Application of staphylococcus aureus toxin protein related gene SA1833 / SA1832 in treatment of staphylococcus aureus infection

By knocking out the Staphylococcus aureus toxin protein-related genes SA1833/SA1832, combined with antibiotic treatment, the persistence and survival rate of methicillin-resistant Staphylococcus aureus were reduced, solving the problem of chronic infection caused by drug-resistant Staphylococcus aureus and providing a new treatment strategy.

CN119055779BActive Publication Date: 2025-11-21UNIV OF SCI & TECH OF CHINA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411043389.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-31
Publication Date
2025-11-21
Estimated Expiration
2044-07-31

AI Technical Summary

Technical Problem

Current technologies lack effective strategies to address persistent and recurrent infections caused by methicillin-resistant Staphylococcus aureus (MRSA), especially chronic infections due to the tolerance and persistence of persistent bacteria, and there are few drugs that target and kill persistent Staphylococcus aureus.

Method used

By knocking out the Staphylococcus aureus toxin protein-related genes SA1833/SA1832, a gene knockout vector was constructed using homologous recombination. This vector was then combined with β-lactam antibiotics such as cefazolin to reduce bacterial persistence and survival. RNA-seq and RT-qPCR were used to identify the expression regulation of the downstream target gene lrgA.

Benefits of technology

It significantly reduced the persistence and survival rate of methicillin-resistant Staphylococcus aureus, providing a new treatment option for methicillin-resistant Staphylococcus aureus and reducing the risk of chronic infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119055779B_ABST
    Figure CN119055779B_ABST
Patent Text Reader

Abstract

The present application relates to the application of Staphylococcus aureus toxin protein related gene SA1833 / SA1832 in treating Staphylococcus aureus infection. Specifically, it relates to the application of Staphylococcus aureus toxin protein related gene SA1833 and / or SA1832 as a target in the preparation of a drug for treating drug-resistant Staphylococcus aureus infection, preferably, the drug resistance is preferably methicillin resistance. With SA1833 and / or SA1832 as a target, the clinical treatment of repeated and persistent infection caused by methicillin-resistant Staphylococcus aureus retention has a significant effect. It provides a new target for the development of drugs for treating repeated infection caused by clinical MRSA strains, provides more choices for the treatment of Staphylococcus aureus, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the application of the Staphylococcus aureus toxin protein-related gene SA1833 / SA1832 in the treatment of Staphylococcus aureus infection. Background Technology

[0002] Staphylococcus aureus is a multifunctional opportunistic pathogen that can cause a variety of infectious diseases, such as mild skin infections, toxic shock syndrome, food poisoning, and chronic pneumonia, posing a significant threat to global public health. Antibiotics are a common and widely used clinical treatment for Staphylococcus aureus infections. However, over time, Staphylococcus aureus has evolved four different mechanisms to maintain its survival in antibiotic-containing environments: drug resistance, heterogeneous resistance, tolerance, and persistence. The formation of drug-resistant Staphylococcus aureus is a major cause of acute Staphylococcus aureus infections. Currently, by elucidating the drug resistance mechanisms of Staphylococcus aureus, various antibacterial or bactericidal drugs targeting different resistance mechanisms have been developed, and the combination of multiple drugs can effectively treat acute infections caused by it. The formation of tolerant and persistent bacteria is an important cause of recurrent and chronic Staphylococcus aureus infections in clinical practice. However, because tolerant and persistent bacteria are relatively few in number and difficult to isolate from cell populations, our understanding of the mechanisms of bacterial tolerance and persistence is still relatively limited. Currently, there are relatively few effective drugs on the market that target and kill persistent Staphylococcus aureus, and there is no good strategy to deal with the stubborn and recurrent infections caused by Staphylococcus aureus.

[0003] Staphylococcus aureus is a facultative anaerobic opportunistic pathogen that can colonize various parts of the human body. Under normal circumstances, Staphylococcus aureus does not cause infection in its host. However, when the body's immunity is weakened, it can invade the host through broken skin and mucous membranes, causing infectious diseases of varying degrees. Staphylococcus aureus infections can be classified according to the type of Staphylococcus aureus: infections caused by methicillin-sensitive Staphylococcus aureus and infections caused by methicillin-resistant Staphylococcus aureus (MRSA). Based on the severity of the infection, they can be classified as acute infections and chronic recurrent infections. Chronic infections caused by methicillin-resistant Staphylococcus aureus pose a significant challenge to the clinical treatment of Staphylococcus aureus infections, and the formation of persistent Staphylococcus aureus is a major cause of chronic recurrent infections. Therefore, exploring the molecular mechanisms of persistent Staphylococcus aureus formation and developing drugs to kill persistent Staphylococcus aureus is particularly important.

[0004] Previous studies have shown that the metabolic level, cell wall defects, and virulence factors of *S. aureus* can all affect bacterial retention. Furthermore, *S. aureus* can influence bacterial retention by regulating intracellular ATP levels or PSM expression in response to oxidative stress or stringent stress, respectively. In addition, the toxin-antitoxin system (TA) plays a crucial role in bacterial retention, and the expression of toxin proteins can promote retention. Based on previous research, the inventors discovered that SA1833 and SA1832 are a gene pair widely found in methicillin-resistant *S. aureus*, with highly conserved gene sequences; they are likely type II TA-like elements. SA1833 encodes an antitoxin protein, and SA1832 encodes a toxin protein. Protein structure prediction indicates that both SA1833 and SA1833 possess DNA-binding domains, while SA1833 also possesses a transcriptional regulatory domain. Furthermore, this study found that SA1833 / SA1832 can respond to different external stresses, thereby upregulating the transcriptional level of SA1833 / SA1832. However, whether this upregulation is beneficial for bacterial adaptation to external stress environments remains unclear. Overexpression of toxin proteins can promote bacterial antibiotic retention, and the complex intracellular environment of host cells, including oxidative environments, nutritional deficiencies, and acidic environments, can all induce the expression of SA1833, SA1832, and SA1833-SA1832. Whether intracellular stress can promote Staphylococcus aureus retention by inducing SA1833 / SA1832 expression, thereby increasing the survival of methicillin-resistant Staphylococcus aureus during intracellular antibiotic treatment and promoting chronic, recurrent infections, requires further investigation. Summary of the Invention

[0005] Based on the aforementioned research background, in this study, we identified that the toxin protein SA1833 / SA1832 can regulate the expression of the downstream metabolic target gene lrgA using RNA-seq and RT-qPCR methods. To determine the correlation between SA1833 / SA1832 and the intracellular retention of methicillin-resistant Staphylococcus aureus (MRSA) in host cells and the molecular mechanism regulating MRSA retention, we first knocked out SA1833 / SA1832 using homologous recombination and then examined the changes in the retention capacity of the mutant strain under treatment with cefazolin, a β-lactam antibiotic that can penetrate host cells. Simultaneously, we used RNA-seq and RT-qPCR to identify the downstream target genes it regulates, hoping to provide new treatment options and strategies for persistent infections caused by MRSA strains of Staphylococcus aureus.

[0006] Therefore, this invention discloses an application of treating Staphylococcus aureus infection by targeting the Staphylococcus aureus toxin protein-related genes SA1833 / SA1832. Specifically, this invention relates to the following aspects:

[0007] On one hand, the present invention relates to the use of the Staphylococcus aureus toxin protein-related genes SA1833 and / or SA1832 as targets in the preparation of medicaments for treating drug-resistant Staphylococcus aureus infections, preferably, the drug resistance is methicillin resistance.

[0008] On the other hand, the present invention also relates to the use of gene knockout vectors or primers of Staphylococcus aureus toxin protein-related genes SA1833 and / or SA1832 in the preparation of medicaments for treating drug-resistant Staphylococcus aureus infections; preferably, the primer sequences are as shown in any of SEQ ID NO.1-12; preferably, the drug resistance is methicillin resistance.

[0009] Among them, the aforementioned drug-resistant Staphylococcus aureus infections include acute infections, chronic infections, and recurrent infections.

[0010] On the other hand, the present invention also relates to a pharmaceutical composition, preferably for treating drug-resistant Staphylococcus aureus infection, characterized in that the pharmaceutical composition comprises a knockout vector or primer of the Staphylococcus aureus toxin protein-related gene SA1833 and / or SA1832, and an antibiotic. Preferably, the primer sequence is as shown in any one of SEQ ID NO. 1-12.

[0011] Among them, the above-mentioned antibiotics are β-lactam antibiotics, preferably cefazolin.

[0012] On the other hand, the present invention also relates to a method for reducing the intracellular persistence of drug-resistant Staphylococcus aureus or reducing the survival rate of drug-resistant Staphylococcus aureus, characterized in that the Staphylococcus aureus toxin protein-related genes SA1833 and / or SA1832 are knocked out. In a specific embodiment of the present invention, the cells include mouse macrophages RAW264.7, but those skilled in the art will expect that they can also be used to reduce the persistence of Staphylococcus aureus in any infected cells.

[0013] Specifically, the expression of lrgA, a metabolism-related gene associated with SA1833 and / or SA1832, was downregulated by knocking out SA1833 and / or SA1832.

[0014] This also includes the design of specific gene knockout primers, as shown in SEQ ID NO. 1-12.

[0015] The aforementioned primers were used to amplify the upstream and downstream homologous arms of the target gene.

[0016] On the other hand, the present invention also relates to gene knockout vectors for knocking out SA1833 and / or SA1832, characterized in that they are pBTs recombinant vectors containing the sequences shown in any one of SEQ ID NO.33-36.

[0017] The term "persistence" is defined as a dormant variant, in which bacteria can momentarily change their physiological state under external stress by reducing metabolic activity or entering a metabolically active but non-growing state, thereby promoting bacterial survival in antibiotics.

[0018] The term "PSM" refers to a group of amphiphilic peptides with broad cytolytic activity, which are important virulence factors secreted by Staphylococcus aureus.

[0019] The term "type II TA-like element" refers to a binary system whose gene transcription mode, protein action mode, and binding to its own promoter all conform to the definition of a type II TA system, but whose toxic function does not conform to that of a type II TA element. Attached Figure Description

[0020] Figure 1 The effect of SA1833 / SA1832 on the survival of Staphylococcus aureus in cefazolin. (AD) SA1833 / SA1832 promoted the survival of Staphylococcus aureus in cefazolin. Each experiment was repeated three times, n=3, and the values ​​are presented as mean±SD. Data analysis was performed using Student's t-test. "ns" indicates not significant. In the figure, "*" indicates p<0.05, "**" indicates p<0.01, and "***" indicates p<0.001; "Δ" indicates the strain with the target gene knocked out (in later figures, "Δ" has the same meaning).

[0021] Figure 2 SA1833 / SA1832 promotes the formation of cefazolin retention in Staphylococcus aureus. (A) The antibiotic time-kill curves of strains N315, ΔSA1833, ΔSA1832, and ΔSA1833-SA1832 showed secondary killing characteristics; (B) The absence of SA1833, SA1832, and SA1833-SA1832 had no significant effect on the growth of strain N315 of Staphylococcus aureus.

[0022] Figure 3SA1833 / SA1832 deletion significantly inhibited lrgA expression. (A) SA1833-SA1832 involved in the signaling pathway; (B) RT-qPCR detection of lrgA expression. lrgA expression levels were significantly reduced in ΔSA1833, ΔSA1832, and ΔSA1833-SA1832; (C) SA1833 / SA1832 deletion downregulated lrgA expression, thereby inhibiting the growth of Staphylococcus aureus in microaerobic medium with pyruvate as the main carbon source. Each experiment was repeated three times, n=3, and the numerical values ​​were presented as mean±SD. Data analysis was performed using Student's t-test. "ns" indicates not significant. In the figure, "*" indicates p<0.05, "**" indicates p<0.01, "***" indicates p<0.001, and "****" indicates p<0.0001.

[0023] Figure 4 This is the result of EMSA testing. SA1833 can bind to the promoter of the lrgA gene.

[0024] Figure 5 To investigate the lrgA-dependent regulation of Staphylococcus aureus retention by SA1833 / SA1832. (A) LrgA deletion significantly reduced the survival of Staphylococcus aureus in cefazolin. (B) LrgA restoration restored the survival of SA1833-SA1832 deletion strains under cefazolin treatment. (C) The cefazolin-induced antibiotic killing curve of lrgA-deleted strains exhibited a two-stage killing characteristic. Each experiment was repeated three times (n=3), and the values ​​were presented as mean ± SD. Data analysis was performed using Student's t-test. "ns" indicates no significance. In the figures, "*" indicates p<0.05, "**" indicates p<0.01, and "***" indicates p<0.001.

[0025] Figure 6The study investigated how SA1833 / SA1832 regulates the survival of *S. aureus* under dual stress conditions of macrophage intracellular stress and cefazolinum oxime in a lrgA-dependent manner. (A, B) SA1833 / SA1832 / lrgA deficiency weakens the ability of *S. aureus* to infect macrophages; (C, D) SA1833 / SA1832 regulates the survival of strain N315 in RAW264.7 macrophages via a lrgA-dependent pathway; (E, F) SA1833 / SA1832 / lrgA deficiency weakens the survival of strain N315 under dual stress conditions of macrophage intracellular stress and cefazolinum oxime. Each experiment was repeated three times (n=3), and numerical values ​​are presented as mean ± SD. Data analysis was performed using Student's t-test. "ns" indicates no significance. In the figure, "*" indicates p < 0.05, "**" indicates p < 0.01, "***" indicates p < 0.001, and "****" indicates p < 0.0001.

[0026] Figure 7 This is a plasmid map of the pALC vector. Detailed Implementation

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. For example, experimental methods not specifically indicated in the examples are based on: Pan Ting. Molecular mechanism of Staphylococcus aureus pyrophosphatase LcpB regulating cell wall synthesis and virulence [D]. University of Science and Technology of China, 2023. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0029] Example

[0030] Example 1: Construction of SA1833, SA1832, SA1833-SA1832 mutants and complement strains

[0031] (1) Construction of SA1833 (its NCBI gene accession number is SA1833), SA1832 (its NCBI gene accession number is SA1832), SA1833-SA1832 and lrgA knockout vectors.

[0032] Using conventional methods, the genome of Staphylococcus aureus N315 (referencing the NARSA published sequence) was used as a template. The upstream and downstream homologous arms (approximately 750 bp each) of SA1833 were amplified using primers SA1833-up-F (SEQ ID NO.1) / SA1833-up-R (SEQ ID NO.2) and SA1833-down-F (SEQ ID NO.3) / SA1833-down-R (SEQ ID NO.4), respectively. The upstream and downstream homologous arms were then ligated to the target gene using overlap PCR. The gel was extracted using the StarPrep Gel Extraction Kit (GenStar, D205-04, method according to kit instructions). The spliced ​​fragment was ligated to the linearized plasmid pBTs (KL-ZL-0864-01) using the homologous recombinase ClonExpress II (Vazyme, C112-01) to form the pBTs-up-SA1833-down recombinant vector, i.e., the SA1833 knockout vector.

[0033] The method for constructing the SA1832 knockout vector is the same as that for constructing the SA1833 knockout vector, except that the primers are replaced with SA1832-up-F (SEQ ID NO.5) / SA1832-up-R (SEQ ID NO.6) and SA1832-down-F (SEQ ID NO.7) / SA1832-down-R (SEQ ID NO.8) to amplify the SA1832 homologous arm.

[0034] The method for constructing the SA1833-SA1832 knockout vector is the same as the method for constructing the SA1833 knockout vector, except that the primers are replaced with SA1833-SA1832-up-F (SEQ ID NO. 9) / SA1833-SA1832-up-R (SEQ ID NO. 10) and SA1833-SA1832-down-F (SEQ ID NO. 11) / SA1833-SA1832-down-R (SEQ ID NO. 12) to amplify the SA1833-SA1832 homologous arm.

[0035] The method for constructing the lrgA knockout vector is the same as that for constructing the SA1833 knockout vector, except that the primers are replaced with lrgA-up-F (SEQ ID NO.13) / lrgA-up-R (SEQ ID NO.14) and lrgA-down-F (SEQ ID NO.15) / lrgA-down-R (SEQ ID NO.16) to amplify the lrgA homologous arm.

[0036] (2) Construction of SA1833, SA1832, SA1833-SA1832 and lrgA replenishment vectors

[0037] Using the Staphylococcus aureus N315 genome as a template, the gene fragment p(SA1833)-SA1833 containing the SA1833 promoter was amplified using primers SA1833-(com)-F (SEQ ID NO.17) / SA1833-(com)-R (SEQ ID NO.18) via conventional methods. Restriction endonucleases (Thermo Fisher Scientific, FastDigest EcoRI: FD0274, FastDigest PstI: FD0614) were used to inhibit p(SA1833)-SA1833 and the pALC vector (sequence map shown in Figure 1). Figure 7 The vector pALC was double-digested (as shown). The gel was recovered using the StarPrep Gel Extraction Kit (method according to the kit instructions). The linearized vector pALC was ligated with the digested fragment p(SA1833)-SA1833 (SEQ ID NO.37) using T4 ligase (Thermo Fisher Scientific, EL0011) to form the pALC-p(SA1833)-SA1833 recombinant plasmid, i.e., the SA1833 complement plasmid.

[0038] The method for constructing the SA1832 complement plasmid is the same as that for constructing the SA1833 complement plasmid, except that the primers are replaced with SA1832-(com)-F(SEQ ID NO.19) / SA1832-(com)-R(SEQ ID NO.20) and SA1833-pro-(com)-F(SEQ ID NO.21) / SA1833-pro-(com)-R(SEQ ID NO.22) to amplify the SA1832 gene fragment p(SA1833)-SA1832(SEQ ID NO.38) containing the SA1833 promoter.

[0039] The construction method of the SA1833-SA1832 complement plasmid is the same as that of the SA1833 complement plasmid, except that the primers are replaced with SA1833-SA1832-(com)-F(SEQ ID NO.23) / SA1833-SA1832-(com)-R(SEQ ID NO.24) to amplify the gene fragment p(SA1833)-SA1833-SA1832(SEQ ID NO.39) containing the SA1833-SA1832 promoter.

[0040] SA1832 and SA1833 share the same promoter (i.e., p(SA1833)). SA1833-SA1832 are co-transcribed genes. Therefore, when preparing the SA1832 complement plasmid, primers are needed to amplify the promoter p(SA1833) additionally.

[0041] The construction method of the lrgA complement plasmid is the same as that of the SA1833 complement plasmid, except that the primers are replaced with lrgA-(com)-F (SEQ ID NO.25) / lrgA-(com)-R (SEQ ID NO.26) to amplify the gene fragment p(lrgA)-lrgA (SEQ ID NO.40) containing the lrgA promoter.

[0042] (3) Genetic transformation and screening of Staphylococcus aureus

[0043] The plasmids prepared in the above steps were mixed with pre-prepared Staphylococcus aureus competent cells and incubated on ice for 30 minutes to complete the cell transformation and screening.

[0044] Example 2: Disruption of SA1833 / SA1832 weakens the survival ability of Staphylococcus aureus in cefazolin.

[0045] To explore the molecular mechanism by which SA1833 / SA1832 regulates the persistence of Staphylococcus aureus under cefazolin treatment, this invention used MRSA strain N315 (obtained from NARSA, NRS70) as the background strain and constructed SA1833, SA1832 and SA1833-SA1832 knockout strains through homologous recombination as described in Example 1, and tested their survival ability under cefazolin antibiotic treatment.

[0046] The SA1833 / SA1832 knockout strains prepared in Example 1 were streaked onto TSB solid medium (BD-Difco, 228200) and incubated overnight at 37°C with the medium inverted. Six single-clonal colonies were then picked and inoculated onto TSB liquid medium (BD-Difco, 214886) and incubated overnight with shaking at 37°C. To determine the growth status of the strains, OD200 was selected. 600 Three bacterial colonies with similar OD values ​​were transferred to 5 mL of TSB liquid medium and the bacterial concentration was adjusted to OD0.05. 600The bacterial culture was incubated at 37°C and 220 rpm with shaking for 3 hours, with an OD value between 0.5 and 0.8. The collected bacterial culture was centrifuged at 12000g and 4°C for 2 minutes, the supernatant was removed, and the bacterial cells were collected. The collected bacterial cells were washed three times with TSB liquid medium and resuspended. The three groups of bacterial cultures were then adjusted to the same concentration using TSB liquid medium. 100 μL of the bacterial culture was added to a 96-well plate, followed by 100 μL of a sublethal concentration (40 μg / mL) of antibiotic. The culture was then incubated at 37°C for 24 hours. After incubation, the bacterial culture was transferred to EP tubes, centrifuged at 5000g and 4°C for 5 minutes, the supernatant was removed, and the bacterial cells were collected. After washing the bacterial cells 2-3 times with PBS, resuspend the cells in an equal volume of PBS, perform serial dilutions, and spread them onto LB agar plates (1L of medium requires 10g Tryptone, 10g NaCl, 5g Yeast extract, and 15g Agar). Incubate overnight at 37°C upside down, count the cells, and calculate the viability. The calculation formula is shown below:

[0047] Survival rate = (Number of CFUs of bacteria under antibiotic treatment / Number of CFUs under no antibiotic treatment) × 100%.

[0048] The results of antibiotic treatment survival experiments on Staphylococcus aureus showed that the survival rate of Staphylococcus aureus with SA1833 / SA1832 deletion was significantly reduced under sublethal concentration (40 μg / mL) of cefazolin. Figure 1 A), and after the corresponding gene was reintroduced into the SA1833 / SA1832 mutant, the survival ability of Staphylococcus aureus under cefazolin antibiotic treatment was restored. Figure 1 (B, D). The above results indicate that SA1833 / SA1832 is involved in regulating the survival of Staphylococcus aureus under sublethal concentrations of cefazolin antibiotics.

[0049] Example 3: SA1833 / SA1832 promotes the retention of Staphylococcus aureus under cefazolin treatment.

[0050] To further verify the role of SA1833 / SA1832 in regulating the persistence of Staphylococcus aureus against cefazolin, this example tested the sensitivity of Staphylococcus aureus to cefazolin after SA1833 / SA1832 was knocked out, the antibiotic time-kill curve of the knockout strain, and the growth curve under aerobic conditions.

[0051] The SA1833 / SA1832 knockout strains prepared in Example 1 were streaked on TSB solid medium and incubated overnight at 37°C with the medium inverted. Ten single-clonal colonies were then picked and resuspended in MH2 liquid medium (BD-Difco, 212322). The OD was adjusted. 600 After reaching 0.2, dilute 100 times and inoculate 75 μL of bacterial culture into 96-well plates. To determine the maximum concentration of antibiotic required, different concentrations (0.125 μg / mL-4 mg / mL) of antibiotic were prepared in MH2 medium. 75 μL of each concentration of antibiotic was mixed with an equal volume of bacterial culture, and the mixture was incubated at 37°C with shaking for 24-48 hours. Observation and counting were then performed to obtain the minimum antibiotic concentration (MIC) that inhibits bacterial growth.

[0052] Table 1. Antibiotic susceptibility testing of gene knockout strains

[0053]

[0054] △: Strains with the target gene knocked out

[0055] The results of the cefazolin susceptibility test showed that the MIC of N315 was 2 mg / mL, and the MICs of ΔSA1833, ΔSA1832 and ΔSA1833ΔSA1832 were 2 mg / mL (Table 1). The MIC values ​​of the knockout strains were not different from those of the wild-type strains, indicating that SA1833 / SA1832 do not participate in regulating the resistance of Staphylococcus aureus to cefazolin.

[0056] The SA1833 / SA1832 knockout strains prepared in Example 1 were streaked onto TSB solid medium and incubated overnight at 37°C with the medium inverted. Six single-clonal bacterial colonies were then picked and inoculated onto TSB liquid medium, and incubated overnight at 37°C with shaking. To determine the bacterial growth status, three OD values ​​were selected. 600 Bacterial colonies with similar OD values ​​were transferred to 10 mL of TSB liquid medium and cultured at 37°C and 220 rpm until the pre-log phase (OD value 0.5-0.8). After centrifugation at 4°C and 5000 g for 15 min, the bacteria were collected, resuspended in TSB liquid medium, and the cell concentration was adjusted to the appropriate OD value. 600 2. Sublethal concentration (40 μg / mL) of cefazolin was added to the bacterial culture medium and cultured at 37°C and 200 rpm. Samples were taken every 2 hours for a total of 5 times. The sampled cells were then collected by centrifugation at 8000g for 3 min at 4°C, washed three times with PBS, resuspended in an equal volume of PBS, diluted, plated, and incubated overnight at 37°C. The bacterial colony count was calculated, and a killing curve was plotted using Prism software (Graphpad).

[0057] The SA1833 / SA1832 knockout strains prepared in Example 1 were streaked onto TSB solid medium and incubated overnight at 37°C with the medium inverted. Six monoclonal colonies were picked and inoculated into TSB liquid medium, and incubated overnight at 37°C with shaking. To determine the growth status of the strains, OD200 was selected. 600 Three bacterial clonal communities with similar values ​​were selected, and the bacterial culture concentration was adjusted to OD0.05. 600 The initial concentration of the bacterial culture was set to 0.05, and the adjusted bacterial culture was added to each well of a 96-well plate at 150 μL. The plates were then incubated at 37°C with shaking for 12 hours. If the growth curve under microaerobic conditions was to be determined, the bacteria from three clonal communities with similar growth states were transferred to anaerobic bottles containing 10 mL of CDM medium (pyruvate as the main carbon source, specific preparation reference: Hussain M, Hastings JG, White PJ. A chemically defined medium for slime production by coagulase-negative staphylococci. J Med Microbiol. 1991 Mar; 34(3): 143-7.) and the initial concentration of the bacterial culture was adjusted to OD. 600 The value was 0.05, and the OD of the bacterial culture was measured using an enzyme-linked immunosorbent assay (ELISA) reader. 600 Value. Samples were taken and tested at 2-hour intervals until the bacteria reached the plateau phase (26 hours in this example), and growth curves were plotted using Prism software (GraphPad). Figure 3 C).

[0058] The results of the antibiotic time-kill curve test showed that the SA1833 / SA1832 mutant strain exhibited a secondary killing characteristic under sublethal concentrations of antibiotics (referring to the rapid killing effect in a short period of time and the slow and continuous killing effect in a long period of time, which shows the result of the game between the rate of bacterial death and the rate of growth under sublethal concentrations of antibiotics). Figure 2 A) indicates that this gene is not involved in regulating the tolerance of Staphylococcus aureus to cefazolin. Growth curve results show that SA1833 / SA1832 has no effect on the growth ability of Staphylococcus aureus under aerobic conditions with glucose as the primary carbon source, thus ruling out the possibility that the knockout of SA1833 / SA1832 would affect its growth ability and thus inhibit its survival under cefazolin treatment. Figure 2 B). Figure 2B ruled out the effect of knocking out SA1833 / SA1832 at sublethal concentrations on bacterial growth capacity, thus proving that SA1833 / SA1832 is involved in regulating the retention of Staphylococcus aureus on cefazolin, demonstrating that knocking out the gene achieves the killing effect of Staphylococcus aureus by reducing bacterial retention.

[0059] Example 4. SA1833 / SA1832 positively regulates lrgA expression

[0060] This invention utilizes the RNA-seq method to explore downstream target genes regulated by SA1833 / SA1832.

[0061] First, the SA1833 / SA1832 knockout strains prepared in Example 1 were streaked onto TSB solid medium and incubated overnight at 37°C with the medium inverted. Single colonies were picked and inoculated into TSB liquid medium, and activated by shaking and incubation overnight at 37°C. The activated bacterial culture was then transferred to fresh TSB liquid medium, and the initial inoculum concentration was adjusted to OD0.05. 600 The concentration was 0.05, and the cells were incubated in a shaker at 37°C until the pre-log phase. The 2OD was collected by centrifugation at 4°C and 12000g. 600The bacterial culture was collected by centrifugation. 1 mL of RNA isoPlus (Takara, 9108) was added to the bacterial pellet, and the cells were resuspended. The suspension was then transferred to a disruption tube containing 0.6 g of zirconium oxide-silica beads. Since Staphylococcus aureus is a Gram-positive bacterium with a thick cell wall, a high-speed shaking disruption device (Fastprep-24cell) was used for cell disruption, performed twice with a 5-minute interval between disruptions, during which the sample was placed on ice. Disruption parameters: speed 6 m / s, time 40 s. 300 μL of chloroform was added to the cells, and the mixture was vigorously shaken and centrifuged at 4°C and 12000 g for 30 min. 500 μL of isopropanol was added to a pre-prepared RNase-free EP tube, and the upper aqueous phase was aspirated and added to the EP tube containing isopropanol. After inverting and mixing, the tube was frozen overnight at -80°C to precipitate RNA. After removing the sample and placing it on ice to thaw, centrifuge at 4°C and 12000g for 30 min to remove the liquid and obtain RNA precipitate. Add 1 ml of 75% ethanol to the centrifuge tube and centrifuge at 4°C and 12000g for 10 min to remove the supernatant. Repeat this operation once. Then, centrifuge the EP tube rapidly at 4°C and 12000g for 30 s to remove residual liquid. Let it stand on ice until the precipitate becomes clear, and add RNase-free water (approximately 60 μL) to dissolve the RNA. Perform mRNA reverse transcription using the PrimeScript RT reagent Kit (Takara, RR037Q). Please refer to the kit instructions for detailed steps. Afterward, perform real-time quantitative PCR detection. The internal control primer sequences used are shown in SEQ ID NO. 27 and 28.

[0062] This invention utilizes RNA-seq to explore downstream target genes regulated by SA1833 / SA1832. Results showed that disrupting SA1833-SA1832 significantly altered the expression levels of genes related to metabolism, pathogenicity, and processing of environmental signals in Staphylococcus aureus. Figure 3A), and changes in bacterial metabolic pathways are closely related to retention formation. Among them, it has been reported that lrgA can participate in the regulation of pyruvate transport in Staphylococcus aureus under anaerobic conditions (The Staphylococcus aureus CidA and LrgAProteins Are Functional Holins Involved in the Transport of By-Products of Carbohydrate Metabolism. mBio. 2021 Feb 22; 13(1):e0282721.), and has also been reported to participate in the regulation of bacterial oxidative stress tolerance (Identification of the Streptococcus mutans LytST two-componentregulon reveals its contribution to oxidative stress tolerance. BMCMicrobiol. 2012; 12:187. Published 2012 Sep 1.). Since surviving bacteria are a subgroup of tolerant bacteria, the mechanism of bacterial tolerance may also affect the formation of bacterial surviving. Therefore, in this embodiment of the invention, the metabolism-related gene lrgA was selected as the downstream target gene regulated by SA1833 / SA1832 for subsequent analysis. RT-qPCR results showed that disruption of SA1833 / SA1832 significantly reduced lrgA expression. Figure 3 B). It is known that lrgA can mediate the transport of pyruvate, a carbon metabolism byproduct of bacteria, under microaerobic conditions. To further verify the regulation of lrgA by SA1833 / SA1832, this invention also detected the growth curves of Staphylococcus aureus under microaerobic conditions with pyruvate as the main carbon source. The growth curve results under microaerobic conditions show that the growth of Staphylococcus aureus under microaerobic conditions with pyruvate as the main carbon source was significantly inhibited after the deletion of SA1833 / SA1832. Figure 3 C). The above results suggest that SA1833 / SA1832 may regulate the retention of cefazolin by Staphylococcus aureus by positively regulating the expression of lrgA, but whether this regulation is direct or indirect needs further verification.

[0063] Example 5. SA1833 / SA1832 can directly regulate lrgA expression.

[0064] This invention uses gel electrophoretic migration rate (EMSA) to detect the regulatory mechanism of SA1833 on lrgA.

[0065] Primers (SEQ ID NO. 29, 30) were designed by selecting a region (100-200 bp) containing the promoter of the target gene, and a 6-FAM fluorescent group was labeled on the 5' phosphate backbone of the downstream primer. The primers were used in a light-protected environment. MaxDNA Polymerase (TaKaRa, R045A) was used to amplify the DNA probe fragment (SEQ ID NO. 41) using the N315 genome as a template. The fluorescent probe was recovered by electrophoresis (100V, photophoresis in the dark for 20 min). A 5% non-denaturing polyacrylamide gel (PAGE) was prepared and incubated at 4°C for later use.

[0066] Add 4 μL of EMSA binding reaction buffer (100 mM HEPES (pH 7.6), 5 mM EDTA, 50 mM (NH4)2SO4, 5 mM DTT, 1% Tween-20, and 150 mM KCl) to each reaction tube, along with 1 ng of DNA, the fluorescent probe prepared in the above steps, and protein at gradient concentrations (0, 0.38, 0.77, 1.53, and 3.07 fmol). Add the specific competitive probe (Unlabeled P) to the reaction tube with the highest protein concentration (3.07 fmol). lrgA (i.e., the above-mentioned DNA probe without fluorescent tag) or non-specific competitive probe (hu) (SEQ ID NO.42, whose probe primer sequence is shown in SEQ ID NO.31, 32) was used as a control. The system was made up to 20 μL with PBS and incubated at 25°C for 20 min.

[0067] Take out 5% PAGE gel, place the gel plate into the electrophoresis tank, add pre-cooled 1×TBE, and perform pre-electrophoresis at 4℃ and 100V for 15 min. After the above incubation, add 5 μL of 5×Gel-shift loading buffer (0.25×TBF, 34% Glycerol, + / - 0.2 (W / V) bromophenol blue) to each reaction tube, mix well, and inject into the wells for loading. Electrophoresis is performed at 90V for 1 hour at 4℃ in the dark. After electrophoresis, the gel blocks are scanned and observed using a near-infrared fluorescence scanning imager.

[0068] The results showed that SA1833 can directly bind to the promoter of lrgA ( Figure 4 This indicates that SA1833 can directly regulate the expression of lrgA, thereby regulating the cefazolin retention formation in Staphylococcus aureus.

[0069] Example 6. SA1833 / SA1832 regulates the formation of cefazolin retention in Staphylococcus aureus via an lrgA-dependent pathway.

[0070] To further confirm that SA1833 / SA1832 promotes the formation of cefazolin retention in Staphylococcus aureus by regulating lrgA expression, this invention constructed lrgA knockout mutants and lrgA-SA1833-SA1832 knockout mutants using clinically derived N315 as the background strain.

[0071] First, the mutant strains described above were constructed using the knockout vectors prepared in Example 1, following conventional methods. Then, the survival ability and secondary killing curves of the lrgA mutant strain and the lrgA-SA1833-SA1832 mutant strain in sublethal concentrations of cefazolin were analyzed using the same methods as in Examples 2 and 3.

[0072] The results of the survival test in sublethal concentrations of cefazolin showed that the survival ability of Staphylococcus aureus in cefazolin was significantly weakened after lrgA deletion; the survival ability of ΔlrgA-SA1833-SA1832 was also significantly reduced compared with ΔSA1833-SA1832; while the survival ability of ΔlrgA was not significantly different from that of ΔlrgA-SA1833-SA1832. Figure 5 A). Adding lrgA to the SA1833-SA1832 mutant strain restored the survival ability of Staphylococcus aureus under cefazolin treatment. Figure 5 B). Furthermore, the cefotaxime sensitivity test results for the lrgA mutant strain showed that the MIC of ΔlrgA was 2 mg / mL, consistent with the wild type (Table 1). The cefotaxime time-kill curve results of the lrgA mutant strain exhibited secondary killing characteristics. Figure 5 C) This ruled out possible interference from tolerance. These results indicate that SA1833 / SA1832 promotes the persistence of Staphylococcus aureus under cefazolin treatment by upregulating lrgA transcription levels.

[0073] Example 7. SA1833 / SA1832 can promote the survival of Staphylococcus aureus under the dual stress of macrophage intracellular and cefazolin antibiotics, and this process depends on lrgA.

[0074] To further verify the result that the SA1833 / SA1832 mutant has reduced cefazolin retention, the ability of Staphylococcus aureus to infect mouse macrophages RAW264.7 (Wuhan Pronosei Biotechnology Co., Ltd., CL-0190) was tested, as were the macrophages' intracellular survival ability and their survival ability under the dual stress of intracellular environment and cefazolin antibiotic.

[0075] With 5×10 5RAW264.7 cells were seeded at a concentration of 12 mL DMEM (gibco, C11995500BT) in 10 cm culture dishes and cultured at 37°C and 5% CO2. When the cells were undifferentiated and the cell density reached 80%-90%, most of the culture medium was removed, and the cells were resuspended by pipetting the bottom of the dish with the remaining medium. Fresh DMEM was added to dilute the cells, and the cells were counted using a hemocytometer to adjust the cell concentration to 3 × 10⁻⁶ cells / mL. 6 Cells / mL; 1 mL of cell suspension was added to a 12-well cell culture plate and cultured for 1 hour in an incubator set to 5% CO2 and 37°C to promote cell adhesion. The SA1833 / SA1832 knockout strains prepared in the above examples were streaked on TSB solid medium plates, and single colonies were picked and inoculated into TSB liquid medium. After one generation of activation, they were transferred to fresh TSB liquid medium and cultured with shaking at 37°C until the pre-log phase. The cells were centrifuged at 12000g for 2 min at 4°C, the supernatant was removed, and the bacteria were collected. After washing three times with PBS, the cells were resuspended in DMEM medium, and the bacterial concentration (OD) was adjusted. 600 The concentration was 0.3. 1 mL of bacterial culture was added to each well of a cell culture plate to infect RAW264.7 cells at an MOI of 50, and incubated at 37°C in a 5% CO2 incubator for 1 hour. After infection, the culture medium was removed, and 500 μL of 100 μg / mL gentamicin was added. The plate was then incubated at 37°C for 2 hours to kill extracellular bacteria. Afterward, the cells were washed three times with PBS, resuspended in PBS, and divided into two aliquots for later use.

[0076] Centrifuge at 1000g for 5 min at 4℃, remove supernatant, and add 1 mL of cell lysis buffer (10 mM EDTA, 0.25% Triton-X 100 in PBS solution) to one cell sample. Mix well by pipetting to promote lysis of infected RAW264.7 cells, dilute with PBS, and plate. Incubate overnight at 37℃ upside down, and count the number of CFUs as the initial clone number. Add an equal volume of DMEM medium to the other cell sample to resuspend the cells. Spread the cells in 24-well cell culture plates and incubate at 37℃ for 24 hours with 5% CO2 to detect bacterial viability in RAW264.7 cells. Simultaneously, to detect intracellular antibiotic retention, add a sublethal concentration of antibiotic to the 24-well plates and incubate at 37℃ for 24 hours. After 24 hours of antibiotic treatment, the supernatant was removed and 1 mL of cell lysis buffer was added to each well to promote cell lysis. After dilution with PBS and plating, the cells were incubated overnight at 37°C with the plates inverted. The number of bacterial CFUs after intracellular treatment was calculated, and the intracellular survival rate and intracellular retention capacity of the bacteria were further calculated.

[0077] Infection assay results showed that the absence of SA1833 / SA1832 reduced the ability of Staphylococcus aureus to infect macrophages. Figure 6 A), and this process depends on the expression of lrgA; knocking out lrgA significantly reduces the ability of Staphylococcus aureus to infect macrophages. Figure 6 B). Subsequently, the viability of Staphylococcus aureus in macrophages was examined, and the results showed that the viability of ΔSA1833 / SA1832 in macrophages was significantly reduced regardless of the presence or absence of cefazolin treatment. Figure 6 C, D), and SA1833 / SA1832 regulates the formation of cefazolin retention in a lrgA-dependent manner ( Figure 6 E, F). The above results indicate that SA1833 / SA1832 can influence the retention of Staphylococcus aureus on cefazolin by regulating lrgA expression, thereby helping Staphylococcus aureus adapt to intracellular pressure stress in macrophages and achieve immune escape. Furthermore, it can promote the survival of Staphylococcus aureus during cefazolin treatment, leading to recurrent chronic infections. Therefore, SA1833 / SA1832 can be used as a target in the preparation of drugs for treating recurrent methicillin-resistant Staphylococcus aureus infections.

[0078] In summary, upregulation of lrgA expression promotes Staphylococcus aureus persistence, thereby enhancing its survival under oxidative stress and cefazolin antibiotic stimulation, indicating that SA1833 / SA1832 has the potential to be a target for treating recurrent Staphylococcus aureus infections. This invention uses a clinically derived methicillin-resistant strain N315 as the research subject. Results show that disrupting SA1833 / SA1832 weakens the survival ability of Staphylococcus aureus in sublethal concentrations of cefazolin. Furthermore, the cefazolin sensitivity of Staphylococcus aureus remains unchanged after SA1833 / SA1832 deletion, and the antibiotic-time killing curve of Staphylococcus aureus shows a secondary killing characteristic, indicating that SA1833 / SA1832 promotes the formation of cefazolin persistence in Staphylococcus aureus. Downstream target genes regulated by SA1833 / SA1832 were preliminarily identified using RNA-seq technology. This patent selected the gene lrgA, whose expression level changed significantly, for further research. Preliminary verification was performed using RT-qPCR, which showed that SA1833 / SA1832 positively regulates lrgA expression. Further verification using microaerial growth curves of *Staphylococcus aureus* showed that the growth of *Staphylococcus aureus* under microaerial and pyruvate-based carbon source conditions was significantly slowed after the deletion of SA1833 / SA1832, consistent with the RT-qPCR results. EMSA results showed that SA1833 can directly bind to the promoter of lrgA to regulate its expression. The survival ability of ΔlrgA in sublethal concentrations of cefazolinum, the antibiotic sensitivity test for cefazolinum, and the time-kill curve all further confirmed that SA1833 / SA1832 promotes the formation of cefazolin persistence in *Staphylococcus aureus* by upregulating the transcriptional level of lrgA. Results of Staphylococcus aureus (S. aureus) infection of RAW264.7 macrophages showed that knockout of SA1833, SA1832, and SA1833-SA1832 significantly reduced the ability of S. aureus to infect macrophages. Intracellular persistence assays showed that the intracellular survival of ΔSA1833 / SA1832 was significantly reduced regardless of the presence or absence of cefazolinum treatment. These results suggest that SA1833 / SA1832 can promote S. aureus adaptation to the host cell's intracellular stress environment, promoting the formation of persistent bacteria, thereby leading to chronic, recurrent infections. This patent elucidates the molecular mechanism by which the Staphylococcus aureus toxin protein SA1833 / SA1832 regulates the formation of S. aureus persistence, thus providing a new target for the development of drugs to treat recurrent infections caused by clinical MRSA strains and offering more treatment options for S. aureus.

[0079] sequence list

[0080] SEQ ID NO.1: SA1833-up-F

[0081] ACGCGTCGACTCCTAGTGATATACGATAGCG

[0082] SEQ ID NO.2:SA1833-up-R

[0083] GTTGAACATTGGTTTATGCAGTCATAATTAAAATCCTCC

[0084] SEQ ID NO.3:SA1833-down-F

[0085] GCATAAACCAATGTTCAAC

[0086] SEQ ID NO.4:SA1833-down-R

[0087] CGGGGTACCGCCAACCATTACTATCCTT

[0088] SEQ ID NO.5:SA1832-up-F

[0089] ACGCGTCGACTTCAGAAACATACCCACTTA

[0090] SEQ ID NO.6:SA1832-up-R

[0091] CAAATATAAGTTAAGTACATTTTGGTTTATGCCTCCTTTAC

[0092] SEQ ID NO.7:SA1832-down-F

[0093] AAATGTACTTAACTTATATTTG

[0094] SEQ ID NO.8:SA1832-down-R

[0095] CGGGGTACCTTAACCAACTTACTCCATTCAG

[0096] SEQ ID NO.9:SA1833-SA1832-up-F

[0097] ACGCGTCGACTCCTAGTGATATACGATAGCG

[0098] SEQ ID NO.10:SA1833-SA1832-up-R

[0099] CTCTTTCGCTAATTCGTCCGACTGACTTCTCAATCAT

[0100] SEQ ID NO.11:SA1833-SA1832-down-F

[0101] GACGAATTAGCGAAAGAG

[0102] SEQ ID NO.12:SA1833-SA1832-down-R

[0103] CGGGGTACCTGCCAACCATTACTATCCT

[0104] SEQ ID NO.13:lrgA-up-F

[0105] GCGGAATTCGAGCTCGGTACCGTAAAAGAAACATTGGAAGCA

[0106] SEQ ID NO.14:lrgA-up-R

[0107] TGCCTCCTACGTTTGATT

[0108] SEQ ID NO.15:lrgA-down-F

[0109] AATCAAACGTAGGAGGCACCACTTAGCACTAAACAC

[0110] SEQ ID NO.16:lrgA-down-R

[0111] CTTGCATGCCTGCAGGTCGACATATCCCAGTTATAAACTGGA

[0112] SEQ ID NO.17:SA1833-(com)-F

[0113] ACGACGGCCAGTGAATTCATTCTGAAGGAGATATGTGCA

[0114] SEQ ID NO.18:SA1833-(com)-R

[0115] AAGCTTGCATGCCTGCAGGGTTTATGCCTCCTTTAC

[0116] SEQ ID NO.19:SA1832-(com)-F

[0117] ACCAATGTTCAACATTAATATTGA

[0118] SEQ ID NO.20:SA1832-(com)-R

[0119] AAGCTTGCATGCCTGCAGACATTTTCATTGCCTTGC

[0120] SEQ ID NO.21:SA1833-pro-(com)-F

[0121] ACGACGGCCAGTGAATTCATTCTGAAGGAGATATGTGCA

[0122] SEQ ID NO.22:SA1833-pro-(com)-R

[0123] TCAATATTAATGTTGAACATTGGTAATTAAAATCCTCCTTCGTTT

[0124] SEQ ID NO.23:SA1833-SA1832-(com)-F

[0125] ACGACGGCCAGTGAATTCATTCTGAAGGAGATATGTGCA

[0126] SEQ ID NO.24:SA1833-SA1832-(com)-R

[0127] AAGCTTGCATGCCTGCAGACATTTTCATTGCCTTGC

[0128] SEQ ID NO.25:lrgA-(com)-F

[0129] ACGACGGCCAGTGAATTCGAGCCATTGAATCGTTATGAA

[0130] SEQ ID NO.26:lrgA-(com)-R

[0131] AAGCTTGCATGCCTGCAGTTAATCATGAGCTTGTGCCTCC

[0132] SEQ ID NO.27:pta-F

[0133] AAAGCGCCAGGTGCTAAATTAC

[0134] SEQ ID NO.28:pta-R

[0135] CTGGACCAACTGCATCATATCC

[0136] SEQ ID NO.29:P lrgA -F

[0137] AAAGAAGTGCAACAATGGTTT

[0138] SEQ ID NO.30:P lrgA -R

[0139] TGCCTCCTACGTTTGATT

[0140] SEQ ID NO.31:P hu -F

[0141] AAAAAGAAGCTGGTTCAGCAGTAG

[0142] SEQ ID NO.32:P hu -R

[0143] TTTACGTGCAGCACGTTCAC

[0144] SEQ ID NO.33:down-SA1833-up sequence

[0145]

[0146] SEQ ID NO.34: down-SA1832-up gene fragment

[0147]

[0148] SEQ ID NO.35: down-SA1833-SA1832-up gene fragment

[0149]

[0150] SEQ ID NO.36: down-lrgA-up gene fragment

[0151]

[0152] SEQ ID NO.37: p(SA1833)-SA1833 gene fragment

[0153] GGTTTATGCCTCCTTTACTTCAAATTCAAATAATTCATTTACCTCAACTTGTAAAACTTCTGCCATTTTCTTAGCTAATTTAGGGCTTGGAATCTTTTTACCATTAATAATTTGGCTTAAATAAGAAATTCCAACACCTGTTTCACGTGATAAATCAGATAAATTAAAGCCTTTTAAGAACATGGCTTCTTTAAACTTTCTAGTATTCGCTAAAATAGTCATAATTAAAATCCTCCTTCGTTTTTGACTGACTTCTCAATCAATTTATAACTTTATTATACATAATCGTTTTTCTTTTGCAATAGTTTTTCGACTGACTTCTCAATCATTTTTTATTTTTTTGTACATAAACGTCCAAAAAAATGCTATTATTAACATAATTAGGAGGTTTGTAATGATTAGAAATAGATTGTCTGAACTACTGTCAGAAAGAGGACTAAAAATATCTCGTGTTGCAAAAGATGTAAAAATAGCAAGAAGTTCACTTACTTCAATGGCACAAAATGATTCTGAAATGATAAGATATGATGCTATAGATAAATTATGTAGTTATCTGCACATATCTCCTTCAGAAT

[0154] SEQ ID NO.38: p(SA1833)-SA1832 gene fragment

[0155] ACATTTTCATTGCCTTGCCTCCAATAACTTTTTGATATTGACTTGTTTAAAGTCGTTATTCTGGATATTCATATGAGCAGTAAGCTGTTCCATGAATTCATCTACATCAGACTTTTTGAATCTATACGTAGATCCGACCATATAATATTTCATGCCATTATTAATAAGTAATTCTTCAATAGTAGGCTTACTTAAATTCAGATAGTTAGACAACTCTTTGTAAGTCATAAAATATTTCTCTTTCGCTAATTCGTCCACACGTGCATTGATAGCCTGCTCAAGTAACTCACGTGCTTCATCTTCATCAATATTAATGTTGAACATTGGTAATTAAAATCCTCCTTCGTTTTTGACTGACTTCTCAATCAATTTATAACTTTATTATACATAATCGTTTTTCTTTTGCAATAGTTTTTCGACTGACTTCTCAATCATTTTTTATTTTTTTGTACATAAACGTCCAAAAAAATGCTATTATTAACATAATTAGGAGGTTTGTAATGATTAGAAATAGATTGTCTGAACTACTGTCAGAAAGAGGACTAAAAATATCTCGTGTTGCAAAAGATGTAAAAATAGCAAGAAGTTCACTTACTTCAATGGCACAAAATGATTCTGAAATGATAAGATATGATGCTATAGATAAATTATGTAGTTATCTGCACATATCTCCTTCA

[0156] SEQ ID NO.39: p(SA1833)-SA1833-SA1832 gene fragment

[0157] ACATTTTCATTGCCTTGCCTCCAATAACTTTTTGATATTGACTTGTTTAAAGTCGTTATTCTGGATATTCATATGAGCAGTAAGCTGTTCCATGAATTCATCTACATCAGACTTTTTGAATCTATACGTAGATCCGACCATATAATATTTCATGCCATTATTAATAAGTAATTCTTCAATAGTAGGCTTACTTAAATTCAGATAGTTAGACAACTCTTTGTAAGTCATAAAATATTTCTCTTTCGCTAATTCGTCCACACGTGCATTGATAGCCTGCTCAAGTAACTCACGTGCTTCATCTTCATCAATATTAATGTTGAACATTGGTTTATGCCTCCTTTACTTCAAATTCAAATAATTCATTTACCTCAACTTGTAAAACTTCTGCCATTTTCTTAGCTAATTTAGGGCTTGGAATCTTTTTACCATTAATAATTTGGCTTAAATAAGAAATTCCAACACCTGTTTCACGTGATAAATCAGATAAATTAAAGCCTTTTAAGAACATGGCTTCTTTAAACTTTCTAGTATTCGCTAAAATAGTCATAATTAAAATCCTCCTTCGTTTTTGACTGACTTCTCAATCAATTTATAACTTTATTATACATAATCGTTTTTCTTTTGCAATAGTTTTTCGACTGACTTCTCAATCATTTTTTATTTTTTTGTACATAAACGTCCAAAAAAATGCTATTATTAACATAATTAGGAGGTTTGTAATGATTAGAAATAGATTGTCTGAACTACTGTCAGAAAGAGGACTAAAAATATCTCGTGTTGCAAAAGATGTAAAAATAGCAAGAAGTTCACTTACTTCAATGGCACAAAATGATTCTGAAATGATAAGATATGATGCTATAGATAAATTATGTAGTTATCTGCACATATCTCCTTCAGAAT

[0158] SEQ ID NO.40: p(lrgA)-lrgA gene fragment

[0159] GAGCCATTGAATCGTTATGAAAAACGATTGAATCCCACTTATTTTATACGTATTCATCGTTCATATATTATTAACACGAAACACATTAAAGAAGTGCAACAATGGTTTAACTACACTTATATGGTAATATTGACAAATGGTGTCAAGATGCAAGTTGGACGTTCATTTATGAAAGATTTTAAAGCGTCGATAGGATTACTTTAACAGTAATCCTTTTTTTTATGCATTTTACCTATGATATTTTGTATTTCGGACTAAAAATCACGCAAATCGAAGTGAGCCATCTATACTTTAGTTAAATCAAACGTAGGAGGCAATGGTCGTGAAACAACAAAAAGACGCATCAAAACCAGCACACTTTTTTCACCAAGTCATTGTAATTGCTTTAGTACTCTTTGTATCGAAAATAATTGAATCATTTATGCCAATTCCTATGCCTGCATCAGTAATCGGTTTAGTATTATTATTTGTATTATTATGTACTGGTGCTGTTAAGTTAGGCGAAGTCGAAAAAGTAGGAACGACACTAACAAATAACATTGGCTTACTCTTCGTACCAGCCGGTATCTCAGTTGTTAACTCTTTAGGTGTCATTAGCCAAGCACCATTTTTAATCATTGGACTAATAATCGTCTCAACAATACTATTACTTATTTGTACTGGCTATGTCACACAAATTATTATGAAAGTTACTTCGAGATCTAAAGGTGACAAAGTCACAAAAAAGATCAAAATAGAGGAGGCACAAGCTCATGATTAAC

[0160] SEQ ID NO.41: lrgA promoter fragment

[0161] AAAGAAGTGCAACAATGGGTTTAACTACACTTATATGGTAATATTGACAAATGGTGTCAAGATGCAAGTTGGACGTTTCATTTATGAAAGATTTTAAAGCGTCGATAGGATTACTTTAACAGTAATCCTTTTTTATGCATTTTACCTATGATATTTTGTATTTCGGACTAAAAATCACGCAAATCGAAGTGAGCCATCTATACTTTAGTTAAATCAAACGTAGGAGGCA

[0162] SEQ ID NO.42: hu promoter fragment

[0163] TTTACGTGCAGCACGTTCACGTACCTCAAAGTTACCGAAACCAATTAATTGTACTTTTTCACCTTTAGCAAGTGAGTTTTGGATTGATTCGAATACAGCATCTACTGCTGAACCAGCTTCTTTTTT

[0164] The above are merely specific embodiments of this disclosure and are not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. The use of the composition in the preparation of a medicament for treating drug-resistant Staphylococcus aureus infection, the composition comprising a gene knockout vector of Staphylococcus aureus toxin protein-related genes SA1833 and / or SA1832 and an antibiotic; wherein the gene knockout vector is a pBTs recombinant vector containing the sequence shown in any one of SEQ ID NO. 33-35; and the antibiotic is cefazolin.

2. The application according to claim 1, wherein, The drug resistance mentioned is methicillin resistance.

3. The application according to claim 1 or 2, wherein, The drug-resistant Staphylococcus aureus infection includes acute infection, chronic infection, and recurrent infection.

4. A pharmaceutical composition, characterized in that, The pharmaceutical composition is used to treat drug-resistant Staphylococcus aureus infection, and the pharmaceutical composition comprises a gene knockout vector of Staphylococcus aureus toxin protein-related genes SA1833 and / or SA1832 and an antibiotic; the gene knockout vector is a pBTs recombinant vector containing the sequence shown in any one of SEQ ID NO. 33-35; the antibiotic is cefazolin.

5. In vitro non-therapeutic methods for reducing intracellular persistence of cefazolin-resistant Staphylococcus aureus or reducing the survival rate of cefazolin-resistant Staphylococcus aureus under cefazolin treatment, including: Design specific gene knockout primer pairs, wherein the specific gene knockout primer pairs are selected from the group consisting of: The sequence of the SA1833 knockout primer pair for the Staphylococcus aureus toxin protein-related gene is shown in SEQ ID NO.1-SEQ ID NO.4; The sequence of the SA1832 knockout primer pair for the Staphylococcus aureus toxin protein-related gene is shown in SEQ ID NO.5-SEQ ID NO.8; The sequences of the knockout primer pairs for the Staphylococcus aureus toxin protein-related genes SA1833 and SA1832 are shown in SEQ ID NO. 9-SEQ ID NO. 12; The primer pairs were used to amplify the upstream and downstream homologous arms of the target gene. To create a knockout vector for the target gene; Knock out the corresponding Staphylococcus aureus toxin protein-related genes SA1833, SA1832, or both SA1833 and SA1832.

6. The method according to claim 5, wherein, The expression of the metabolism-related gene lrgA was downregulated by knocking out SA1833 and / or SA1832.