplification primers

[0069] Primer Name Sequence (5' - 3') N1-RAA-F (SEQ ID NO. 3) GAAATTAATACGACTCACTATAGGGaacgaacaaactaaaatgtctgataatgga N1-RAA-R (SEQ ID NO. 4) tgagtgagagcggtgaaccaagacgcagta N2-RAA-F (SEQ ID NO. 5) GAAATTAATACGACTCACTATAGGGgacgtggtccagaacaaacccaaggaaatt N2-RAA-R (SEQ ID NO. 6) cacctgtgtaggtcaaccacgttcccgaag

[0070] 3. Design of signal reporter molecule

[0071] Because Cas13a has collateral cleavage activity, after recognizing the target RNA, the activated Cas13a will continue to cut other non-target RNAs, so a short RNA oligonucleotide can be designed as a fluorescent reporter molecule, which has a fluorescein (such as FAM, FITC) at one end and a biotin at the other end, and the sequence is shown in Table 2.

[0072] Table 2. Reporter molecule sequence

[0073] Name Sequence (5' - 3') RRNA fluorescent-quenched dual-labeled 5'-FITC-UUUUUU-Bio-3'

[0074] 4. Obtaining of RT-RAA amplification product

[0075] Using the plasmid standard as a template, the primers designed in step 2 are used for RT-RAA amplification to obtain the RT-RAA amplification product. The RT-RAA amplification system is shown in Table 3.

[0076] Table 3. RAA amplification basic system

[0077]

[0078]

[0079] Add 41.5 μL Buffer, 2.0 μL upstream primer, 2.0 μL downstream primer to the detection unit tube containing the reaction dry powder; add 2.0 μL of the RNA sample to be tested obtained in step 1 to the detection unit tube, and then add 2.5 μL of B Buffer to the detection unit tube, cover the tube cap, mix thoroughly for 5-6 times up and down, centrifuge at low speed for 10 s (note: whether the mixing is sufficient will determine the repeatability of the test results); place the reaction unit tube in a 42°C constant temperature water bath, incubate for 1 h.

[0080] 5. Preparation of CRISPR-Cas13a detection system

[0081] Take 8.2 μL of the RAA amplification product obtained in step 3 as a template, and prepare the CRISPR-Cas13a detection system according to Table 4. The Cleavage Buffer is prepared in the laboratory, the LawCas13a protein is purchased from Bio-lifesci (http: / / www.bio-lifesci.com / ), the RT-RAA product in Table 3 is replaced with Nuclease free water, and the other components remain unchanged, i.e. the negative control.

[0082] Table 4 Cas13a detection reaction system

[0083] Cas13a detection reaction system Amount added (μL) Cleavage Buffer (400 mM Tris pH 7.4) 2 LwaCas13a protein (0.38 μM) 2 crRNA (1 μM) 2 Reporter (2 μM) 1 SUPERase-In RNase Inhibitor 1 T7 RNA polymerase (5 U / μL) 0.6 Ribonucleotide Solution 0.8 MgCl2(50 mM) 2.4 RT-RAA product 8.2 Total 20

[0084] The reaction conditions are: after mixing thoroughly, react at 37°C for 30 min, and then use blue light or ultraviolet light excitation to observe the fluorescence.

[0085] 6. Visualized detection results

[0086] Using the collateral cleavage activity of Cas13a, when containing RNA complementary to crRNA, the RNA connecting the fluorescein and fluorescence quenching group is broken, and the two are separated, at which time observable fluorescence can be emitted under blue light or ultraviolet light. The results of the present application can be read using a blue light gel instrument, and the negative control is used as a reference. The light-emitting group is observed to be positive, or the results of the reaction can be diluted to 300 μL using nuclease free water, and then a fluorescence spectrophotometer (Shimadzu Spectrofluorophotometer RF-6000) is used to detect the fluorescence intensity at an excitation wavelength of 490 nm and an emission wavelength of 520 nm. When the fluorescence intensity value of the experimental group is more than 3 times the fluorescence intensity value of the negative control, it is determined to be a positive result, or at any time the fluorescence intensity is greater than or equal to 600 a.u. (3 times the highest value that the fluorescence intensity of the negative control can reach), it is determined to be a positive result.

[0087] AsFigure 2 As shown in middle B, only when the RNA target sequence of SARS-CoV-2, the CrRNA, the Cas13a protein and the RT-RAA amplification system coexist, a visible fluorescence signal can be obtained. Figure 2 As shown in middle C, the fluorescence intensity increases with the extension of the cleavage time and approaches a plateau at about 40 minutes.

[0088] The designed crRNA of the application is shown in SEQ ID NO. 1 or SEQ ID NO. 2:

[0089] SEQ ID NO. 1: GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACaatctgagggtccaccaaacgtaatgcg;

[0090] SEQ ID NO. 2: GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACtgacttccatgccaatgcgcgacattcc.

[0091] Example 3: Determination of RT-RAA amplification time and detection temperature by CRISPR / cas13a

[0092] The crRNA designed in Example 1 was synthesized by a company, and 1 μM standard sample was used as the analyte. The system in Table 5 was added to an enzyme-free PCR tube. After the addition was completed, the PCR tube containing the prepared reaction system was placed in a fluorescence quantitative PCR instrument. The channel excitation wavelength was set to 490 nm, the emission wavelength was set to 520 nm, and the different temperatures were set to 30℃, 35℃, 37℃, 42℃ and 45℃. The fluorescence intensity value was read every 2 min, and the reading was repeated for 40 times, for a total of 80 min. Different time points were repeated for 3 groups.

[0093] The experimental results are shown in Figure 3 As shown in middle A, the LwaCas13a protein has the highest nuclease activity at 37-39℃, and subsequent experiments are selected at 37℃.

[0094] Example 4: Screening of CrRNA and determination of temperature and time

[0095] The crRNA designed in Example 1 was synthesized by the company, and 10 copies / μL of standard sample was used as the analyte. Different RT-RAA amplification times of 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min were added to enzyme-free PCR tubes according to the method in Example 2. After the sample was added, the PCR tube containing the prepared reaction system was placed in a real-time PCR instrument. The channel excitation wavelength was set to 490 nm and the emission wavelength to 520 nm. The fluorescence intensity value was read every 2 min for 60 times, for a total of 60 min. Three sets of different time points were repeated.

[0096] Table 5. Cas13a Basic Testing System

[0097] Sample Name Concentration (μM) Volume (μL) Lawcas13a 1 2 crRNA 1 1.3 Fluorescent probe 2 1.5 Target RNA 1 1 10x Buffer --- 1 Nuclease-free water --- 3.2 Total --- 10

[0098] Experimental results are as follows Figure 3 As shown in Figure B, the detection sensitivity of the detection system increases with the increase of RT-RAA amplification time. Therefore, it will be selected to use RT-RAA reaction for 60 min before the next detection step.

[0099] Example 5: Detection sensitivity of single crRNA versus two crRNAs

[0100] The standard sample was subjected to a series of dilutions to test the sensitivity of the method of the present invention. The specific steps are as follows:

[0101] 1. Serially dilute the standard sample from step 1 of Example 1 to 10. 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.

[0102] 2. Perform RT-RAA amplification according to the method in step 4 of Example 2 to obtain RT-RAA amplification products.

[0103] 3、After RT-RAA amplification, select the crRNA that reaches the plateau first in Example 2, and take 8.2 μL of the amplification product to detect the novel coronavirus nucleic acid based on the CRISPR\Cas13a system according to the method in step 6 of Example 1, and set the amplification product with water as the template as a negative control. Place the PCR tube with the prepared reaction system into a fluorescence quantitative PCR instrument, set the channel excitation wavelength to 490 nm, the emission wavelength to 520 nm, 37℃, read the value every 2 min, read 40 times for a total of 80 min, and detect the change of fluorescence intensity in the system.

[0104] 4、Mix the two CrRNAs that reach the plateau first in Example 2, and perform subsequent experiments according to step 3.

[0105] The experimental results are shown in Figure 3 , and the direct observation of fluorescence or real-time fluorescence quantification shows that the CRISPR / Cas13a detection system using N1-crRNA and N2-crRNA has reliable performance in a blue light gel cutter or a fluorescence spectrophotometer when the SARS-CoV-2 target RNA sequence is 5 to 10,000 copies. It is worth noting that when N1-crRNA-1 and N2-crRNA-1 are added at the same time, more stable fluorescence values can be obtained.

[0106] Example 6 Detection specificity of the application

[0107] 1、Synthesize the N gene fragments of Zika, H1N1, DENV, JEV, TBEV, and HSV-1. Together with clinical samples, detect according to the established detection method, and compare whether the method can cross-detect other coronaviruses.

[0108] 2、After RAA amplification, take 8.2 μL of the amplification product to detect the nucleic acid of each virus based on the CRISPR / Cas13a system according to the method in Example 2, and set the amplification product with water as the template as a negative control.

[0109] The detection results are shown in Figure 4 B-D, only the SARS-Cov-2 tube detects fluorescence, indicating that the CRISPR / Cas13a system has high specificity for different pathogen nucleic acids.

[0110] Example 7 Verification of the accuracy and detection limit of the method compared with the RT-qPCR method

[0111] The method reported in the literature (Preclinical Diagnosis of African Swine Fever in Contact-Exposed Swine by a Real-Time PCR Assay) was used, and the reaction conditions, reaction system, and primers were referred to the above-mentioned literature. The primers and probes for detecting the novel coronavirus by Real-Time RT-PCR were synthesized in vitro and provided by the Respiratory Virus Disease Prevention and Control Center of the U.S. Viral Disease Department. The primer and probe sequences are as follows:

[0112] Table 6 RT-qPCR primers and probes

[0113] Name Sequence Tag 2019-nCoV_N1-F 5'-GACCCCAAAATCAGCGAAAT-3' None 2019-nCoV_N1-R 5'-TCTGGTTACTGCCAGTTGAATCTG-3' None 2019-nCoV_N1-P 5'-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3' FAM, BHQ-1 2019-nCoV_N2-F 5'-TTACAAACATTGGCCGCAAA-3' None 2019-nCoV_N2-R 5'-GCGCGACATTCCGAAGAA-3' None 2019-nCoV_N2-P 5'-FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1-3' FAM, BHQ-1

[0114] Ten clinical samples were detected by RT-qPCR and the method at the same time, and the detection rates of the two methods were compared.

[0115] Table 7 qPCR settings

[0116]

[0117] Fluorescence data should be collected during the 55°C incubation phase.

[0118] Table 8 TaqPath TM 1-Step RT-qPCR Master Mix

[0119] Step Reagent Vol. of Reagent Added per Reaction 1 Nuclease-free Water Nx 13.5 μL 2 Combined Primer / Probe Mix Nx 1.5 μL 3 TaqPath™ 1-Step RT-qPCR Master Mix (4x) Nx 5.0 μL Total Volume Nx 20.0 μL

[0120] N is the number of samples detected. After adding 20 μL of Mix to each PCR tube, add 5 μL of sample to be tested. After adding the sample, centrifuge it with a low-speed centrifuge for 10 s, and then place it in the fluorescence quantitative qPCR. Set up and detect according to Table 7.

[0121] Further dilute the clinical samples and see the detection limit of the two methods.

[0122] The experimental results are shown in Figure 5 A total of 10 unidentified clinical weakly positive swab RNA samples were detected. To ensure the reliability of the detection, each sample was detected twice in three independent analyses. Within 60 minutes, all 3 COVID-19 positive samples were identified as SARS-CoV-2 positive by CRISPR / Cas13a detection, and the endpoint visual detection also confirmed this Figure 5Middle A). With negative control as control, green fluorescence group is positive, or dilute the reaction results to 300 μL with nuclease-free water, then detect with fluorescence spectrophotometer (Shimadzu Spectrofluorophotometer RF-6000) at excitation 490 nm, emission 520 nm. When the fluorescence intensity value of the experimental group is more than 3 times higher than that of the negative control group, or when the fluorescence intensity is greater than or equal to 600 μa (the fluorescence intensity of the negative control) or 3 times the maximum fluorescence intensity of the negative control, it can be determined as a positive result Figure 5 Middle B). In addition, the CRISPR detection results of the present application are consistent with the CDC-approved RT-qPCR method Figure 5 Middle C). Therefore, the CRISPR method of the present application provides a simple, fast and intuitive method for SARS-CoV-2 detection, and has the potential to develop a COVID-19 diagnostic method without instruments.

[0123] Obviously, the above embodiments of the present application are only examples for the purpose of clear illustration, and are not intended to limit the embodiments of the present application. Based on the above description, other different forms of changes or variations can also be made by those skilled in the art. Here, it is not necessary and impossible to exhaust all the embodiments. Any modification, equivalent replacement and improvement made within the spirit and principles of the present application shall be included in the protection scope of the claims of the present application.

Claims

1. A method for detecting SARS-CoV-2 for non-disease detection or therapeutic purposes, characterized by, The method comprises the following steps: using the RAA amplification primer group to perform amplification reaction on the template of the sample DNA to be tested, and then using the CRISPR-Cas13a detection system to perform enzyme cutting reaction on the amplification product, and judging whether the sample to be tested contains SARS-CoV-2 according to the fluorescence color after the reaction is completed; the RAA amplification primer group consists of an upstream primer as shown in SEQ ID NO. 3 and a downstream primer as shown in SEQ ID NO. 4; or consists of an upstream primer as shown in SEQ ID NO. 5 and a downstream primer as shown in SEQ ID NO. 6; the CRISPR-Cas13a detection system comprises CrRNA and Cas13a protein; the nucleotide sequence of the CrRNA is shown in SEQ ID NO. 1 or SEQ ID NO.

2.

2. The detection method according to claim 1, characterized in that, The fluorescence color is observed under blue light or ultraviolet excitation after the reaction is completed.

3. The detection method according to claim 2, characterized in that, The judgment of whether the sample to be tested contains SARS-CoV-2 is specifically: reading with a blue light gel cutter, taking the negative control as a reference, and observing that the light-emitting group is positive; or diluting the reaction results to 300 µL with nuclease free water, and then detecting the fluorescence intensity at an excitation light of 490 nm and an emission light of 520 nm with a fluorescence spectrophotometer, when the fluorescence intensity value of the experimental group is more than 3 times higher than that of the negative control, it is determined as a positive result; or the fluorescence intensity is greater than or equal to 600a.u. at any time, which is determined as a positive result.

4. The method of claim 1, wherein, The reaction system of the amplification reaction is 50 µL, which comprises: reaction dry powder 1 tube, A Buffer 41.5 µL, Forward primer 2 µL, Reverse primer 2 µL, RNA sample 2 µL and B Buffer 2.5 µL; the reaction condition is: after being fully mixed, incubating at 42℃ for 1h.

5. The method of claim 1, wherein The reaction system of the enzyme cutting reaction is 20 µL, which comprises: Cleavage Buffer 2 µL, LwaCas13a protein 2 µL, crRNA 2 µL, Reporter 1 µL, SUPERase•In RNase Inhibitor 1 µL, 5 U / µL T7 RNA polymerase 0.6 µL, Ribonucleotide Solution 0.8 µL, MgCl2 2.4 µL and amplification product 8.2 µL; the reaction condition is: reacting at 37℃ for 30min.

6. A product for detecting SARS-CoV-2, characterized in that, The method comprises the following steps: the RAA amplification primer group consists of an upstream primer as shown in SEQ ID NO. 3 and a downstream primer as shown in SEQ ID NO. 4; or consists of an upstream primer as shown in SEQ ID NO. 5 and a downstream primer as shown in SEQ ID NO. 6; The CRISPR-Cas13a detection system comprises a CrRNA and a Cas13a protein; the nucleotide sequence of the CrRNA is shown in SEQ ID NO. 1 or SEQ ID NO.

2. The CRISPR-Cas13a detection system comprises a CrRNA and a Cas13a protein; the nucleotide sequence of the CrRNA is shown in SEQ ID NO. 1 or SEQ ID NO.

2. The CRISPR

Images