KASP markers for soybean petiole angle-related qtl and application
By developing KASP markers related to soybean petiole angle, the problem of time-consuming and labor-intensive field identification of soybean petiole angle was solved, enabling rapid and efficient genotyping, supporting early screening and improvement in soybean breeding, and increasing soybean yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-27
- Publication Date
- 2026-03-17
AI Technical Summary
Field phenotypic identification of soybean petiole angle is time-consuming, labor-intensive, and inaccurate, making it difficult to achieve efficient marker-assisted selection and affecting soybean plant architecture improvement and yield enhancement.
We developed KASP markers based on single nucleotide mutation sites (SNPs), used KASP marker technology to perform molecular detection of soybean petiole angle, identified key sites through genome-wide association analysis, and designed specific primers to achieve rapid and efficient genotyping.
This method enables early and large-scale identification and screening of soybean petiole angles, improving the efficiency and accuracy of soybean breeding, supporting the breeding of compact soybean varieties, and increasing soybean planting density and yield.
Smart Images

Figure CN119061186B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of soybean molecular genetics breeding, and specifically provides a major QTL locus for soybean petiole angle and its application as a KASP marker. Background Technology
[0002] Soybean [Glycine max (L.) Meer.] seeds are rich in oil and protein, making it an important dual-purpose crop for grain, oil, and feed worldwide. my country is the domestication center of soybean cultivation and possesses the largest germplasm resources, but the arable land available for soybean cultivation is limited, and soybean yields are low. More than 80% of China's annual soybean consumption needs to be imported. One effective way to increase soybean yield in my country is to improve plant architecture to increase planting density. Soybeans that tolerate dense planting require a relatively ideal plant architecture structure, such as a smaller petiole angle, shorter petiole length, and fewer branches (Liu et al., 2020c, Wang et al., 2021b, Gao et al., 2022). The leaf petiole angle (LPA) is defined as the angle of inclination between the petiole (or midrib of the leaf) and the main stem (Anderson et al., 1969). It is an important component of crop architecture, directly affecting the size of the crop canopy and ultimately crop yield (Mantilla-Perez et al., 2017). The petiole angle is crucial for plant photosynthetic efficiency and competition among neighboring plants in the natural environment, playing a decisive role in the plant architecture of soybeans and other cereal crops (Gao et al., 2017). Smaller petiole angles in dense canopies enhance light perception, photosynthetic efficiency, ventilation, and stress resistance, thus enabling dense planting and increasing crop yield (Cao et al., 2022). Studies have shown that plants with upright leaves have stronger light interception capabilities and higher photosynthetic efficiency, thereby improving their nitrogen fixation capacity (Sinclair et al., 1999). More efficient grain filling allows for planting more plants per unit area, resulting in a larger leaf area index (Liu et al., 2019). Increasing planting density by selecting soybean varieties with smaller petiole angles and compact plant architecture is an important direction for improving soybean yield.
[0003] The petiole angle in soybean is a complex quantitative trait. Traditional field phenotypic identification of soybean petiole angle is not only time-consuming and labor-intensive, but also easily affected by environmental factors and the work of the measurement personnel, leading to low measurement accuracy. Utilizing the base differences in target genes and developing specific molecular markers for high-effect sites for marker-assisted selection is the best method to improve the selection of compact soybeans. It is simple to operate, unaffected by environmental factors and interactions, and can quickly and efficiently breed target materials. KASP (kompetitive allele specific PCR) is a novel genotyping technology with low cost and high throughput. It performs precise bicelestem typing of SNPs and InDel sites through specific matching of primer terminal bases and is widely used in marker-assisted selection of soybeans. Given the advantages of KASP marker detection technology, such as good stability, high accuracy, low detection cost, and high throughput, it can be used to perform precise bicelestem typing on large numbers of samples, achieving high-throughput target gene verification and detection.
[0004] This patent discovered a SNP variant site related to the petiole angle of soybean natural population materials through genome-wide association analysis. Based on this variant site, a corresponding KASP marker was developed. This marker can be used for molecular detection of the petiole angle of soybean germplasm resources, providing soybean breeders with a molecular marker that can be applied to marker-assisted selection, which will accelerate the process of marker-assisted breeding of new varieties. Summary of the Invention
[0005] The purpose of this invention is to identify single nucleotide mutation sites (SNPs) closely associated with the angle between soybean petioles, and to develop KASP molecular markers and their primer pairs based on the SNP information, so as to provide molecular-assisted selection technology support for the early large-scale identification and screening of soybean petiole angles.
[0006] The objective of this invention can be achieved through the following technical solutions:
[0007] In a first aspect, the present invention provides a haplotype closely associated with the soybean petiole angle gene, located at position 36,429,255 bp on chromosome 16 of the soybean genome Wm82.a2.v2.0, wherein the soySNP at position 36,429,255 bp involves a C-to-A substitution. The genotype CC shows a highly significant difference from the mean soybean petiole angle, explaining 5.37% of the phenotypic variation. The nucleotide sequence of the aforementioned SNP is shown in SEQ ID NO: 1.
[0008] This invention performed a genome-wide association analysis on the mean petiole angle of soybean and found that, under multiple environmental conditions, a co-location of Chr16_36,429,255 on chromosome 16 was identified as significantly associated with the petiole angle trait. Figure 1 After PLINK calculations, the range of SNPs with an LD value ≥ 0.6 (R² ≥ 0.6) between the peak SNP and the target SNP was determined to be the candidate interval 36.39–36.44 Mb on chromosome 16. Figure 2 a), and used LDBlockShow software to draw the haplotype diagram for this interval ( Figure 2 b). Phenotypic analysis was performed on materials with different alleles at the peak SNP hr16_36429255. The results showed that the mean petiole angle differed significantly between materials carrying the dominant frequency allele at the peak SNP and those carrying the alternative allele. Furthermore, materials with the Chr16_36,429,255_C allele had a mean LPA that was 7.4 degrees lower than those with the Chr16_36,429,255_A allele (e.g., ...). Figure 2 b).
[0009] Secondly, the present invention also provides a primer pair for detecting the major QTL site of soybean petiole angle, wherein the KASP marker is the KASP marker of the aforementioned SNP mutation site, and the KASP marker contains three primers, including two specific primers designed for the base differences of key sites, namely upstream primer F1 and upstream primer F2, and one universal primer, namely downstream primer R. The 3' ends of the two specific primers are allelic variant bases, and the 5' ends are connected to the specific FAM and HEX fluorescent linker sequences of the KASP reaction reagent from LGC (Laboratory of the Government Chemist) in the UK.
[0010] The primer pairs are as follows:
[0011] The upstream primer F1 sequence labeled with soySNP KASP is:
[0012] 5'-GAAGGTGACCAAGTTCATGCTCGACCCAACCTTAAGGCATTATAG-3', such as SEQ ID NO 2;
[0013] The soySNP KASP-labeled upstream primer F2 sequence is:
[0014] 5'-GAAGGTCGGAGTCAACGGATTCGACCCAACCTTAAGGCATTATAT-3', such as SEQ ID NO 3;
[0015] The downstream primer R sequence of the soySNP KASP marker is: 5'-GTGAAGAAGCCTCACACATTTGAA-3', as shown in SEQ ID NO 4.
[0016] Thirdly, this invention protects a reagent for detecting the major QTL site of soybean petiole angle using KASP molecular markers, containing the primer pair described above.
[0017] Fourthly, the present invention also protects a kit for detecting KASP molecular markers of QTL major sites in soybean petiole angle, the kit containing the primer pairs described above or the reagents described above.
[0018] Fifthly, the present invention also protects a system for detecting KASP markers at major QTL sites in soybean petiole angle, the system comprising the primer pairs described above, or the reagents described above, or the kits described above.
[0019] In a specific implementation, the system also includes an instrument or device for detecting KASP markers at major QTL sites in soybean petiole angle.
[0020] Sixthly, the present invention also protects the use of the primer pairs, reagents, kits, or systems described above in any of the following applications:
[0021] (A1) Soybean-assisted breeding;
[0022] (A2) Preparation of products for soybean-assisted breeding;
[0023] (A3) To identify or assist in the identification of soybean petiole angle;
[0024] (A4) Prepare products for identifying or assisting in the identification of soybean petiole angle;
[0025] (A5) Breeding or assisting in the breeding of compact soybean plants;
[0026] (A6) Prepare products of compact soybean plants by breeding or assisting in the breeding of soybeans.
[0027] Seventhly, the present invention protects a method for breeding or assisting in the breeding of compact soybean plants, wherein soybean genomic DNA is extracted, the extracted genomic DNA is amplified by PCR using the primer pairs described above, and genotyping is performed based on the fluorescence signal of the PCR amplification product.
[0028] Eighthly, the present invention protects a method for identifying or assisting in the identification of compact soybean plants, comprising extracting soybean genomic DNA, performing PCR amplification on the extracted genomic DNA using the primer pairs described above, and performing genotyping based on the fluorescence signal of the PCR amplification product.
[0029] In the above methods and applications, the primer set consists of the aforementioned upstream primer F1, upstream primer F2, and downstream primer R. PCR amplification is performed using an ABI 7500 real-time quantitative PCR instrument. After PCR, the instrument can perform genotyping based on the fluorescence signal. After the reaction is complete, the ABI 7500 real-time quantitative PCR instrument directly reads the fluorescence data of the PCR reaction product, and the fluorescence scan results are automatically converted into graphs.
[0030] In specific implementation plans, the aforementioned applications or methods include the following specific steps:
[0031] (1) Extraction of genomic DNA from soybean plants;
[0032] (2) PCR amplification of the genomic DNA of the biological sample was performed using the primers described above, and the SNP genotypes described above were obtained:
[0033] The primer pairs described above were added to the same PCR reaction system, and two blank controls were set up with ultrapure water instead of sample template DNA. The DNA of soybean germplasm resources was amplified on a real-time PCR instrument. After the reaction was completed, the fluorescence was detected by a multi-functional microplate reader. Based on the fluorescence readings, the ratios of FAM / ROX and HEX / ROX were calculated, and a coordinate graph was plotted using software to obtain the genotype of the sample.
[0034] (3) Based on genotype, identify compact soybean germplasm resources with smaller petiole angles.
[0035] In a more specific implementation, in step (2), the 5.0 μL reaction system is as follows: 5-100 ng of soybean sample DNA template; 2.5 μL of FLu-Arms 2x PCR Mix; 0.075 μL of KASP upstream genotyping primer F1 (10 μM), 0.075 μL of KASP upstream genotyping primer F2 (10 μM), 0.2 μL of KASP downstream universal primer R (10 μM); and water to 5.0 μL.
[0036] In a more specific implementation, in step (2), the PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min, 1 cycle; 95℃ denaturation for 15 s, 63.4~57℃ annealing for 45 s, decreasing by 0.8℃ for each cycle, 9 cycles; 95℃ denaturation for 15 s, 57.5℃ annealing for 45 s, 45 cycles; after the cycle, extension at 30℃ for 30 s.
[0037] This invention identified a SNP variant site associated with a soybean petiole angle from 298 population materials. This variant site is located upstream of the Glyma.16g203200 gene and has two haplotypes: CC and AA. Based on this, this invention obtained a major QTL locus for soybean petiole angle and its KASP marker. The application of this KASP marker provides molecular-assisted selection technology support for the identification and screening of genes associated with soybean petiole angle.
[0038] Beneficial effects
[0039] (1) The SNP variants closely related to the soybean petiole angle in this invention were selected from 298 representative soybean germplasm resources out of 1498 resources in southern China. These were subjected to 5× resequencing, and after filtering, a high-density SNP molecular marker map covering the entire genome was obtained. Then, field phenotypic identification methods were used to detect soybean petiole angle data under two environments (summer of 2021 and summer of 2022). Genome-wide association analysis was performed on the soybean petiole angle phenotypic data to obtain the results. Figure 1 A three-SNP haplotype marker located in the GmYUC2 gene, significantly associated with soybean petiole angle, was detected in both environments. This locus is located at 36,429,255 bp on chromosome 16 of the soybean genome (Wm82.a2.v2.0), explaining 5.37% of the phenotypic variation. The CC haplotype allelic variant carried at this locus significantly reduces soybean petiole angle. Figure 2 This provides technical support for molecular marker-assisted breeding of soybean petiole angle traits. Based on this, the KASP marker can realize pre-selection and molecular-assisted breeding of soybean petiole angle traits. Attached Figure Description
[0040] Figure 1 Manhattan diagrams and QQ diagrams were used for correlation analysis in different environments. Figure 1 In Figures a and b, 21BM and 22BM represent the correlation analysis results of the two environments, respectively. Figure 1 Plot c in the figure represents the optimal linear unbiased estimate. The red line in the figure is the significance threshold line. The red arrows indicate the sites of significant LPA correlation.
[0041] Figure 2 This shows the significant loci and their haplotypes on chromosome 16. Figure 2 Figure a in the diagram is the Manhattan diagram of chromosome 16, and the red arrows indicate SNP markers closely related to candidate genes. Figure 2 Figure b shows a comparison between the dominant frequency alleles and alternative alleles carried by the peak SNP.
[0042] Figure 3 To identify the genotype of soybean petiole angle-related SNPs using the KASP method. Detailed Implementation
[0043] The present invention will be further described below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the methods used are conventional methods. Reagents or instruments used without a specified manufacturer are considered to be conventional products that can be purchased on the market.
[0044] Example 1: Obtaining SNP variant sites
[0045] The SNP mutation sites of the soybean petiole angle in this invention were obtained through the following steps:
[0046] (1) 298 representative soybean germplasm accessions were selected from global soybean germplasm resources and whole-genome resequencing was performed using an Hseq X ten sequencer at a depth of 5×, with an average of 28,279,904 reads per sample. Using the William 82 (Glyma.Wm82.a2.v2.0) genome as a reference sequence, the average coverage of each sample reached 94.69%. The Burrows-Wheeler transform method was used for alignment, and the intersection of the GATK and Samtools algorithms was taken. After filtering out low-frequency SNPs, a total of 3,625,423 high-quality SNP molecular markers covering the entire genome were obtained. High-throughput phenotypic identification technology was used to obtain the mean petiole angle of the 298 soybean germplasm resources, which was then combined with these SNPs for genome-wide association analysis.
[0047] (2) The field experiment planting scheme was 1m row length, 0.7m row spacing, and 7cm plant spacing. Each variety was planted in 3 rows with two replicates. When measuring data, the second plant in each row in a fixed direction was selected. Two replicates were measured for each variety, with 3 plants in each replicate. The petiole angle was taken at the petiole position in the middle node (mature) of the plant at the R5 growth stage. The soybean petiole angle was measured by a protractor and a ground-based lidar Faro Focus3D S70 (FARO Technology Inc, FL, USA). The petiole angle of soybean in two environments (summer of 2021 and summer of 2022) was measured using field phenotypic identification methods. Genome-wide association analysis and BLUE association analysis were performed on the mean petiole angle of soybean in different environments. Seven SNP markers significantly associated with the petiole angle of soybean were detected in both analyses, all located on soybean chromosome 16. Among them, locus 7 was the most significant, explaining 5.37% of the phenotypic variation. SoySNP-7 underwent a C-to-A substitution at 36,429,255 bp.
[0048] Example 2: Development of KASP-labeled specific primers
[0049] Using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), primers for the SNP variant site were designed based on the sequence of the soySNP variant site on the genome (SEQ ID NO 1) and its reverse complementation with the sequence of the same gene in the Phytozome database. These primers included upstream primer F1, upstream primer F2, and downstream primer R. F1 and F2 contain FAM and HEX fluorescent linker sequences, respectively, as shown below:
[0050] The upstream primer F1 sequence labeled with soySNP KASP is:
[0051] 5'- GAAGGTGACCAAGTTCATGCTCGAC CCAACCTTAAGGCATTATAG-3', as shown in SEQ ID NO 2;
[0052] The soySNP KASP-labeled upstream primer F2 sequence is:
[0053] 5'- GAAGGTCGGAGTCAACGGATTCGAC CCAACCTTAAGGCATTATAT-3', as shown in SEQ ID NO 3;
[0054] The R sequence of the downstream primer labeled soySNP KASP is: 5'-GTGAAGAAGCCTCACACATTTGAA-3', as shown in SEQ ID NO 4;
[0055] Example 3: Genotyping of SNP loci in different soybean varieties and its application
[0056] Genomic DNA was extracted from different soybean samples. Using the genomic DNA as a template, PCR amplification was performed using KASP-labeled primers to obtain the PCR amplification products. PCR amplification was performed using an ABI 7500 real-time quantitative PCR instrument. After PCR, the instrument can perform genotyping based on the fluorescence signal.
[0057] The amplification system used was a 5.0 μL reaction system: 5-100 ng soybean sample DNA template; 2.5 μL FLu-Arms 2xPCRMix; 0.075 μL KASP upstream genotyping primer F1 (10 μM), 0.075 μL KASP upstream genotyping primer F2 (10 μM), 0.2 μL KASP downstream universal primer R (10 μM); and water added to a final volume of 5.0 μL.
[0058] The reaction conditions included: pre-denaturation at 95℃ for 3 min, 1 cycle; denaturation at 95℃ for 15 s, annealing at 63.4–57℃ for 45 s, decreasing by 0.8℃ per cycle, 9 cycles; denaturation at 95℃ for 15 s, annealing at 57.5℃ for 45 s, 45 cycles; and an extension at 30℃ for 30 s after the cycle was completed.
[0059] After the reaction was completed, the ABI 7500 real-time quantitative PCR instrument directly read the fluorescence data of the PCR reaction products. Using KASP-labeled primers, 27 soybean materials were amplified and genotyped on the real-time quantitative PCR instrument, and sorted by petiole angle from smallest to largest (Table 1). The results showed that the molecular marker primers could clearly separate the two genotypes. Among the 10 materials carrying the angle-increasing effect allele AA at the soySNP site, 9 materials had a larger petiole angle than the materials with the CC allele at the soySNP site, accounting for 90.0%. If we exclude the one material carrying the AA genotype but with a smaller petiole angle, all individuals with the CC genotype at the soySNP site had a smaller petiole angle than those with the AA genotype. The genotype-phenotype matching ratio of the 27 materials was 88.9%. Figure 3 The genotype and petiole angle phenotypic results are basically consistent, so they can be safely used in molecular marker-assisted selection breeding.
[0060] Table 1. Soybean names, genotypes, and phenotypes used for KASP markers.
[0061]
[0062]
[0063]
[0064] The scope of protection of this invention is not limited to the above embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.
[0065] SEQ ID NO 1: (Chr16: 36429230-35429399)
[0066] CATAGAAGTGGGATGACCCATAGAG[C / A]TATAATGCCTTAAGGTTGGGTCGAGTC AAGATGTGGGGTTAACCCATAAGCTTGGTTCCTTGTTAAGCACATGAAAGGAGATCCCCCAGTGTTCTTGGTTGTCCTGACAAGCAAGTTTATTGGTCAATGGAGACATTCAGCAACTTTTGAGATATGATCCATTATTTAACTATGTGACGTATCTATCATTTAAGAATGTACCCCGAGACTTTTTTATGTATTATGCCAATTTGCTGATGATAGCTCCCAATTAACGAGTTAGTTGATAGATAAAGTAAGGAGACAGGCAAGTGTAAAGGATTGAGCTCTGCTATTAACTTCTTCATTTGGGAAGTTGGACTTCACTTCTAGAAGTTTGACAGTGAAGTATATGATGGTTTTCATTTTACTAAGTGGATAGATAATGTGAGGAACAACAGCATAAAGAGGGTGTCTTTGGTGTATTTCCCTCGA
[0067] The upstream primer F1 sequence of the soySNP KASP marker, SEQ ID NO 2:
[0068] 5’-GAAGGTGACCAAGTTCATGCTCGACCCAACCTTAAGGCATTATAG-3’;
[0069] The upstream primer F2 sequence of the soySNP KASP marker, SEQ ID NO 3:
[0070] 5’-GAAGGTCGGAGTCAACGGATTCGACCCAACCTTAAGGCATTATAT-3’;
[0071] The downstream primer R sequence of the soySNP KASP marker, SEQ ID NO 4:
[0072] 5’-GTGAAGAAGCCTCACACATTTGAA-3’.
Claims
1. A KASP marker primer pair for detecting a major QTL site of soybean petiole angle, characterized in that, The primer pair is used for detecting soybean leaf petiole angle significantly related SNP site soySNP genotype variation, the SNP site is located at the position of 16th chromosome Chr16_36,429,255 bp of soybean genome Wm82.a2.v2.0, which has a base C to A substitution; the KASP marker primer pair sequence is as follows: The sequence of the upstream primer F1 of the soySNP KASP marker is as follows: 5'-GAAGGTGACCAAGTTCATGCTCGACCCAACCTTAAGGCATTATAG-3', as shown in SEQ ID NO 2; The sequence of the upstream primer F2 of the soySNP KASP marker is as follows: 5'-GAAGGTCGGAGTCAACGGATTCGACCCAACCTTAAGGCATTATAT-3', as shown in SEQ ID NO 3; The sequence of the downstream primer R of the soySNP KASP marker is as follows: 5'-GTGAAGAAGCCTCACACATTTGAA-3', as shown in SEQ ID NO 4.
2. The primer pair according to claim 1, characterized in that, When the haplotype of the 16th chromosome Chr16_36,429,255 bp of the soybean genome Wm82.a2.v2.0 of the to-be-tested material is CC, the leaf petiole angle of the to-be-tested material is smaller than that of the haplotype AA.
3. A kit of KASP markers for detecting the major QTL locus of soybean petiole angle, characterized in that, The kit contains the primer pair of claim 1.
4. The kit of claim 3 is used in any one of the following: (A1) identifying the leaf petiole angle of soybean; (A2) preparing a product for identifying the leaf petiole angle of soybean; (A3) breeding soybean with small leaf petiole angle and compact plant shape; (A4) preparing a product for breeding soybean with small leaf petiole angle and compact plant shape.
5. A method for selecting a soybean plant with a small compact plant type with a small petiole angle, comprising the steps of: The method comprises the following steps: extracting soybean genomic DNA, performing PCR amplification on the extracted genomic DNA by using the primer pair of claim 1 or 2, and performing genotyping by using the fluorescence signal of the PCR amplification product, wherein the leaf petiole angle of the to-be-tested material with haplotype CC is smaller than that of the to-be-tested material with haplotype AA.
6. A method of identifying the angle of the petiole of a soybean leaf, characterized by, The method comprises the following steps: extracting soybean genomic DNA, performing PCR amplification on the extracted genomic DNA by using the primer pair of claim 1 or 2, and performing genotyping by using the fluorescence signal of the PCR amplification product, wherein the leaf petiole angle of the to-be-tested material with haplotype CC is smaller than that of the to-be-tested material with haplotype AA.
7. The method of claim 5 or 6, wherein the PCR reaction system is as follows: soybean sample DNA template 5-100 ng; FLu-Arms 2x PCR Mix 2.5 μL; KASP upstream typing primer F1 10 μM 0.075 μL, KASP upstream typing primer F2 10 μM 0.075 μL, KASP downstream universal primer R 10 μM 0.2 μL; and water to 5.0 μL.
8. The method of claim 5 or 6, wherein the PCR reaction system is as follows: PCR reaction conditions were as follows: 95 °C pre-denaturation for 3 min, 1 cycle; 95 °C denaturation for 15 s, 63.4-57 °C annealing for 45 s, each cycle decreasing 0.8 °C, 9 cycles; 95 °C denaturation for 15 s, 57.5 °C annealing for 45 s, 45 cycles; after the end of the cycle, 30 °C extension for 30 s.
Citation Information
Patent Citations
KASP marker of soybean shade-tolerant gene GmYUC2 and application of KASP marker
CN117286287A
SNP site closely associated with anthocyanin content in vigna unguiculata, KASP molecular marker primer, and use thereof
WO2023236840A1