A molecular marker closely linked to relative root length in wheat and application thereof
By developing molecular markers that are tightly linked to the relative root length of wheat, and using PCR amplification and fluorescently labeled primer sets to detect wheat root length, the problem of selecting varieties with longer root systems in existing technologies has been solved, realizing a rapid and accurate breeding method that improves wheat yield and stress resistance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- QINGDAO AGRI UNIV
- Filing Date
- 2024-09-26
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies make it difficult to quickly and accurately select and cultivate wheat varieties with longer root systems, which affects their ability to absorb water and nutrients, and consequently their yield and stress resistance.
A molecular marker closely linked to the relative root length of wheat was developed. By utilizing a base variation at position 530103940 on chromosome 7 of the Chinese spring wheat reference genome, wheat root length was detected by PCR amplification and fluorescently labeled primer set, providing a method for predicting the relative root length of wheat.
This method enables the rapid and accurate screening of wheat varieties with longer root systems, improving breeding efficiency, enhancing wheat's adaptability to drought and infertile soils, and increasing yield and stability.
Smart Images
Figure CN119040508B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker breeding technology, specifically relating to a molecular marker closely linked to the relative root length of wheat and its application. Background Technology
[0002] The root system is a crucial part of wheat's growth and development, responsible for absorbing water and nutrients from the soil. Root length directly affects wheat's ability to absorb water and nutrients. Studies have shown that root depth and length are closely related to wheat yield. For example, the heading stage is a critical period directly impacting yield; root depth during this stage directly affects wheat's absorption of water and nutrients from deeper soil layers, ultimately affecting yield and stress resistance. Furthermore, root length also influences the range of nutrients wheat can absorb from the soil, thus affecting its growth status and final yield. Therefore, breeding wheat varieties with relatively longer roots is of great significance for improving wheat yield and stress resistance.
[0003] Molecular marker breeding is a novel breeding method that utilizes the close linkage between molecular markers and genes that determine target traits. By detecting molecular markers, the presence of the target gene can be detected, thus achieving the goal of selecting the target trait. It has the advantages of being fast, accurate, and unaffected by environmental conditions.
[0004] Researching molecular markers closely linked to wheat root length can help improve wheat growth and productivity. By identifying and utilizing these markers, the breeding process can be accelerated, allowing for the selection of varieties with longer root systems. This improves water and nutrient absorption, enhancing wheat's adaptability to drought and poor soils. Ultimately, this contributes to increased wheat yield and stability, which is of great significance to agricultural production. Summary of the Invention
[0005] To address the problems existing in the prior art, the purpose of this invention is to provide a molecular marker closely linked to the relative root length of wheat and its application.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A molecular marker closely linked to the relative root length of wheat, located at position 530103940 on chromosome 7 of the Chinese spring wheat reference genome sequence RefSeq v2.1, indicates that when the base at this site is G, the relative root length of wheat is longer; when the base at this site is C, the relative root length of wheat is shorter.
[0008] The above-mentioned molecular markers closely linked to wheat relative root length are used in predicting wheat relative root length and / or in preparing reagents for predicting wheat relative root length.
[0009] A primer set was used to amplify the molecular markers that are closely linked to the relative root length of wheat, the primer set comprising two front primers shown in SEQ ID NO:1 and SEQ ID NO:2 and one back primer shown in SEQ ID NO:3.
[0010] Based on the above scheme, different fluorescent labels were set at the 5' ends of the two front primers.
[0011] The above primer set is used in predicting relative root length of wheat and / or in preparing reagents for predicting relative root length of wheat.
[0012] A method for predicting the relative root length of wheat involves using the genomic DNA of the wheat to be tested as a template and performing PCR amplification with the primer set described above. When the base at position 20 of the amplification product sequence is G, the relative root length of the wheat to be tested is relatively long; when the base at position 20 of the amplification product sequence is C, the relative root length of the wheat to be tested is relatively short.
[0013] Based on the above scheme, different fluorescent labels were set at the 5' ends of the two front primers; after PCR amplification, the data were read using fluorescence typing software.
[0014] A kit for predicting relative root length in wheat, comprising a primer set for amplifying the aforementioned molecular markers.
[0015] The advantages of this invention are:
[0016] (1) This invention develops a molecular marker that is closely linked to the relative root length of wheat. The molecular marker of this invention is derived from the genetic variation analysis of the TaHKT2;7-D gene in natural wheat populations, providing unique genetic information and providing a new tool for wheat breeding.
[0017] (2) By applying the molecular markers developed in this invention, the relative root length of wheat can be predicted, which not only saves costs but also greatly improves selection efficiency, accelerates the breeding process, and provides new possibilities for the efficient screening of superior alleles of the TaHKT2;7-D gene and the breeding of salt-tolerant and drought-resistant wheat varieties. Attached Figure Description
[0018] Figure 1 Genotyping results of the tested wheat varieties read by fluorescence genotyping software;
[0019] Figure 2 The results of the comparison of relative root lengths of different genotypes of the tested wheat varieties ("*" indicates significant differences). Detailed Implementation
[0020] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. The following embodiments are merely illustrative and are not intended to limit the scope of the invention in any way.
[0021] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the experimental materials, reagents, and chemicals used in the following embodiments can be obtained through general channels.
[0022] Example 1
[0023] A molecular marker closely linked to the relative root length of wheat is located at position 530103940 on chromosome 7 of the Chinese spring wheat reference genome sequence RefSeq v2.1. When the base at this site is G, the genotype of wheat is TaHKT2;7-D-Hap I, with a relatively long root length; when the base at this site is C, the genotype of wheat is TaHKT2;7-D-Hap II, with a relatively short root length.
[0024] Example 2
[0025] The primer set for detecting the molecular marker described in Example 1 includes two front primers shown in SEQ ID NO:1 and SEQ ID NO:2 and one back primer shown in SEQ ID NO:3; the 5' ends of the two front primers are respectively provided with different fluorescent labels, the specific sequences of which are as follows:
[0026] Allele-specific primer 1-FAM: 5'-FAM-GCCGACAAATGAGAACATGG-3' (SEQ ID NO: 1); Allele-specific primer 2-HEX: 5'-HEX-GCCGACAAATGAGAACATGC-3' (SEQ ID NO: 2); Common, reverse primer: 5'-GGAACAATGTATTGCCTGCGA-3' (SEQ ID NO: 3).
[0027] The nucleic acid sequences amplified by the Allele-specific primer 1-FAM and the Common, reverse primer are shown in SEQ ID NO:4.
[0028] SEQ ID NO:4(5'→3')
[0029] GCCGACAAATGAGAACATGGTCATCTTCTCAAAGAATTCAGGCCTCTTGCTGCTGC TCAGTGGCCAGATGCTCGCAGGCAATACATTGTTCC
[0030] The nucleic acid sequences amplified by the Allele-specific primer 2-HEX and the Common, reverse primer are shown in SEQ ID NO:5.
[0031] SEQ ID NO:5 (5'→3')
[0032] GCCGACAAATGAGAACATGCTCATCTTCTCAAAGAATTCAGGCCTCTTGCTGCTGC TCAGTGGCCAGATGCTCGCAGGCAATACATTGTTCC
[0033] Example 3
[0034] Example 1: Molecular markers and Example 2: Primer sets used for the identification of relative root length in wheat
[0035] (1) Extract genomic DNA from wheat seedling leaves to be tested; the extraction method can be existing methods, or the following methods can be used:
[0036] ① Place a 2cm wheat leaf sample and a 6mm steel ball in a 1.5mL centrifuge tube, freeze quickly in liquid nitrogen, and then grind.
[0037] ② Add 600 μL of CTAB to dissolve the DNA significantly, and incubate in a 65°C water bath for 30 minutes, shaking gently every 10 minutes during this period.
[0038] ③ Add 600 μL (equal volume to CTAB) of chloroform-isoamyl alcohol solution prepared in a 24:1 ratio to the fume hood and shake gently for 1 min.
[0039] ④ Centrifuge at 10,000 rpm for 10 minutes in a room temperature centrifuge.
[0040] ⑤ Take 450 μL of the supernatant, add 450 μL (equal volume to the supernatant) of isopropanol frozen at -20°C and mix gently. At this point, a white flocculent precipitate will appear.
[0041] ⑥ Let it stand at 4℃ for 30 minutes, or at -20℃ for 20 minutes.
[0042] ⑦ Centrifuge at 10,000 rpm for 10 minutes at 4℃.
[0043] ⑧ Take 150 μL of 75% ethanol to wash the precipitate twice. Each time, gently shake the precipitate by hand and centrifuge at 8000 rpm for 2 min at room temperature.
[0044] ⑨ Discard the supernatant, use medium and small pipette tips to remove the remaining liquid, and place it in a fume hood to blow until it becomes a gel-like substance.
[0045] ⑩ Dissolve the DNA in 100 μL of ddH2O, then freeze and store at -20°C for later use.
[0046] (2) Using the genomic DNA extracted from the wheat sample to be tested as a template, PCR amplification was performed using the primer set of Example 2.
[0047] The PCR reaction system consisted of 5 μL of genomic DNA (50 ng / μL) from the wheat sample to be tested, 5 μL of HiGeno 2x ProbeMix (Beijing Jiacheng Biotechnology Co., Ltd.), and 0.14 μL of SNP-Specific Primers, with ddH2O added to bring the total volume to 10 μL. The SNP-Specific Primers were prepared as follows: 12 μL of 100 μM Allele-specific primer 1-FAM, 12 μL of 100 μM Allele-specific primer 2-HEX, and 30 μL of 100 μM common reverse primer were mixed, and ddH2O was added to bring the total volume to 100 μL.
[0048] The PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61–55℃ for 40 s, 10 cycles, decreasing the temperature by 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, 28 cycles. Store at 4℃.
[0049] (3) PCR reactions were performed on an S1000 TMThermal Cycler PCR instrument (Bio-Rad Laboratories Inc.).
[0050] After the reaction, the obtained PCR amplification products were genotyped based on fluorescence signals using a real-time quantitative instrument (QuantStudio 3 Real-Time PCR System). The PCR amplification products were scanned with FAM excitation at 485 nm and emission at 520 nm; HEX excitation at 535 nm and emission at 556 nm; and the system reference fluorescence ROX excitation at 575 nm and emission at 610 nm. The genotyping data were then read using fluorescence genotyping software (QuantStudio Design & Analysis Software).
[0051] Specifically: The PCR amplification products of the Allele-specific primer 1-FAM and the Common, reverse primer carrying the fluorescent sequence FAM were analyzed by software and indicated by red dots, indicating that the DNA sample to be tested was TaHKT2; 7-D-Hap I type; the wheat sample had a relatively long root length.
[0052] The PCR amplification products of the Allele-specific primer 2-HEX and the Common, reverse primer carrying the fluorescent sequence HEX were analyzed by software and represented by blue dots, indicating that the DNA sample to be tested was TaHKT2; 7-D-Hap II type; the wheat sample had a relatively short root length.
[0053] Example 4
[0054] Example 1: Molecular marker detection of genotype in actual wheat samples
[0055] The method described in Example 3 was used to test 296 wheat samples, and the genotyping results of the TaHKT2;7-D gene in the wheat samples are shown in Table 1.
[0056] Table 1. Genotyping results of the TaHKT2;7-D gene in 296 natural wheat populations.
[0057]
[0058]
[0059]
[0060]
[0061] Note: HapⅠ represents TaHKT2; 7-D-Hap I type; HapⅡ represents TaHKT2; 7-D-Hap II type.
[0062] The fluorescence typing software (QuantStudio Design & Analysis Software) reads the typing results of some wheat samples in Table 1, as shown below. Figure 1 As shown, red dots indicate that the DNA sample to be tested is TaHKT2; 7-D-Hap I type, and blue dots indicate that the sample to be tested is TaHKT2; 7-D-Hap II type.
[0063] The results of relative root length detection in wheat with two different genotypes, TaHKT2;7-D-Hap I and TaHKT2;7-D-Hap II, are as follows: Figure 2 As shown, haplotype TaHKT2;7-D-Hap I has a larger relative root length compared to haplotype TaHKT2;7-D-Hap II.
[0064] The above results demonstrate that the genotyping results of the molecular markers of this invention are excellent and completely consistent with the haplotype prediction results based on network data and laboratory resequencing results of 103 wheat samples. This indicates that the molecular markers of this invention can be further applied to the detection of breeding materials.
[0065] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. The application of molecular markers closely linked to relative root length in wheat in predicting relative root length, characterized in that, The molecular marker is located at position 530103940 on chromosome 7 in the Chinese spring wheat reference genome sequence RefSeq v2.
1. When the base at this site is G, the relative root length of wheat is longer; when the base at this site is C, the relative root length of wheat is shorter.
2. The application of primer sets amplifying molecular markers closely linked to wheat relative root length in predicting wheat relative root length and / or preparing reagents for predicting wheat relative root length, characterized in that, The molecular marker is located at position 530103940 on chromosome 7 in the Chinese spring wheat reference genome sequence RefSeq v2.
1. When the base at this site is G, the relative root length of wheat is longer; when the base at this site is C, the relative root length of wheat is shorter. The primer set includes two front primers shown in SEQ ID NO:1 and SEQ ID NO:2 and one back primer shown in SEQ ID NO:
3.
3. The application according to claim 2, characterized in that, The 5' ends of the two front primers are each labeled with a different fluorescent marker.
4. A method for predicting the relative root length of wheat, characterized in that, Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using a primer set that amplifies molecular markers closely linked to the relative root length of wheat. When the base at position 20 of the amplification product sequence is G, the relative root length of the wheat to be tested is relatively long; when the base at position 20 of the amplification product sequence is C, the relative root length of the wheat to be tested is relatively short. The primer set includes two front primers shown in SEQ ID NO:1 and SEQ ID NO:2 and one back primer shown in SEQ ID NO:
3.
5. The method for predicting the relative root length of wheat according to claim 4, characterized in that, The 5' ends of the two front primers were each labeled with a different fluorescent marker; after PCR amplification, the data were read using fluorescence typing software.