Biomimetic nano-drug delivery system based on pd1 engineered cancer cell membrane and construction method thereof

Abstract

The application relates to a construction method of a biomimetic nano-drug delivery system based on a PD1 engineered cancer cell membrane, which comprises the following steps: preparing a nanoparticle inner core of a Pin1 inhibitor by using PLGA, and assisting with fluorescent labeling; engineering PD1 expression on a cancer cell, extracting a PD1-rich cell membrane, and wrapping and modifying API-1-NPs with the PD1 engineered cancer cell membrane to obtain composite nanoparticles API-1@PD1-CCNPs, which can not only guarantee stability and long-term circulation in the delivery process, but also can track the process of the carrier being quickly and effectively targeted to tumor cells and organs in the body in real time, and once internalized by the cancer cell, the wrapped drug API-1 can be effectively released and play a role to inhibit the Pin1 function; the composite nanoparticles API-1@PD1-CCNPs can effectively down-regulate the protein levels of MYC and PD-L1 in hepatocarcinoma cells, thereby effectively synergistically reprogramming the tumor immune microenvironment and affecting tumor immune escape.

Description

[0001] The present application belongs to the field of biotechnology, and particularly relates to a kind of biomimetic nano-drug delivery system based on PD1 engineered cancer cell membrane and a construction method thereof. BACKGROUND

[0002] Currently, the systemic treatment drugs for hepatocellular carcinoma are very limited-molecular targeted drugs and immunological drugs. Since 2007, when sorafenib was approved by FDA for the treatment of advanced liver cancer, drugs for liver cancer indications have been successively approved, including: first-line treatment of sorafenib and lenvatinib; second-line treatment of regorafenib, ramucirumab, cabozantinib, apatinib, pembrolizumab, nivolumab and carotidliuzimab. In addition to monoclonal antibody immunological drugs, other targeted drugs are small molecule multi-target oral tyrosine kinase inhibitors (TKI), which have the effects of anti-angiogenesis and inhibition of tumor cell proliferation. The TKI approved in China for liver cancer indications are sorafenib, lenvatinib, regorafenib and apatinib; the only immune checkpoint inhibitor is carotidliuzimab. Although sorafenib is used as a first-line drug for liver cancer treatment, its objective response rate is only 2%, and the immunotherapy of monoclonal antibody is only effective for part of the patients. In recent years, substantial progress has been made in the targeted combination immunotherapy for hepatocellular carcinoma, but new challenges also exist. It is an urgent need and in line with the development trend of scientific research around the theme of human health to explore promising therapeutic targets, drugs and methods for hepatocellular carcinoma.

[0003] Molecular targeted drugs take advantage of the molecular biological differences (including different characteristics of genes, enzymes, signal transduction, etc.) between tumor cells and normal cells to inhibit the growth and proliferation of tumor cells and finally make them die. There are still the following problems: ① adaptability. If the targeted drugs do not match the patient's genes, they can cause great harm to the patient. Experiments have shown that if gene detection is not performed and targeted drugs are taken blindly, it may be faster to die, and if it is stopped when it is indeed ineffective, the best treatment opportunity will be missed. ② success rate and cure rate. The current targeted therapy does not have a radical effect, and it is not effective for all tumors and all patients. For example, the targeted drugs for treating locally advanced and metastatic non-small cell lung cancer, Iressa and Tarceva, now have a reported effective rate of only 40% or so, and the tumor control rate is only about 70%. Sorafenib for treating renal cell carcinoma and liver cancer, and Gleevec for treating chronic myeloid leukemia and gastrointestinal stromal tumors, have also failed to achieve a radical effect. ③ drug resistance. Many patients who use targeted drugs in clinical practice lose their effectiveness after a period of use, because various specific molecular targeted drugs act on a certain protein or molecule of a certain cancer cell, and can only inhibit one pathway of tumor growth. When one pathway is inhibited, tumor cells will constantly seek "ways" to synthesize the substances needed for their own growth, and eventually the molecular targeted drugs will lose their effect.

[0004] With the rapid development of nanotechnology, the nanomedicine delivery technology with broad application prospects emerged as the times require, and has become a popular new technology in the field of pharmaceutical technology in recent years. The types of nanomedicine carriers are quite extensive. According to the properties of nanomaterials, they can be divided into inorganic nanocarriers, such as mesoporous silica nanomaterials, carbon nanomaterials, etc.; organic nanocarriers, such as liposomes, polylactic acid, chitosan, dendritic polymers, etc. and metal nanocarriers, such as gold nanoparticles, silver nanoparticles, etc. Compared with traditional drugs and systemic therapy drugs, nanomedicine delivery system shows many advantages: ① Nanomedicine carriers can increase the solubility of drugs, improve the stability of drugs, thereby reducing the amount of drugs and improving the efficacy of drugs; ② Nanomedicine carriers can achieve precise treatment through active / passive targeting; ③ Reduce the hindering effect of physiological barriers on drugs, and improve the blood circulation time of drugs in the body; ④ Nanomedicine carriers provide opportunities for the development of stimulus-responsive intelligent nanodrug delivery systems; ⑤ Nanomedicine carriers can realize multifunctionalization and integration of diagnosis and treatment.

[0005] Previous studies have shown that organic drug carriers are some organic molecules that form liposomes, micellar particles through self-assembly process, or designed dendritic molecules, polymer particles. The design principle of these organic carriers is simple, and the controlled release of the loaded drugs is achieved through the deformation or degradation of the organic carriers. Organic nanomedicine delivery system provides many advanced possibilities for drug targeted delivery and release, but still faces a series of limitations and challenges, which are embodied in ① the poor stability of organic nanoparticles in the body, and they are easily removed by the reticuloendothelial system, ② the toxic side effects of the organic molecules themselves, ③ the difficulty in controlling the molecular weight and size of organic molecules, ④ the instability of drug release kinetics, etc. These shortcomings greatly limit the application range of organic nanomedicine delivery system. SUMMARY

[0006] To solve the above problems, the application provides a kind of biomimetic nano drug delivery system based on PD1 engineered cancer cell membrane and a construction method thereof.The biomimetic nano drug delivery system has the following advantages: (1) cell membrane packaged organic nano drug delivery system, simple preparation method and components, non-toxic, with a more realistic biomimetic surface, with high biocompatibility; (2) it can present the antigen of the same type of cancer cell to the immune cell, and also has good immune escape and same type binding capacity, and can effectively carry and release drugs in animal models; (3) PD1 is expressed on the cancer cell, and the cell membrane rich in PD1 is extracted, and PD1-CCNPs nanoparticles are synthesized, based on the binding affinity of PD1 / PD-L1, the CCNPs are given high tumor active targeting, and the drugs can be more efficiently and accurately carried to the solid tumor; (4) the PD1 on the CCNPs can competitively bind to the PD-L1 on the tumor cells, interfere with the inhibition of the immune T cell function by the tumor cell surface PD-L1, and further affect the tumor immune escape. This strategy avoids the negative effects of using PD1 / PD-L1 inhibitors to treat tumors on T cells and normal cells.

[0007] The technical scheme of the application is:

[0008] A construction method of a biomimetic nano drug delivery system based on PD1 engineered cancer cell membrane, comprising the following steps:

[0009] (1) preparing API-1-NPs drug-loaded core;

[0010] Take PLGA and API-1 and dissolve them in acetone to obtain an organic phase; under stirring conditions, take the organic phase and quickly add it to water, and after stirring reaction, obtain API-1-NPs drug-loaded core;

[0011] (2) construction of API-1@PD1-CCNPs:

[0012] First, a PD1 overexpression cell line is established, and then the cell membrane is extracted; the extracted cell membrane is wrapped on the surface of API-1-NPs to obtain composite nanoparticles API-1@PD1-CCNPs.

[0013] In step (1), a certain proportion of carbon-based dendritic macromolecular structure G0-C14 and surfactant TPGS are added to the organic phase. Thus, the nanoparticle pore structure can be effectively increased, and the drug loading efficiency and stability can be improved; the addition amount of G0-C14 is 0.025-0.125 mg / mL, and the mass ratio of surfactant TPGS to PLGA is 1:5-1:10;

[0014] In step (1), a dye is also added to construct the fluorescent nanoparticles; the fluorescent dye is added in an amount of 1% of the mass of the PLGA.

[0015] The fluorescent nanoparticles are DiD and / or DiO. By using dyes such as DiD (ex / em = 644 / 663 nm), DiO (ex / em = 484 / 501 nm), etc., the fluorescent nanoparticles are synthesized by adding them during the nanoparticle synthesis process, and are collected by centrifugation, thereby facilitating the study of the uptake and transport of the nanoparticles in cells.

[0016] In step (2), the specific operation for establishing the PD1 overexpression cell line is as follows:

[0017] First, a PD1 target gene overexpression vector is constructed, and then transfection or infection is performed. The drug is selected according to the screening gene of the expression vector, the selected single clone cells are cultured and identified.

[0018] The sequence of the target gene is shown in SEQ ID No. 1;

[0019] The drug is puromycin or G418.

[0020] In step (2), the specific operation for extracting the cell membrane is as follows:

[0021] The cells are expanded in large quantities 5-7 days before the cell membrane is extracted, the cells are digested with PBS, and the collected cells are washed three times with PBS by centrifugation. The last collected cells are resuspended with a hypotonic buffer, and then ultrasonicated in ice water. The supernatant is collected after centrifugation, and the above-mentioned "resuspension-ultrasonication-centrifugation" operation is repeated on the sediment. The supernatants of the two times are mixed and centrifuged, and the obtained sediment is added with Tris-HCl, blown and centrifuged. The sediment is the purified cell membrane.

[0022] The specific composition of the hypotonic buffer is as follows:

[0023] 20mM of Tris-HCl, 10mM of KCl, 2mM of MgCl2, 200mM of protease inhibitor concentrate (20μmol, that is, 100x protease inhibitor concentrate);

[0024] The PBS is a PBS solution containing 2mM of EDTA, and the Tris-HCl is a Tris-HCl solution containing 1mM of EDTA.

[0025] The specific operation for wrapping the extracted cell membrane on the surface of the API-1-NPs is as follows:

[0026] The extracted cell membrane is added to the syringe of the extruder, prepared with 1xPBS into a total volume of 1 mL, and after being extruded back and forth for more than 20 times with the extruder, the extruded empty membrane bubble structure cell membrane is collected from another syringe; the empty membrane bubble and API-1-NPs are mixed according to the proportion, and then added to the syringe of the extruder, and after being extruded back and forth for more than 20 times with the extruder, the extruded membrane wrapping material is collected from another syringe, and then ultrafiltration centrifugation and concentration collection are performed.

[0027] The method constructs a PD1 engineered cancer cell membrane based biomimetic nanodrug delivery system.

[0028] The present application has the following advantages:

[0029] (1) The present application provides a construction method of a PD1 engineered cancer cell membrane based biomimetic nanodrug delivery system. The API-1-NPs (nanoparticle core of Pin1 inhibitor (an anti-cancer small molecule targeted drug)) is prepared by using PLGA (an FDA certified organic polymer material), and is assisted by fluorescence labeling. PD1 is engineered to be expressed on cancer cells, and the cell membrane rich in PD1 is extracted. The API-1-NPs is wrapped and modified by the PD1 engineered cancer cell membrane to obtain the composite nanoparticles API-1@PD1-CCNPs. The composite nanoparticles API-1@PD1-CCNPs can not only ensure stability and long-term circulation during delivery, but also can track the process of rapid and effective targeted delivery of the carrier to tumor cells and organs in real time in vivo. Once internalized by cancer cells, the wrapped drug (API-1) can be effectively released and exert its effect to inhibit the function of Pin1. The composite nanoparticles API-1@PD1-CCNPs can effectively down-regulate the protein levels of MYC and PD-L1 in hepatocellular carcinoma cells, thereby effectively synergistically reprogramming the tumor immune microenvironment and affecting tumor immune escape.

[0030] (2) The API-1-NPs drug-loaded core of the present application is a uniform dispersed nanoparticle structure, which has the characteristics of high targeting, high delivery efficiency and high biocompatibility compared with ordinary nanoparticles. The composite nanoparticles API-1@PD1-CCNPs have good stability and significant drug efficacy, and have higher water solubility and higher biological safety factor than naked drug molecules. The API-1@PD1-CCNPs of the present application are easy to store and the preparation process is simple, which is completed at room temperature without the dependence on precise temperature control equipment, greatly reducing the operation complexity. The present application combines the characteristics and advantages of organic nanomaterials, biomaterials and fluorescence signals, and can realize the rapid, high sensitivity and high specificity in vivo delivery and visual analysis of anti-tumor small molecule drugs. The present application has no special requirements for the loaded small molecule drugs, and has a wide application range. The targeting drug molecules can be appropriately replaced according to different treatment needs, and the present application has universality and can be applied to other tumor models.

[0031] (3) The PD1-CCNPs carrier of the present application can effectively induce an anti-tumor immune response in vivo. The cancer cell membrane provides a more realistic biomimetic surface for the nanoparticles, and through biomimetic surface functionalization, the immune escape and homologous targeting behavior will significantly enhance its targeting and retention capacity for tumors. At the same time, only tumor antigens are not enough to resist the immunosuppressive effect of the tumor microenvironment, combined with the immune regulation molecule mechanism (PD1 / PD-L1 immune checkpoint), while strengthening the active targeting, the advantages of nanodrug delivery technology can be fully played, and the anti-cancer immune response can be more efficiently induced. BRIEF DESCRIPTION OF DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0033] Figure 1 The schematic diagram of the biomimetic nanodrug delivery system based on immune checkpoint active targeting synergizing with Pin1 inhibitor anti-hepatocarcinoma strategy is shown.

[0034] Figure 2 The material characterization diagram is shown, wherein, Figure 2 a is a synthesis schematic diagram of the API-1@PD1-CCNPs material; Figure 2 b is detection from DNA, mRNA, protein level by PCR, qRT-PCR, WB, immunofluorescence flow cytometry, etc. Figure 2 c is a transmission electron microscope image of the API-1@PD1-CCNPs material; Figure 2 d-2f show that the apparent hydrodynamic size and Zeta potential of the nanoparticles are measured by Zetasizer, wherein, Figure 2 d shows the particle size of API-1@PD1-CCNPs, which is about 100 nm uniform particle size. Figure 2 e shows the Zeta potential, which is about -20 mV, Figure 2 f shows the change of particle size in 3 weeks, which is almost stable at about 100 nm. The results show that the physical properties of the synthesized nanoparticles are stable.

[0035] Figure 3 The growth inhibition of API-1@PD1-CCNPs on SK-Hep1 and molecular regulation are shown. Figure 3 a is the effect of API-1, API-1-NPs, API-1@PD1-CCNPs on the proliferation ability of hepatocarcinoma cells after treatment, respectively; Figure 3b and 3c respectively verified whether API-1@PD1-CCNPs affect the nuclear transport of tumor suppressor miRNAs using immunofluorescence staining (IF) and qRT-PCR methods.

[0036] Figure 4 This demonstrates the highly efficient targeting and intervention of API-1@PD1-CCNPs in a CDX subcutaneous tumor-bearing model. Figure 4 a) Establishment of a CDX subcutaneous tumor-bearing model; Figure 4 b-4d is a targeted delivery efficiency test; Figure 4 e represents the detection of tumor suppression effect; Figure 4 f represents immunohistochemical analysis;

[0037] Figure 5 This indicates the tumor-suppressive effect of API-1@PD1-CCNPs and the induction of CD8 in spontaneous hepatocellular carcinoma model mice. + T-cell infiltration. Figure 5 a) To verify tumor targeting and calculate drug delivery efficiency; Figure 5 b represents the detection of the therapeutic effect of API-1@PD1-CCNPs on tumors; Figure 5 c represents the percentage, number, and spatial distribution of various immune cell infiltrations in the tumor microenvironment after API-1@PD1-CCNPs treatment. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0039] The above technical solution will be described in detail below with reference to specific embodiments.

[0040] Example 1

[0041] This embodiment provides a method for constructing a biomimetic nanomedicine delivery system based on the membrane of PD1-engineered liver cancer cells, such as... Figure 1 As shown, it includes the following steps:

[0042] (1) Preparation of API-1-NPs drug-loaded cores;

[0043] Take 10 mg PLGA and 1 mg API-1 dissolved in acetone, place the organic phase solution at 37°C, constant temperature ultrasonic until dissolution, then add a certain proportion of carbon-based dendrimer structure G0-C14 and surfactant TPGS in the organic phase formula; the addition amount of G0-C14 is 0.025-0.125 mg / mL, and the mass ratio of surfactant TPGS to PLGA is 1:5-1:10; preferably, in this embodiment, the addition amount of G0-C14 is 0.075 mg / mL, and the mass ratio of surfactant TPGS to PLGA is 1:7.5;

[0044] Take 1 mL and add it into 5 mL sterilized water with a rotation speed of 1200 rpm / min, add DiD (ex / em=644 / 663 nm) as a fluorescent dye, stir for 30 min, and construct the fluorescent nanoparticles API-1-NPs stably dispersed in the solution. Put it into a rotary evaporator, quickly evaporate the organic solvent, and evaporate about 90% of the water to concentrate; the addition amount of fluorescent dye DiD is 1% of the mass of PLGA;

[0045] (2) Construction of API-1@PD1-CCNPs:

[0046] First, establish a PD1 overexpression cell line, then extract the cell membrane; the extracted cell membrane is wrapped on the surface of API-1-NPs to obtain composite nanoparticles API-1@PD1-CCNPs;

[0047] Establishment of PD1 overexpression cell line: construct PD1 target gene (as shown in SEQ ID No. 1) overexpression vector, and use virus infection; select drugs for screening according to the screening gene of the expression vector, and the expression vector selected in this embodiment is a plasmid with ampicillin resistance gene, and the drug selected is puromycin; the selected single clone cells are cultured; WB method is used to detect PD1 engineering expression from the protein level Figure 2 b).

[0048] The PD1 target gene is as shown in SEQ ID No. 1, and the specific sequence is as follows:

[0049] ATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTAC

[0050] AACTGGGCTGGCGGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTG

[0051] GAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGGAC

[0052] AACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCT

[0053] AAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCC

[0054] TTCCCCGAGGACCGCAGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCA

[0055] CACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGGCCCG

[0056] GCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCA

[0057] AGGCGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGA

[0058] GAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCCTCACCCAGGCCAGC

[0059] CGGCCAGTTCCAAACCCTGGTGGTTGGTGTCGTGGGCGGCCTGCTGGGC

[0060] AGCCTGGTGCTGCTAGTCTGGGTCCTGGCCGTCATCTGCTCCCGGGCCGC

[0061] ACGAGGGACAATAGGAGCCAGGCGCACCGGCCAGCCCCTGAAGGAGGA

[0062] CCCCTCAGCCGTGCCTGTGTTCTCTGTGGACTATGGGGAGCTGGATTTCC

[0063] AGTGGCGAGAGAAGACCCCGGAGCCCCCCGTGCCCTGTGTCCCTGAGCA

[0064] GACGGAGTATGCCACCATTGTCTTTCCTAGCGGAATGGGCACCTCATCCC

[0065] CCGCCCGCAGGGGCTCAGCTGACGGCCCTCGGAGTGCCCAGCCACTGAG

[0066] GCCTGAGGATGGACACTGCTCTTGGCCCCTCTGA;

[0067] Cell membrane extraction: a) Begin large-scale cell expansion a few days before cell membrane extraction, ensuring approximately 100 million cells (using a diameter of...) The dishes, each containing approximately 10 7 (cells); b) Prepare hypotonic buffer: 20mM Tris-HCl, 10mM KCl, 2mM MgCl2, 1 tablet of protease inhibitor (pre-prepared protease inhibitor concentrate can be used), total volume 10mL, pH 7.5; c) Use a solution containing 2mM Digest cells with EDTA in 1×PBS, collect them in EP tubes, and wash three times with 1×PBS (1000×g, 8 min); d) Resuspend the last collected cells in hypotonic buffer; e) Sonicate in ice water using an ultrasonic water bath (50W, 40kHz) for 5-10 min (this step can be replaced with a glass cell homogenizer), collect the liquid, and centrifuge at 3200×g for 5 min; f) Collect the supernatant, repeat steps 4 and 5 with the precipitate, and collect the supernatant again; g) Mix the two supernatants, centrifuge at 20000×g for 20 min at 4℃; h) Collect the supernatant, centrifuge at 10000×g at 4℃ for 1 h; i) Discard the supernatant, add 10 mM Tris-HCl (pH 7.5, containing 1 mM EDTA) to the precipitate, pipette, centrifuge at 10000×g at 4℃ for 1 h, and the precipitate is the purified cell membrane. j) Discard the supernatant, and resuspend the precipitate (cell membrane) with PBS buffer as needed.

[0068] Cell membrane encapsulation: The extracted cell membrane was added to the syringe of the squeezer and prepared with 1×PBS to a total volume of 1 mL. After squeezing back and forth more than 20 times, the empty membrane vesicle structure was collected from another syringe. The empty membrane vesicle (or the collected cell membrane) and API-1-NPs were mixed in the specified ratio and added to the syringe of the squeezer. After squeezing back and forth more than 20 times, the membrane encapsulation material was collected from another syringe, ultrafiltered, centrifuged, concentrated and collected.

[0069] Experimental Example 1

[0070] The physical properties of API-1@PD1-CCNPs and synthetic intermediates were characterized and analyzed using transmission electron microscopy, dynamic light scattering particle size analyzer, fluorescence spectrophotometer, HPLC, and enzyme-linked immunosorbent assay (ELISA), including particle size, potential, drug loading efficiency, and release rate.

[0071] Particle size and potential: After dilution, the solution containing API-1@PD1-CCNPs was dropped onto a copper grid under a transmission electron microscope, and the excess solvent was evaporated. The morphology of the nanoparticles was detected by transmission electron microscopy Figure 2 c) API-1@PD1-CCNPs were diluted with ultrapure water or cell culture medium, and the apparent hydrodynamic size and Zeta potential of the nanoparticles were measured by Zetasizer Figure 2 d, e, f) Fluorescence spectra were obtained by Edinburgh FS920 fluorescence spectrometer.

[0072] Encapsulation efficiency: 1 mL of API-1@PD1-CCNPs was centrifuged at 15000 r / min for 10 min, and the supernatant was aspirated and diluted to the appropriate mass concentration. The content of API-1 was determined by enzyme-labeled instrument and HPLC according to the spectral conditions. The drug loading rate and encapsulation efficiency were calculated according to the total mass of the carrier and the total amount of the drug.

[0073] Release rate: 2 mL of API-1@PD1-CCNPs and PD1-CCNPs were added into dialysis bags (MWCO: 7000 Da), respectively, and they were immersed in 18 mL of buffer (0.1% Tween 80, PBS, pH 7.4) and buffer (0.1% Tween 80, PBS, pH 5.5), respectively. They were placed in a shaking bed at 100 r / min at 37°C in the dark. At 0.5, 1, 2, 4, 8, 12, 24, 36 and 48 h, 1 mL was taken out for detection of its absorbance and 1 mL of fresh buffer was added. Their ultraviolet absorption was measured at the maximum absorption wavelength of 278 nm, and the drug release rate was calculated.

[0074] Experimental Example 2

[0075] The biocompatibility of the PD1-CCNPs drug delivery system was verified at the cellular level.

[0076] A variety of liver cancer cell lines (SK-Hep1, HepG2, Huh7, etc.) were selected, and after treatment with different concentrations of homologous PD1-CCNPs, MTT detection, clone formation and Ki67 immunofluorescence experiments were used to detect the cytotoxicity of liver cancer cells. Untreated liver cancer cells were selected as the control group. The maximum carrier concentration was determined by the experimental results.

[0077] MTT activity and clone formation: liver cancer cell lines (SK-Hep1 was selected as an example) were trypsinized, resuspended in DMEM complete medium, and 100 μL of cell suspension was added to each well of a 96-well plate, with a total of 3 x 10 3The cells were planted in 96-well plates, and different concentrations of cell membrane homologous PD1-CCNPs were added, concentration gradient groups were set, 5 duplicate wells were designed at each time point, 20 μL of MTT was added to each well every 1 day, the culture medium was discarded after 4 h of incubation at 37°C, 100 μL of DMSO was resuspended, the period absorbance was measured at 540 nm wavelength on a microplate reader, and finally the cell growth curve was drawn. At the same time, 1×10 4 SK-Hep1 cells were planted in 6-well plates, PD1-CCNPs were added to the culture medium, concentration gradient groups were set, and the culture was terminated after 5 days. The plates were stained at room temperature for 20 min in 0.5% crystal violet, and then washed with running water to fully fade the outside of the plates. Finally, the plates were dried and photographed, and the clones were counted. The untreated cell line was used as a control group to detect the proliferation ability Figure 3 a)。

[0078] Immunofluorescence: 1. Plating: Sterile glass slides were added to the 24-well plate with tweezers (or special confocal glass bottom dishes were used), and liver cancer cells were plated at a density of 80,000 / well, and incubated overnight. 2. Drug addition: Different concentrations of drugs (PD1-CCNPs) were added according to experimental requirements for different time periods. 3. Staining: 1×PBS washing, 4×5 min; 4% paraformaldehyde fixation at room temperature for 30 min, 500 μL per well; 1×PBS washing, 4×5 min; membrane penetration: mixture containing 0.25% Triton and 0.2% Tween, 500 μL per well, incubation for 15 min; 1×PBS washing, 4×5 min; blocking primary antibody: dilute the primary antibody (6% BSA) at a ratio of 1:200, incubate at room temperature for 2 h; 1×PBS washing, 4×5 min; add secondary antibody: dilute the fluorescent secondary antibody (6% BSA) at a ratio of 1:200, incubate at room temperature for 1 h; 1×PBS washing, 4×5 min; slide mounting: remove the glass slides, mount them on the carrier with glue, and air dry at room temperature overnight, and observe and photograph under a laser confocal microscope.

[0079] Experimental Example 3

[0080] Effect of API-1@PD1-CCNPs on the tumor biological characteristics of liver cancer cells.

[0081] (1) Effect of API-1@PD1-CCNPs on the proliferation ability of liver cancer cells

[0082] Select liver cancer cell lines (SK-Hep1, HepG2, Huh7, etc.), respectively, using API-1, API-1-NPs, API-1@PD1-CCNPs treatment, using MTT detection, clone formation experiment and Ki67 immunofluorescence experiment, etc., to detect the influence on the proliferation ability of liver cancer cells. Select untreated and PD1-CCNPs treated liver cancer cells as control group. The optimal drug concentration and drug efficacy duration of each liver cancer cell line are determined by the experimental results.

[0083] MTT activity and colony formation: different concentrations of drugs (API-1, API-1-NPs, API-1@PD1-CCNPs) were added according to experimental requirements to treat different time groups Figure 3 a). The specific experimental operation is according to the above scheme.

[0084] Ki67 immunofluorescence: different concentrations of drugs (API-1, API-1-NPs, API-1@PD1-CCNPs) were added according to experimental requirements to treat different time groups. The specific experimental operation is according to the above scheme.

[0085] (2) Effect of API-1@PD1-CCNPs on the invasion and migration ability of liver cancer cells

[0086] Select liver cancer cell lines (SK-Hep1, HepG2, Huh7, etc.), respectively, using API-1, API-1-NPs, API-1@PD1-CCNPs treatment, using Transwell migration assay, invasion assay and wound healing assay, etc., to detect the influence on the invasion and migration ability.

[0087] Transwell migration and invasion: untreated and PD1-CCNPs treated liver cancer cells were selected as control group. Taking SK-Hep1 as an example, after treatment with API-1, API-1-NPs, API-1@PD1-CCNPs for 48h, the cells were trypsinized, resuspended in serum-free DMEM, and 700μL of DMEM complete medium was added to each well of the 24-well plate. The bottom of the Transwell chamber was lightly added with 150μL of cell suspension, and the bottom of the chamber was fully contacted with the lower liquid surface. After incubation at 37℃ for 48h, the chamber was fixed with 4% paraformaldehyde solution at room temperature for 20min, then the chamber was placed in 0.5% crystal violet, and stained at room temperature for 20min. Then the chamber was washed with running water to fully fade the color, and the inner wall of the chamber was carefully wiped with a cotton swab. Finally, the chamber was placed under a glass slide, and 5 random fields were selected under a 400x field of view of a upright microscope, photographed and counted.

[0088] Scratch healing: We laid 5×10 mm thick substrate in a 6-well plate. 6 The SK-Hep1 cells treated in the above experiment were plated for 24 hours. The cell surface was then gently scratched with a pipette tip, and the medium was changed to serum-free medium. Five fields of view were randomly selected, and the scratch width at the same location was observed and recorded under a microscope every 12 hours. The migration ability of SK-Hep1 cells was statistically analyzed. The migration and invasion abilities of SK-Hep1 cells treated with API-1, API-1-NPs, and API-1@PD1-CCNPs were compared with those of the control group.

[0089] (3) Effects of API-1@PD1-CCNPs on tumor angiogenesis

[0090] Hepatocellular carcinoma cell lines (SK-Hep1, HepG2, Huh7, etc.) were selected and treated with API-1, API-1-NPs, and API-1@PD1-CCNPs. The culture medium was collected by centrifugation and filtration, and the effect on angiogenesis ability was observed using umbilical vein epithelial cells (HUVEC) tube formation assay.

[0091] HUVEC Tube Formation: Cell culture medium from each group after 3 days of cell culture was collected and mixed with umbilical vein epithelial cells (HUVECs) and seeded into pre-coated 96-well plates. Images were taken from 5 random fields of view every 2 hours, and the formation of microtubule structures was calculated. The number of tubes in each group was then counted. Similarly, untreated and PD1-CCNPs-treated hepatocellular carcinoma cells were selected as the control group.

[0092] (4) Can API-1@PD1-CCNPs induce apoptosis / autophagy in tumor cells?

[0093] Hepatocellular carcinoma cell lines (SK-Hep1, HepG2, Huh7, etc.) were selected and treated with API-1, API-1-NPs, and API-1@PD1-CCNPs. Flow cytometry, immunofluorescence, and Western blotting were used to detect apoptosis or autophagy in the hepatocellular carcinoma cells. Untreated and PD1-CCNPs-treated hepatocellular carcinoma cells were selected as control groups.

[0094] Flow cytometry detection of apoptosis: after the liver cancer cells were treated with the corresponding drugs API-1, API-1-NPs, API-1@PD1-CCNPs, the adherent cells were collected by trypsin digestion, centrifuged at 1500 rpm for 5 min at room temperature, and the cells were suspended in 300 μL of 1x Binding Buffer. After mixing with 5 μL of Annexin V-FITC, avoid light, incubate at room temperature for 15 min; 5 min before machine, add 5 μL of PI staining. After adding 200 μL of 1x Binding Buffer, the machine was detected.

[0095] Immunofluorescence: according to the experimental requirements, the tumor cell apoptosis was characterized by Caspase3, Caspase9, etc. after the cells were treated with nanodrugs; LC3I and LC3II were used to characterize tumor cell autophagy. The specific experimental scheme is as follows.

[0096] (5) Whether API-1@PD1-CCNPs affect Pin1 substrate cancer proteins and anti-cancer miRNA transport

[0097] The influence of API-1@PD1-CCNPs on the substrate cancer protein related pathways of Pin1 such as KRAS, AKT, β-catenin, NF-κB, Cyclin D1, c-JUN, etc. was verified by WB and other methods; whether API-1@PD1-CCNPs affect the transport of anti-cancer miRNA out of the nucleus was verified by immunofluorescence staining IF, qRT-PCR and other methods. Figure 3 b, c).

[0098] Experimental Example 4

[0099] Effect of API-1@PD1-CCNPs on tumor microenvironment and immune promotion mechanism.

[0100] (1) Detection of changes in key molecules after API-1@PD1-CCNPs treatment by combining transcriptome and proteome integrated analysis results

[0101] Isolation of tumor tissues from multiple tumor mouse models treated and untreated, detect the effect of API-1@PD1-CCNPs on tumor cells at the transcriptional and translational levels by RNA-seq, Label-Free, etc. Then verify the sequencing results in the previous step by immunofluorescence staining, WB, and multiplex fluorescence immunohistochemical staining kit, focusing on detecting the changes of Pin1 substrates such as MYC and related proteins, further revealing the anti-cancer molecular mechanism of API-1@PD1-CCNPs in vivo, while detecting tumor metastasis, apoptosis / necrosis / senescence, angiogenesis, etc. Markers to evaluate the inhibitory effect of API-1@PD1-CCNPs on tumors and clarify the molecular mechanism of API-1@PD1-CCNPs against tumors.

[0102] (2) Detect the changes of tumor microenvironment in multiple preclinical tumor models after API-1@PD1-CCNPs treatment

[0103] Isolation of Hu-PBMC and GEMM tumor models in blood, spleen, lymph nodes, and tumor tissues after treatment, detection of various immune cells in the tumor microenvironment such as CD8 + / CD4 + T cells, B cells, NK cells, TAMs, APCs, etc. Lymphocytes by multicolor flow cytometry, multiplex fluorescence immunohistochemical staining kit, etc. The percentage, number, and spatial distribution of infiltrating lymphocytes Figure 5 c), and changes in cytokines such as IL-12, TNF-alpha, IFN-gamma, TGF-beta, PD-L1, etc. Verify whether tumor immune surveillance is restored and tumor immunity is mobilized.

[0104] Multicolor flow cytometry of mouse tumor tissues: The whole liver was removed, weighed and recorded, and 0.5g of tumor tissue (the same part and weight were taken from each mouse) was taken in EP and cut into 1mm3 fine pieces with scissors. The chopped liver was transferred to the prepared digestion buffer and kept on ice until the end of tissue harvesting. Add 10mL of digestion solution (digestion solution is prepared and preheated at 37℃). Digestion at 37℃ for 30min, filter the cell suspension with a 70μm filter, and pre-wet the filter with 1500rpm centrifugation for 3min before filtration. Resuspend the cells with 5mL of PBS and centrifuge at 1500rpm for 3min. Lyse the red blood cells, lyse for 15min on ice, then wash, resuspend. After cell counting, divide into tubes based on flow cytometry staining scheme. Add appropriate amount of flow cytometry antibody to each tube, incubate on ice for 30min, centrifuge, wash, resuspend, and detect on the machine.

[0105] Mouse tumor tissue multiplex fluorescence immunohistochemistry: peel the whole liver, weigh and record the total weight of the liver, take 0.5 g of tumor tissue (try to take the same part and the same weight from each mouse) in a BD tube, fix it with paraformaldehyde, follow the operation steps of the multiplex fluorescence immunohistochemistry staining kit to prepare the fluorescence tissue section sample, and use the multispectral full-automatic tissue quantitative analyzer to detect the number and spatial distribution of various immune cells in the tumor microenvironment, such as CD8 + / CD4 + T cells, B cells, NK cells, TAM, APC and other lymphocytes, and changes in cytokines such as IL-12, TNF-alpha, IFN-gamma, TGF-beta, PD-L1, etc.

[0106] (3) In vitro simulation of tumor microenvironment experiment to explore the synergistic mechanism of API-1@PD1-CCNPs and immune cells

[0107] Using a variety of human hepatocellular carcinoma cell lines and immortalized T lymphocytes Jurkat to simulate T cell-mediated anti-tumor immune response in vitro, the activation state of T cells and the synergistic killing effect of tumor in the presence or absence of API-1@PD1-CCNPs were verified by flow cytometry, immunofluorescence staining, clonogenic assay, ELISA and other methods.

[0108] (4) To explore whether API-1@PD1-CCNPs treatment induces immune memory in mice

[0109] Induced immune memory experiment: first, the C57BL / 6 mice with spontaneous liver cancer GEMM were treated with API-1@PD1-CCNPs for four cycles. After the last treatment, the tumor size was imaged and recorded. Four mice with complete response to treatment were selected, and 5x10 5 Hepa1-6 cells were subcutaneously injected. Wild-type C57BL / 6 mice were used as controls, and the same number of Hepa1-6 cells were subcutaneously injected on day 0 without any pretreatment. The size of the subcutaneous tumor was measured every other day from day 7 to day 25 using a caliper, and the tumor volume was calculated according to the following formula: 1 / 2 (length x width x width). As shown in Figure 4 and Figure 5

[0110] Figure 4 a The design of the administration cycle and test time point of the CDX model. Figure 4 In b, the CDX tumor mice were injected with DiD fluorescent labeled nanoparticles and naked drugs (DiD instead) via the tail vein 2 weeks after tumor formation, and 72 h later, the small animal imaging instrument was used to observe that the PD1-CCNPs drug delivery system could efficiently deliver to the tumor site. Figure 4 ​In c, the distribution of drugs in the whole body was counted, among which PD1-CCNPs had the highest uptake ratio in tumors, showing excellent targeted delivery efficiency. Figure 4 In d, after dissection, the organs were taken out, and the local results were consistent with the whole. Figure 4 In e, after modeling for 1 week, the CDX model was injected with drugs every 3 days, and the tumor growth curve was counted. The results showed that API-1@PD1-CCNPs had better solid tumor intervention effect than API-1 naked drugs. Figure 4 In f, the Figure 4 In e, the organs (heart, liver, spleen, lung, and kidney) of nude mice were sampled to make H&E staining, and observed under a microscope. No pathological changes and toxic reactions were found in the API-1@PD1-CCNPs group. The results confirmed that API-1@PD1-CCNPs had good biocompatibility and had certain clinical application potential.

[0111] Figure 5 In a, to verify the tumor targeting and calculate the drug delivery efficiency, the drug administration cycle and test time points of the CDX model were designed. Figure 5 In b, the inhibitory effect of API-1@PD1-CCNPs and API-1 naked drugs on spontaneous liver cancer tumors was detected after 1 month of administration. It was found that API-1 naked drugs had no significant effect, while API-1@PD1-CCNPs could effectively inhibit tumors. Figure 5 In c, the Figure 5 In b, immunofluorescence experiments were performed on tumor tissues, and it was found that the CD8+ T cell infiltration in the PD1-CCNPs group was enhanced, and the CD8+ T cell infiltration in the API-1-NPs group and the API-1@PD1-CCNPs group was enhanced in turn. Among them, API-1@PD1-CCNPs was the most obvious. The results suggested that the PD1-CCNPs carrier might compete with tumor cell PD-L1, affect tumor immune escape, and induce T cell infiltration; combined Figure 3 According to the results in c, it was speculated that after API-1@PD1-CCNPs effectively delivered API-1 to tumors to play a role, it might down-regulate tumor cell PD-L1, thereby further affecting tumor immune escape.

[0112] (5) Detection of changes in Exosomal PD-L1 after API-1@PD1-CCNPs treatment

[0113] After API-1@PD1-CCNPs treatment, exosomes were extracted from orthotopic tumor models using ultracentrifugation.

[0114] Peripheral blood exosome collection: 1-1.5 mL of mouse peripheral blood was added to a 1.5 mL enzyme-free centrifuge tube and allowed to coagulate at 37°C for 1 hour without anticoagulation. The blood was centrifuged at 2000×g for 10 min to obtain serum. Then, it was centrifuged at 3000×g for 10 min to obtain serum again. The supernatant was diluted 1:1 with sterile PBS and centrifuged again at 10000×g for 30 min, followed by ultracentrifugation at 200000×g for 2 h. The precipitate was resuspended in a large volume of PBS, filtered through a 0.2 μm syringe filter, and centrifuged at 200000×g for 1 h. The precipitate was then collected and resuspended in PBS or the culture medium for subsequent functional or biochemical assays. Care should be taken to avoid excessive foaming, as exosomes are present in the resuspension. PBS was transferred to a new EP tube, and 1 mL of TRIzol or cell lysis buffer, protein loading solution, or DTT was added for nucleic acid or protein extraction. The ultracentrifuge tube was then washed and ready for use.

[0115] Exosome detection: PD-L1 expression on exosomes was detected by SDS-PAGE and WB, and the size and morphology of exosomes were analyzed by transmission electron microscopy. Then, combined with immunolabeling, the expression sites of PD-L1 in exosomes were analyzed.

[0116] PD-L1 exosome intracellular and extracellular observation: Hepatocellular carcinoma cell lines (SK-Hep1, HepG2, Huh7, etc.) were selected to analyze the differences in intracellular and extracellular oosome formation. Based on experimental requirements, hepatocellular carcinoma cell lines were treated with a specific concentration of API-1@PD1-CCNPs. Using exosome fluorescent probes or fluorescent fusion protein labeling methods, combined with immunofluorescence staining of PD-L1, confocal observation was used to verify whether there were any changes in the intracellular germination process of PD-L1-positive exosomes. Exosomes were collected in the culture medium, following a mouse peripheral blood exosome collection protocol.

[0117] This invention utilizes the biological characteristics of cancer cell membranes and immune checkpoints to develop a biomimetic nanomedicine delivery system named PD1-CCNPs, and explores its application in specific embodiments. By encapsulating synthetic nanoparticles API-1@PD1-CCNPs with the Pin1 inhibitor API-1 using the non-cytotoxic PD1-CCNPs drug delivery system, its tumor-targeted delivery efficiency and tumor intervention effect can be significantly improved, downregulating MYC and PD-L1 in liver cancer cells and affecting tumor immune escape. Furthermore, the PD1-CCNPs biomimetic nanomedicine delivery system, as a nanomedicine delivery carrier, exhibits good biocompatibility and has the potential for intracellular in-situ tracing and in vivo visualized therapy, laying a foundation for future clinical translation.

[0118] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A method for constructing a biomimetic nano-drug delivery system based on PD1 engineered cancer cell membrane, characterized in that, The method comprises the following steps: (1) preparing API-1-NPs drug-loaded inner core; PLGA and API-1 are dissolved in acetone to obtain an organic phase; under stirring, the organic phase is quickly added to water, and after stirring reaction, API-1-NPs drug-loaded inner core is obtained; A certain proportion of carbon-based dendrimer structure G0-C14 and surfactant TPGS are also added to the organic phase; The amount of G0-C14 added is 0.025-0.125 mg / mL, and the mass ratio of the surfactant TPGS to PLGA is 1:5-1:10; (2) construction of API-1@PD1-CCNPs: First, a PD1 overexpression cell line is established, and then the cell membrane is extracted; the extracted cell membrane is wrapped on the surface of API-1-NPs to obtain composite nanoparticles API-1@PD1-CCNPs; The specific operation for establishing the PD1 overexpression cell line is as follows: First, a PD1 target gene overexpression vector is constructed, and then transfection or infection is performed; according to the selection gene of the expression vector, a drug is selected for screening; the screened single clone cells are expanded and cultured and identified; The sequence of the target gene is shown in SEQ ID No.

1. The drug is puromycin or G418.

2. The method for constructing the PD1-engineered cancer cell membrane-based biomimetic nanodrug delivery system according to claim 1, wherein, In step (1), a fluorescent dye is also added to construct a fluorescent nanoparticle; the amount of the fluorescent dye added is 1% of the mass of PLGA.

3. The method of constructing a PD1-engineered cancer cell membrane-based biomimetic nanodrug delivery system according to claim 2, wherein, The fluorescent nanoparticle is DiD and / or DiO.

4. The method for constructing the PD1-engineered cancer cell membrane-based biomimetic nanodrug delivery system according to claim 1, wherein, In step (2), the specific operation for extracting the cell membrane is as follows: Five to seven days before extracting the cell membrane, the cells are expanded in large quantities, and the cells are digested with PBS; after collection, the cells are washed with PBS three times by centrifugation; the last collected cells are resuspended with a hypotonic buffer, and then ultrasonicated in ice water; after centrifugation, the supernatant is collected, and the sediment is subjected to the above-mentioned "resuspension-ultrasonication-centrifugation" operation repeatedly; the supernatants of the two times are mixed and centrifuged; after centrifugation of the supernatant, Tris-HCl is added to the obtained sediment, and then blown and centrifuged; the sediment is the purified cell membrane.

5. The method for constructing the PD1-engineered cancer cell membrane-based biomimetic nanodrug delivery system according to claim 4, wherein, The specific composition of the hypotonic buffer is as follows: 20 mM Tris-HCl, 10 mM KCl, 2 mM MgCl2, 200 mM proteinase inhibitor concentrate; The PBS is a PBS solution containing 2 mM EDTA, and the Tris-HCl is a Tris-HCl solution containing 1 mM EDTA.

6. The method for constructing the PD1-engineered cancer cell membrane-based biomimetic nanodrug delivery system according to claim 1, wherein, The specific operation for wrapping the extracted cell membrane on the surface of API-1-NPs is as follows: The extracted cell membrane is added to the syringe of the extruder, and a total volume of 1 mL is prepared with 1×PBS; after back and forth extrusion of the extruder for more than 20 times, the cell membrane with the structure of empty membrane bubble that is extruded is collected from another syringe; the empty membrane bubble and API-1-NPs are mixed according to the proportion, and then added to the syringe of the extruder; after back and forth extrusion of the extruder for more than 20 times, the extruded membrane wrapping material is collected from another syringe; ultrafiltration centrifugation is performed, and then concentrated and collected.

7. The PD1 engineered cancer cell membrane-based bionic nanodrug delivery system constructed according to any one of claims 1-6.

Images