Preparation of 10-shogaol nanoliposomes and their application in the treatment of septic lung injury

Abstract

This invention discloses the preparation of 10-shogaol nanoliposomes and their application in the treatment of septic lung injury, relating to the field of pharmaceutical technology. The 10-shogaol nanoliposomes provided by this invention are prepared under controlled drug-lipid ratio conditions, thus exhibiting excellent encapsulation efficiency and drug loading. Furthermore, these liposomes possess good biocompatibility, safety, stability, and therapeutic efficacy, and can be used for targeted treatment of LPS-induced septic lung injury, reducing pulmonary edema, alleviating H2O2-induced oxidative stress, and decreasing the expression levels of pro-inflammatory factors IL-6, iNOS, and TNF-α.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to the preparation of 10-shogaol nanoliposomes and their application in the treatment of septic lung injury. Background Technology

[0002] Acute lung injury (ALI) is a common clinical syndrome of diffuse lung inflammation, characterized by decreased lung volume, reduced lung compliance, and severe ventilation / perfusion mismatch. Clinically, it manifests as progressive hypoxemia and respiratory distress, with heterogeneous exudative lesions on pulmonary imaging. When lung damage in ALI progresses to a certain extent, it can easily lead to acute respiratory distress syndrome (ARDS). The pathogenesis of ALI is complex, and the mortality rate is as high as 30%–50%. Therefore, there is an urgent need to develop drugs with good efficacy against ALI.

[0003] Current research indicates that gingerol possesses certain anti-inflammatory activity in in vitro cell experiments, with 6-gingerol demonstrating therapeutic effects against ALI. However, the efficacy of 10-gingerol in treating ALI remains to be explored. Furthermore, as this compound is hydrophobic, improving its solubility and bioavailability in the human body to better exert its therapeutic effect on ALI is a major challenge that urgently needs to be addressed. Summary of the Invention

[0004] To address the above problems, this invention provides the preparation of 10-shogaol nanoliposomes and their application in treating septic lung injury.

[0005] According to one aspect of the present invention, a 10-shogaol nanoliposome is provided, comprising the active ingredient 10-shogaol and liposomes encapsulating the active ingredient 10-shogaol, wherein the mass ratio of the active ingredient 10-shogaol to the liposomes is 1:(3~10); the liposomes are prepared from DPPC, cholesterol and DSPE-mPEG2000, wherein the molar ratio of DPPC, cholesterol and DSPE-mPEG2000 is (75~80):(18~22):3.

[0006] The 10-shogaol nanoliposomes provided by this invention, by adjusting the drug-liposome ratio (mass ratio of the original drug 10-shogaol to the liposomes) and the proportion of each component in the liposomes, yielded liposomes with excellent encapsulation efficiency and drug loading. The resulting 10-shogaol nanoliposomes have good biocompatibility, safety, stability and therapeutic efficacy, and can be used for targeted treatment of LPS-induced septic lung injury, reducing pulmonary edema, alleviating H2O2-induced oxidative stress, and reducing the expression levels of pro-inflammatory factors IL-6, iNOS and TNF-α.

[0007] In some embodiments, the mass ratio of the active ingredient 10-shogaol to liposomes is 1:(4~6).

[0008] In some embodiments, the drug loading of 10-shogaol nanoliposomes is 7-16%.

[0009] In some embodiments, the 10-shogaol nanoliposomes encapsulate 60-80% of 10-shogaol.

[0010] In some embodiments, the 10-shogaol nanoliposomes are spherical with an average diameter of 126±5 nm.

[0011] In some embodiments, the zeta potential of the 10-shogaol nanoliposomes is -22±3 mV.

[0012] According to another aspect of the present invention, a method for preparing 10-shogaol nanoliposomes is provided, comprising the following steps:

[0013] S1. Dissolve DPPC, cholesterol, DSPE-mPEG2000 and 10-shogaol in a solvent, and remove the solvent by rotary evaporation to obtain a film;

[0014] S2. Add an aqueous medium to the film obtained in step S1 to hydrate it and obtain a suspension. Then place it on ice for sonication. After sonication, 10-shogaol nanoliposomes can be obtained.

[0015] In some embodiments, the solvent used in step S1 is chloroform.

[0016] In some embodiments, the amounts of DPPC, cholesterol, DSPE-mPEG2000 and 10-shogaol added in step S1 are 44 mg, 6 mg, 2 mg and 10 mg, respectively.

[0017] In some embodiments, the amount of solvent used in step S1 is 5 mL.

[0018] In some implementations, the rotary evaporation in step S1 is carried out at a pressure of 230 mbar.

[0019] In some embodiments, the rotary evaporation in step S1 is carried out at a temperature of 40°C.

[0020] In some implementations, the aqueous medium used in step S2 is PBS buffer.

[0021] In some embodiments, the amount of aqueous medium added in step S2 is 5 mL.

[0022] In some implementations, hydration in step S2 is carried out at a temperature of 60°C.

[0023] In some embodiments, hydration in step S2 is carried out under stirring conditions, with the stirring speed being 300 rpm.

[0024] In some implementations, the hydration time in step S2 is 30 min.

[0025] In some implementations, the power of the ultrasound in step S2 is 15-25%.

[0026] It should be noted that the ultrasonic power mentioned above as 15-25% refers to the ultrasonic power being 15-25% of the instrument's maximum power.

[0027] In some implementations, the ultrasound pattern in step S2 is to perform ultrasound for 15 seconds followed by a 15-second pause.

[0028] In some implementations, the ultrasound time in step S2 is 15 to 45 minutes.

[0029] In some implementations, step S2, after ultrasound, further includes steps of filtration, ultrafiltration, and volume adjustment.

[0030] In some embodiments, the filtration process involves collecting the ultrasonically dispersed suspension, filtering it through a 0.22 μm filter, and collecting the filtrate. The purpose of this filtration step is to remove large, undispersed clumps.

[0031] In some embodiments, the ultrafiltration process involves transferring the filtrate to a 100,000 MWCO ultrafiltration tube and centrifuging at 3,000 rpm for 1 h. The purpose of this ultrafiltration step is to remove residual solvent and free 10-shogaol monomer.

[0032] In some embodiments, the above volume adjustment is performed by using PBS buffer to adjust the volume of the 10-shogaol nanoliposomes in the ultrafiltration tube to 3 mL for later use.

[0033] According to another aspect of the invention, the use of 10-shogaol nanoliposomes in the preparation of a medicament for treating septic lung injury is provided.

[0034] According to another aspect of the present invention, the use of 10-shogaol nanoliposomes in the preparation of medicaments for treating H2O2-induced oxidative stress is provided.

[0035] The 10-shogaol nanoliposomes provided by this invention can reduce the levels of reactive oxygen species, superoxide dismutase activity and malondialdehyde (MDA) in cells, and therefore can be used to alleviate H2O2-induced oxidative stress.

[0036] According to another aspect of the present invention, the use of 10-shogaol nanoliposomes in the preparation of anti-inflammatory drugs is provided.

[0037] The 10-shogaol nanoliposomes provided by this invention can reduce the expression levels of pro-inflammatory factors IL-6, iNOS and TNF-α, and therefore can also be used to prepare anti-inflammatory drugs.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] This invention obtains 10-shogaol nanoliposomes with excellent drug loading and encapsulation efficiency by adjusting the drug-liposome ratio and the proportion of each component in the liposome. These liposomes can target the lungs, reduce the expression levels of inflammatory factors such as IL-6, iNOS and TNF-α, alleviate H2O2-induced oxidative stress, and treat septic lung injury caused by LPS. Attached Figure Description

[0040] Figure 1 This is a transmission electron microscope and particle size comparison diagram of different groups of liposomes in this invention;

[0041] Figure 2 This is a schematic diagram comparing the ZETA potentials of different groups of liposomes in this invention;

[0042] Figure 3 This is a schematic diagram showing the 7-day particle size distribution and PDI comparison of different groups of liposomes in this invention;

[0043] Figure 4 This invention illustrates the effect of different concentrations of different groups on the viability of HUVEC cells.

[0044] Figure 5 The effect of different concentrations of different groups of the present invention on the viability of RAW 264.7 cells;

[0045] Figure 6 This invention illustrates the effect of different concentrations of different groups on the viability of A549 cells.

[0046] Figure 7 This is a schematic diagram illustrating the effect of different working concentrations of the present invention on the activity / toxicity of HUVECs;

[0047] Figure 8 This is a schematic diagram illustrating the effect of different working concentrations of the present invention on the activity / toxicity of A549 cells;

[0048] Figure 9 This is a schematic diagram illustrating the compatibility of different concentrations of different groups of the present invention with blood;

[0049] Figure 10This invention relates to the effects of different groups on the mRNA expression levels of pro-inflammatory factors IL-6, IL-1β, and TNF-α in RAW264.7 cells treated with LPS.

[0050] Figure 11 This invention illustrates the effect of different groups on reactive oxygen species levels in H2O2-induced oxidative stress.

[0051] Figure 12 The effects of different groups of this invention on superoxide dismutase activity in H2O2-induced oxidative stress;

[0052] Figure 13 The effect of different groups of this invention on malondialdehyde levels in H2O2-induced oxidative stress;

[0053] Figure 14 The effects of different groups of this invention on lung and other tissue pathological damage in mice with LPS-induced septic lung injury;

[0054] Figure 15 This invention describes the effects of different groups on the lung index of mice with LPS-induced septic lung injury.

[0055] Figure 16 This invention investigates the effects of different groups on the mRNA expression levels of pro-inflammatory factors IL-6, IL-1β, and TNF-α in the lung tissue of mice with LPS-induced septic lung injury. Detailed Implementation

[0056] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following examples are all commercially available.

[0057] Example 1

[0058] A method for preparing 10-shogaol nanoliposomes includes the following steps:

[0059] S1. Weigh out 44 mg of DPPC, 6 mg of cholesterol, and 2 mg of DSPE-mPEG2000 in a molar ratio of 77:20:3 and add them to a 500 mL round-bottom flask. Dissolve 10 mg of 10-shogaol in chloroform and add it to the round-bottom flask. After mixing, the total volume of chloroform in the round-bottom flask is 5 mL. Perform rotary evaporation at 40 °C and 230 mbar until all the chloroform has evaporated and a thin film has formed on the wall of the round-bottom flask. The mass ratio of 10-shogaol to liposomes used is 1:5.2.

[0060] S2. Add 5 mL of PBS buffer to the round-bottom flask from step S1. Stir at 300 rpm at 60°C for 30 min on a magnetic stirrer until the membrane is completely hydrated to obtain a liposome suspension. Transfer the liposome suspension to a 20 mL sample vial and sonicate on ice at 20% power. The sonication mode is 15 s sonication followed by a 15 s pause, repeated for 30 min. Collect the sonicated suspension and filter it through a 0.22 μm filter. Transfer the filtrate to a 100,000 MWCO ultrafiltration tube and centrifuge at 3000 rpm for 1 h. Adjust the volume of the 10-shogaol nanoliposomes in the ultrafiltration tube to 3 mL using PBS buffer for later use.

[0061] The 10-shogaol nanoliposomes obtained in this embodiment are designated SA-Lipo. Characterization of the 10-shogaol nanoliposomes revealed a drug loading of 13.5% and an encapsulation efficiency of 78.4% for 10-shogaol. The 10-shogaol nanoliposomes were spherical with an average diameter of 126.03 nm. Figure 1 As shown; the Zeta potential of 10-shogaol nanoliposomes is -22.14 mV, as... Figure 2 As shown.

[0062] The method for determining the drug loading of 10-shogaol nanoliposomes in this embodiment includes the following steps:

[0063] The 10-shogaol nanoliposome solution obtained in step S2 was diluted in acetonitrile at a ratio of 1:10. The solution was ultrasonically broken up for 1 h to release the 10-shogaol encapsulated in the liposomes. The solution was collected and centrifuged at 12000 rpm for 10 min. The supernatant was taken and the highest absorption peak of the drug was detected by a UV spectrophotometer to determine the optimal absorption wavelength (281.5 nm) and the OD value of the drug. The drug concentration of SA-Lipo was calculated based on the standard curve.

[0064] Example 2

[0065] A method for preparing 10-shogaol nanoliposomes, wherein the only difference from Example 1 is:

[0066] In step S1, the mass ratio of 10-shogaol to liposomes is 1:7.8, wherein the mass of 10-shogaol is 10 mg, and the mass of DPPC, cholesterol, and DSPE-mPEG are 66 mg, 9 mg, and 3 mg, respectively.

[0067] Example 3

[0068] A method for preparing 10-shogaol nanoliposomes, wherein the only difference from Example 1 is:

[0069] In step S1, the mass ratio of 10-shogaol to liposomes is 1:4.2, wherein the mass of 10-shogaol is 10 mg, and the mass of DPPC, cholesterol, and DSPE-mPEG are 35.2 mg, 4.8 mg, and 1.6 mg, respectively.

[0070] Characterization of the 10-shogaol nanoliposomes obtained in Examples 1-3 revealed that, while maintaining a 10 mg dosage of 10-shogaol, different drug-liposome ratios resulted in variations in encapsulation efficiency and drug loading, as shown in Table 1 below. The liposomes obtained at a drug-liposome ratio of 1:5.2 (Example 1) exhibited the highest encapsulation efficiency.

[0071] Table 1. Drug loading, drug loading rate, and encapsulation efficiency of the liposomes obtained in Examples 1-3

[0072]

[0073] Comparative Example 1

[0074] A method for preparing nanoliposomes, wherein the only difference from Example 1 is:

[0075] 10-Shogaol is not added in step S1.

[0076] The nanoliposomes obtained in this comparative example are denoted as Lipo.

[0077] The liposomes obtained in Example 1 and Comparative Example 1 were characterized, and the experimental results are as follows: Figures 1-2 As shown, the size of Lipo ranges from 126 to 158 nm, and the size of SA-Lipo ranges from 109 to 158 nm. The average sizes of Lipo and SA-Lipo are approximately 127.87 nm and 126.03 nm, respectively. Zeta potentials show that both Lipo and SA-Lipo are negatively charged, with average potentials of -12.43 mV and -22.14 mV, respectively. Transmission electron microscopy observations show that Lipo and SA-Lipo have relatively uniform spherical morphologies, and their diameters are within the range measured by DLS.

[0078] Take 1 mL of Lipo and SA-Lipo suspensions respectively, add 9 mL of ultrapure water to dilute the suspensions 10 times, and use the DLS method of a particle size analyzer to detect the size distribution and dispersion index (PDI) of Lipo and SA-Lipo for 7 consecutive days.

[0079] Figure 3The results showed that the size and PDI of Lipo and SA-Lipo were stable at around 120 nm and 0.2, respectively, indicating that the SA-Lipo provided by this invention has good stability characteristics for at least one week.

[0080] Pharmacological effects of 10-shogaol nanoliposomes investigated

[0081] Below, cell and animal experiments were conducted using the 10-shogaol nanoliposome SA-Lipo prepared in Example 1, the nanoliposome Lipo in Comparative Example 1, and the free 10-shogaol monomer 10-Shogaol (denoted as SA) to explore their pharmacological effects.

[0082] I. Cell experiments and related indicator measurements

[0083] 1. Biosafety assessment

[0084] 1) Effects of different concentrations of SA-Lipo on the viability of HUVEC cells

[0085] The cytotoxicity of the drug was determined using the Cell Counting Kit-8 (CCK-8) assay kit (Jingxin Biotechnology, #GxCK08). HUVEC cells were cultured at 4 × 10⁻⁶ cells per cell line. 3 Cells were seeded at a density in 96-well plates and cultured for 24 h. Cells were then treated with DMEM medium (containing 10% FBS, i.e., 10% fetal bovine serum) containing different concentration gradients of Lipo, SA, and SA-Lipo. After 24 h, the supernatant was discarded, and 10 μL of CCK8 solution and 100 μL of DMEM medium were added to each well. The plates were incubated in the dark for 1–2 h, and the absorbance was measured at 450 nm.

[0086] Figure 4 The results showed that, within the concentration range of 0.5-8 μM, the SA-Lipo of the present invention had almost no effect on cell viability, and at 8 μM, cell viability was better than that of the free monomer group.

[0087] 2) Effects of different concentrations of SA-Lipo on the viability of RAW264.7 cells

[0088] The cytotoxicity of the drug was determined using a CCK-8 assay kit. RAW 264.7 cells were cultured at 1 × 10⁻⁶ cells / year. 4 Cells were seeded at a density of / wells in 96-well plates and cultured for 24 hours. Cells were then treated with DMEM medium containing different concentration gradients of Lipo, SA, and SA-Lipo. After 24 hours, the supernatant was discarded, and 10 μl of CCK8 solution and 100 μl of DMEM medium were added to each well. The plates were then incubated in the dark for 1–2 hours, and the absorbance was measured at 450 nm.

[0089] Figure 5 The results showed that, within the concentration range of 0.5-8 μM, the SA-Lipo of this invention had almost no effect on the viability of RAW264.7 cells.

[0090] 3) Effects of different concentrations of SA-Lipo on the viability of A549 cells

[0091] The cytotoxicity of the drug was determined using CCK-8 assay. A549 was administered at 4 × 10⁻⁶. 3 Cells were seeded at a density in 96-well plates and cultured for 24 h. Cells were then treated with DMEM medium (containing 10% FBS) with different concentration gradients of Lipo, SA, and SA-Lipo. After 24 h, the supernatant was discarded, and 10 μl of CCK8 solution and 100 μl of DMEM medium were added to each well. The plates were then incubated in the dark for 1–2 h, and the absorbance was measured at 450 nm.

[0092] Figure 6 The results showed that, within the concentration range of 0.5-8 μM, the SA-Lipo of this invention had almost no effect on the viability of A549 cells.

[0093] 4) Detection of the activity and toxicity of SA-Lipo against HUVEC and A549 cells

[0094] The activity and cytotoxicity of the drug on cells were detected using the Calcein / PI Cell Viability and Cytotoxicity Assay Kit (Beyotime, #C2015M). A549 or HUVEC cells were cultured in 12-well plates for 24 h, and then treated with DMEM medium (containing Lipo, SA, and SA-Lipo, respectively, with 10% FBS). The control group was treated with additional DMEM medium (containing 10% FBS). After 24 h, the supernatant was discarded, and the prepared Calcein AM / PI assay working solution was added to each well. The cells were incubated at 37°C in the dark for 30 min. After incubation, the staining effect was observed under a fluorescence microscope.

[0095] Figure 7 , 8 The results showed that the SA-Lipo of this invention had no effect on the activity of HUVEC and A549 cells. Based on the above CCK8 experimental results, 2 μM was finally selected as the working concentration of SA and SA-Lipo.

[0096] 5) Schematic diagram of the compatibility of SA-Lipo with different concentrations in blood.

[0097] Two mL of whole blood from normal rats was added to an appropriate volume of heparin sodium solution and centrifuged (5000 rpm, 5 min, room temperature). The supernatant plasma was discarded, and the precipitate was resuspended in physiological saline. The solution was washed three times until the supernatant was bloodless. An appropriate amount of lower red blood cells was placed in a centrifuge tube, and physiological saline was added to prepare a 2% red blood cell solution. Different concentration gradients of Lipo, SA, and SA-Lipo were added. Pure water and PBS were used as positive and negative controls, respectively. After standing at room temperature for 3 h, the solution was centrifuged at 1000 rpm for 5 min, and photographed. The supernatant was then aspirated and analyzed at 540 nm using a microplate reader to calculate the hemolysis rate. Hemolysis rate = (Aa - A0) / (Ab - A0) × 100%. (Aa, A0, and Ab are the absorbance values ​​of the experimental group, negative control group, and positive control group, respectively.)

[0098] Figure 9 The results showed that the SA-Lipo of the present invention is immiscible with blood and has good biocompatibility.

[0099] 2. Anti-inflammatory effect study: Effects of SA-Lipo on the mRNA of pro-inflammatory factors IL-6, IL-1β and TNF-α in LPS-treated RAW264.7 cells.

[0100] RAW264.7 cells were cultured in 12-well plates for 24 h. Cells were then treated with DMEM medium (containing 10% FBS) containing Lipo, SA, and SA-Lipo, respectively. The control and model groups were treated with DMEM medium (containing 10% FBS). After 12 h, the supernatant was discarded. Except for the control group, cells in the other groups were treated with DMEM medium (containing 100 ng / ml LPS (Sigma, L2880#) (containing 10% FBS). After 4 h, the supernatant was discarded, and cells were treated with DMEM medium (containing Lipo, SA, and SA-Lipo, respectively) (containing 10% FBS). After 6 h, the supernatant was discarded, and cells were collected.

[0101] Following the instructions of the RNA extraction kit (Tiangen Biotech, China), total RNA was extracted from RAW264.7 cells using RZ reagent. The RNA content was measured using Nanodrop, and the mRNA was reverse transcribed into cDNA using the PrimeScript RT kit and gDNA Eraser Perfect Real Time (Takara Bio, China). Using the cDNA from each sample as a template, qRT-PCR amplification was performed to detect and analyze the mRNA expression of target genes (IL-6, IL-1β, TNF-α, and α-Tubulin). After the reaction, Tubulin was used as an internal control gene, and 2... -ΔΔCTThe method calculates the relative expression levels of each gene.

[0102] The primer sequences are:

[0103] TNF-aF:TTGTCTACTCCCAGGTTCTCT;

[0104] TNF-aR:GAGGTTGACTTTCTCCTGGTATG;

[0105] IL-1β-F:GGTGTGGTGACGTTCCCATTA;

[0106] IL-1β-R:ATTGAGGTGGAGAGCTTTCAG;

[0107] IL-6-F:CTTCCATCCAGTTGCCTTCT;

[0108] IL-6-R:CTCCGACTTGTGAAGTGGTATAG;

[0109] α-Tubulin-F:AGCAGCTACTTTGTGGAGTG;

[0110] α-Tubulin-R:TCGGAGATGCGCTTGAATAG.

[0111] Figure 10 The results showed that the SA-Lipo of the present invention could significantly reduce the increase in mRNA levels of pro-inflammatory factors IL-6, IL-1β and TNF-α induced by LPS stimulation, and reduce the inflammation level of RAW264.7 cells.

[0112] 3. Effects of SA-Lipo on H2O2-induced oxidative stress

[0113] 1) Effects of SA-Lipo on reactive oxygen species levels in H2O2-induced oxidative stress

[0114] The effect of SA-Lipo on reactive oxygen species (ROS) levels was detected using a reactive oxygen species (ROS) detection kit (Beyotime, #S0033S). A549 cells were cultured in 12-well plates for 24 h. Cells were pretreated with DMEM medium (containing Lipo, SA, and SA-Lipo, respectively, with 10% FBS). The Control and Model groups were treated with DMEM medium (containing 10% FBS). After 12 h, the supernatant was discarded, and cells were treated with DMEM medium (containing 600 μM H2O2, 10% FBS). The Control group was treated with DMEM medium (containing 10% FBS). After 4 h, the supernatant was discarded, and 500 μl of DCFH-DA was diluted 1:1000 with serum-free culture medium in each well. Cells were incubated at 37°C for 20 minutes, and finally observed and photographed directly using a fluorescence microscope.

[0115] Figure 11 The results showed that the SA-Lipo of the present invention can significantly reduce the level of reactive oxygen species in H2O2-induced oxidative stress.

[0116] 2) Effects of SA-Lipo on superoxide dismutase activity during H2O2-induced oxidative stress

[0117] The effect of SA-Lipo on superoxide dismutase activity was detected using a total SOD activity assay kit (Beyotime, #S0101S). A549 cells were cultured in T25 cell culture flasks for 24 h. Cells were pretreated with DMEM medium (containing 10% FBS) containing Lipo, SA, and SA-Lipo, respectively. The Control and Model groups were treated with DMEM medium (containing 10% FBS). After 12 h, the supernatant was discarded, and cells were treated with DMEM medium (containing 10% FBS) containing 600 μM H2O2. The Control group was treated with DMEM medium (containing 10% FBS). After 4 h, the supernatant was discarded, and cells were collected, fully lysed, and the supernatant was used as the test sample. The test sample, WST-8 / enzyme working solution, and reaction start-up solution were added sequentially to 96-well plates according to the manufacturer's instructions. The plates were incubated at 37°C for 30 min, and the absorbance was measured at 450 nm.

[0118] Figure 12 The results showed that the SA-Lipo of the present invention can significantly upregulate the activity of superoxide dismutase in H2O2-induced oxidative stress.

[0119] 3) Effect of SA-Lipo on malondialdehyde levels during H2O2-induced oxidative stress

[0120] The effect of SA-Lipo on malondialdehyde (MDA) levels was detected using a lipid peroxidation (MDA) assay kit. A549 cells were cultured in T25 cell culture flasks for 24 h. Cells were pretreated with DMEM medium (containing 10% FBS) containing Lipo, SA, and SA-Lipo, respectively. The Control and Model groups were treated with DMEM medium (containing 10% FBS). After 12 h, the supernatant was discarded, and cells were treated with DMEM medium (containing 10% FBS) containing 600 μM H2O2. The Control group was treated with DMEM medium (containing 10% FBS). After 4 h, the supernatant was discarded, and cells were collected and fully lysed. The supernatant was used as the test sample. MDA detection working solution was added to the test sample according to the manufacturer's instructions, mixed well, and heated at 100°C or a boiling water bath for 15 minutes. After cooling to room temperature, the sample was centrifuged at 1000g for 10 minutes. 200 μL of the supernatant was added to a 96-well plate, and the absorbance was measured at 532 nm using a microplate reader.

[0121] Figure 13 The results showed that the SA-Lipo of the present invention can significantly reduce the malondialdehyde level in H2O2-induced oxidative stress.

[0122] II. Animal experiments and related indicator measurements

[0123] 1. Animal experimental grouping, model establishment, and drug administration: 6-8 week old male C57BL6 / J mice were acclimatized for 7 days. Two hours before model establishment, physiological saline, Lipo, SA, or SA-Lipo (20 mg / kg, prepared with PBS solution as solvent) were injected intraperitoneally. Following this, LPS (20 mg / kg) was injected via the tail vein. The control group received an equal volume of PBS solution. Mice were sacrificed 24 hours after model establishment for testing.

[0124] 2. Measurement of relevant indicators

[0125] 1) Effects of SA-Lipo on lung tissue pathological damage in LPS-induced septic lung injury mice

[0126] Fresh lung tissue was fixed in 4% paraformaldehyde solution for 24 h, then embedded in paraffin and sectioned to a thickness of 4 μm. The sections were retrieved onto glass slides and dried, then stained with hematoxylin and eosin according to a prescribed procedure. The stained slides were dried, mounted, and finally photographed under an optical microscope.

[0127] Figure 14The results showed that, compared to the model group, which exhibited significant congestion, edema, and thickening of the alveolar walls in the lung tissue (black arrows), extensive neutrophil infiltration (green arrows), and widening and edema of the extravascular interstitial spaces (red arrows), the SA-Lipo treatment group significantly improved these damages. Furthermore, SA-Lipo also showed varying degrees of improvement in damage to other organs.

[0128] 2). Effects of SA-Lipo on Lung Index in LPS-Induced Sepsis-Induced Lung Injury Mice

[0129] Collect and weigh the entire fresh lung tissue of each mouse at the time of sacrifice (W1). Record the mouse's body weight at the time of sacrifice (W2). The lung coefficient is calculated using the formula: W1 / W2 × 100%.

[0130] Figure 15 The results showed that the SA-Lipo of the present invention significantly reduced the lung index and alleviated pulmonary edema in mice with LPS-induced septic lung injury.

[0131] 3) Effects of SA-Lipo on pro-inflammatory factors IL-6, iNOS, and TNF-α mRNA in lung tissue of mice with LPS-induced septic lung injury.

[0132] Following the instructions of the RNA extraction kit, total RNA was extracted from lung tissue using Trizol reagent. The RNA content was measured using Nanodrop. The mRNA was then reverse transcribed into cDNA using the PrimeScript RT kit and gDNA Eraser PerfectReal Time. Using the cDNA from each sample as a template, qRT-PCR amplification was performed to detect and analyze the mRNA expression of target genes (IL-6, IL-1β, TNF-α, and α-Tubulin). After the reaction, Tublin was used as an internal control gene, and 2... -ΔΔCT The method calculates the relative expression levels of each gene.

[0133] Primer sequence:

[0134] TNF-aF:TTGTCTACTCCCAGGTTCTCT;

[0135] TNF-aR:GAGGTTGACTTTCTCCTGGTATG;

[0136] iNOS-F: GGAGTGACGGCAAACATGACT;

[0137] iNOS-R: TCGATGCACAACTGGGTGAAC;

[0138] IL-6-F:CTTCCATCCAGTTGCCTTCT;

[0139] IL-6-R:CTCCGACTTGTGAAGTGGTATAG;

[0140] α-Tubulin-F:AGCAGCTACTTTGTGGAGTG;

[0141] α-Tubulin-R:TCGGAGATGCGCTTGAATAG.

[0142] Figure 16 The results showed that SA-Lipo of the present invention could significantly reduce the mRNA levels of pro-inflammatory factors IL-6, iNOS and TNF-α in LPS-induced septic lung injury mice, and its anti-inflammatory effect was better than that of SA and Lipo alone.

[0143] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. Application of 10-Shogaol nanoliposomes in the preparation of drugs for treating septic lung injury, wherein the 10-shogaol nanoliposomes comprise the active ingredient 10-shogaol and liposomes encapsulating the active ingredient 10-shogaol, wherein the mass ratio of the active ingredient 10-shogaol to the liposomes is 1:(3~10); the liposomes are prepared from DPPC, cholesterol, and DSPE-mPEG2000, wherein the molar ratio of DPPC, cholesterol, and DSPE-mPEG2000 is (75~80):(18~22):3, and the mass ratio of the active ingredient 10-shogaol to the liposomes is 1:(4~6).

2. The application according to claim 1, characterized in that, The drug loading of the 10-shogaol nanoliposomes is 7-16%.

3. The application according to claim 1 or 2, characterized in that, The 10-shogaol nanoliposomes have an encapsulation rate of 60-80% for 10-shogaol.

4. The application according to claim 3, characterized in that, The 10-shogaol nanoliposomes were prepared by the following steps: S1. Dissolve DPPC, cholesterol, DSPE-mPEG2000 and 10-shogaol in a solvent, and remove the solvent by rotary evaporation to obtain a film; S2. Add an aqueous medium to the film obtained in step S1 to hydrate it and obtain a suspension. Then place it on ice for sonication. After sonication, 10-shogaol nanoliposomes can be obtained.

5. The application according to claim 4, characterized in that, The power of the ultrasound in step S2 is 15-25%.

6. The application according to claim 5, characterized in that, The ultrasound time in step S2 is 15~45 min.

Images