Application of L-NRB in the preparation of drugs for treating amyotrophic lateral sclerosis (ALS)
By using L-NRB to inhibit inflammatory factors and activate the P11-Htr4 signaling pathway, various dosage forms were prepared, which solved the problem of insufficient efficacy of existing drugs in the treatment of amyotrophic lateral sclerosis (ALS) and significantly improved motor function and delayed disease progression in ALS mice.
Patent Information
- Application Number
- CN202411078014.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-07
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2044-08-07
AI Technical Summary
Existing drugs are not effective in treating amyotrophic lateral sclerosis (ALS), and butylphthalide has limited efficacy and poor water solubility, which restricts its application.
Using L-NRB as the drug, it is prepared into oral, injectable, or transdermal formulations to treat amyotrophic lateral sclerosis by inhibiting the expression of inflammatory factors and activating the P11-Htr4 signaling pathway.
L-NRB significantly improved motor function in SOD1-G93A mice, inhibited the activation of astrocytes and microglia in the spinal cord, reduced the expression of pro-inflammatory factors in serum, delayed disease progression, and improved the quality of life of ALS patients.
Smart Images

Figure CN119074713B_ABST
Abstract
Description
Technical Field
[0001] This application pertains to the fields of neurodegenerative diseases and biomedicine. Specifically, this application provides the use of L-NRB in the preparation of drugs for the treatment of amyotrophic lateral sclerosis (ALS). Background Technology
[0002] Amyotrophic lateral sclerosis (ALS) is a chronic, progressive neurodegenerative disease, clinically characterized by progressive skeletal muscle weakness and atrophy, fasciculations, bulbar palsy, and pyramidal tract signs. Some ALS patients may also experience varying degrees of cognitive and behavioral impairments, indicating frontotemporal lobe involvement. According to the "Chinese Expert Consensus on the Diagnosis and Treatment of Amyotrophic Lateral Sclerosis 2022," ALS remains incurable, and currently available drugs cannot meet the clinical treatment needs. Therefore, finding novel therapeutic drugs is currently a top priority in ALS treatment.
[0003] ALS is a motor neuron disease characterized by degeneration of both upper and lower motor neurons. Improving motor function is a core indicator for evaluating drug efficacy. Approximately 20% of familial ALS cases and 3% of sporadic ALS cases are associated with mutations in the gene encoding superoxide dismutase-1 (SOD1). SOD1-G93A mice, expressing the G93A mutant form of human SOD1, are frequently used in ALS research. Muscle atrophy is considered a complex process involving not only the loss of motor neurons but also the accumulation of misfolded proteins in muscle, oxidative stress, and mitochondrial dysfunction. Therefore, direct treatment of skeletal muscle is more resistant to damage induced by mutant SOD1. Neuroinflammation can be defined as an inflammatory response of the central nervous system against homeostatic factors. Neuroinflammation is widespread in neurodegenerative diseases and causes damage to neurons and glial cells in multiple ways. The release of inflammatory factors and the activation of glial cells are major factors in neuroinflammation. Microglial activation leads to the release of inflammatory and cytotoxic components, resulting in neuroinflammation and neurodegeneration. Simultaneously, astrocyte activation can lead to exotoxic glutamate. Therefore, methods targeting inflammation in ALS patients have considerable therapeutic potential. Developing targeted therapies that modulate the inflammatory response in ALS patients could potentially slow or halt disease progression, thereby improving the quality of life for ALS patients.
[0004] Butylphthalide (NBP) was approved by the China Food and Drug Administration in 2002 for the treatment of acute ischemic stroke, and is China's third innovative drug with independent intellectual property rights. The "Guidelines for the Diagnosis and Treatment of Acute Ischemic Stroke in China (2021 Edition)" describes butylphthalide as a drug that improves microcirculation, promotes angiogenesis, and increases cerebral blood flow. However, the limited efficacy and extremely poor water solubility of NBP significantly restrict its application. L-NRB is a levorotatory product formed by combining the ring-opening product of butylphthalide with dextromethorphanol in a 1:2 molar ratio. According to previous research by our group, L-NRB has good activity in treating cerebral ischemia, and its effect is superior to that of butylphthalide. L-NRB has both neuroprotective and anti-inflammatory effects; therefore, studying its therapeutic effects on neurodegenerative diseases, especially ALS, is feasible and of practical significance. Summary of the Invention
[0005] On the one hand, this application provides the use of L-NRB in the prevention and treatment of amyotrophic lateral sclerosis (ALS), wherein the chemical formula of L-NRB is shown in Formula I:
[0006]
[0007] Furthermore, the amyotrophic lateral sclerosis (ALS) described herein is ALS caused by a mutation in the SOD1 gene.
[0008] Furthermore, the drug inhibits the expression of inflammatory factors and the activation of astrocytes and microglia in the spinal cord.
[0009] Furthermore, the drug inhibits apoptosis in brain cells.
[0010] Furthermore, the drug activates the P11-Htr4 signaling pathway in the brain.
[0011] Furthermore, the drug is in oral, injectable, or transdermal form.
[0012] Furthermore, the drug is an oral dosage form.
[0013] Furthermore, the drug also includes pharmaceutically acceptable excipients or excipients.
[0014] On the other hand, this application provides a medicament for treating amyotrophic lateral sclerosis (ALS), the medicament comprising L-NRB, the chemical formula of which is shown in Formula I:
[0015]
[0016] Furthermore, the drug is an oral dosage form.
[0017] The available drug dosage forms for this application include various injectable, oral, and topical dosage forms, including but not limited to tablets, capsules, oral solutions, aqueous injections, powder injections, eye drops, and transdermal drug delivery preparations.
[0018] The medicament described in this application may also include various pharmaceutically acceptable excipients or excipients, including but not limited to coating materials, solvents, solubilizers, binders, stabilizers, antioxidants, pH adjusters, flavoring agents, etc.
[0019] The "L-NRB" mentioned in this application refers to a compound with the chemical formula I below, which is disclosed in the applicant's earlier application CN202210205661.2. Its chemical name, CAS number, chemical formula, and various abbreviations all have the same meaning and can be used interchangeably.
[0020]
[0021] This application elucidates that L-NRB treats amyotrophic lateral sclerosis (ALS) by inhibiting neuroinflammation and activating the P11-Htr4 signaling pathway, and therefore can be used for the further development of drugs for the prevention / treatment of ALS, increasing the availability of drugs for the clinical treatment of ALS. Attached Figure Description
[0022] Figure 1 The results are from an animal model of amyotrophic lateral sclerosis (ALS): Part A shows the time mice spent on the rotarod in the rotarod test; Part B shows the time mice spent hanging on the string in the string test; and Part C shows the forelimb gripping force of mice in the gripping force measurement test.
[0023] Figure 2 The results of the detection of mouse serum and urine are as follows: Part A is the determination of NfL content in serum; Part B is the determination of p-NfH content in serum; and Part C is the determination of P75ecd content in urine.
[0024] Figure 3 The results of Nissl staining and immunohistochemical staining of GFAP and Iba1 in mouse spinal cord are as follows: Part A shows representative images of Nissl staining in spinal cord; Part B shows representative images of Iba1 immunohistochemical staining in spinal cord; Part C shows representative images of GFAP immunohistochemical staining in spinal cord; Part D shows a statistical graph of Nissl staining in spinal cord; Part E shows a statistical graph of Iba1 immunohistochemical staining in spinal cord; and Part F shows a statistical graph of GFAP immunohistochemical staining in spinal cord.
[0025] Figure 4 The results of the detection of inflammatory factors in mouse serum are as follows: Part A is the determination of the serum IL-1β content; Part B is the determination of the serum TNF-α content; and Part C is the determination of the serum IL-6 content.
[0026] Figure 5 The results of measuring the length and weight of the mouse gastrocnemius muscle and detecting HE staining are as follows: Part A shows a representative image of the mouse gastrocnemius muscle; Part B shows the measurement of the length of the mouse gastrocnemius muscle; Part C shows the measurement of the weight of the mouse gastrocnemius muscle; and Part D shows a representative image of the hourly gastrocnemius muscle after HE staining.
[0027] Figure 6 The results of TUNEL staining and Bcl-2 and Bax expression detection in mouse brain are as follows: Part A shows representative images of mouse brain TUNEL staining; Part B shows statistical graphs of mouse brain TUNEL staining; Part C shows representative Western Blot images of mouse brain Bcl-2 and Bax; and Part D shows statistical graphs of Bcl-2 / Bax.
[0028] Figure 7A PCA diagrams of the WT group and model group in transcriptome sequencing.
[0029] Figure 7B This is a KEGG analysis diagram of the WT group and the model group in transcriptome sequencing.
[0030] Figure 7C Heatmaps of the WT group and model group in transcriptome sequencing.
[0031] Figure 7D These are representative Western Blot images of Htr4 and P11 in the mouse brain.
[0032] Figure 7E Statistical graphs of mRNA and protein levels of P11 and Htr4. Detailed Implementation
[0033] Example 1: Construction of an animal model of amyotrophic lateral sclerosis (ALS) and behavioral experiments
[0034] Experimental materials:
[0035] L-NRB was synthesized by the Chemical Laboratory of the Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences, following the synthesis and structural confirmation in Example 2 of CN202210205661.2. The positive control drug edaravone was purchased from Simcere Pharmaceutical Group Co., Ltd. (batch number: 80-220201).
[0036] Sixty male SOD1-G93A mice (B6.Cg-Tg(SOD1*G93A)1Gur, catalog number: GAP2008) and 20 sex-matched non-transgenic mice (WT) were purchased from Changzhou Cavens Laboratory Animal Co., Ltd. A rotarod fatigue tester (catalog number: YLS-4D) and a rat / large mouse gripping force tester (catalog number: YLS-13A) were purchased from Jinan Yiyan Technology Development Co., Ltd. 40cm × 40cm wire mesh (0.1cm line width, 0.5cm spacing) was used for the mouse string-hanging experiment. All animals were housed at the Animal Center of the Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences. All mice were housed in an environment with 22-26℃, 40-70% humidity, and alternating 12-hour light and dark conditions, with free access to water and food. The use of laboratory animals followed the guidelines for laboratory animal care and use issued by the National Institutes of Health (NIH) and the regulations of the Animal Care and Use Committee of the Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences. This experiment was approved by the Animal Welfare and Laboratory Animal Management and Animal Welfare Committee of the Chinese Academy of Medical Sciences and Peking Union Medical College (Approval No.: SLXD-20230229011).
[0037] Experimental methods:
[0038] Grouping and Administration: SOD1-G93A mice were randomly divided into a model group, a low-dose L-NRB group (11 mg / kg), a high-dose L-NRB group (22 mg / kg), and a positive control group (15 mg / kg). The low-dose L-NRB, high-dose L-NRB, and positive control group were administered L-NRB via intraperitoneal injection according to the prescribed dosage. WT and model groups were administered an equal volume of physiological saline. SOD1-G93A and WT mice were administered the drug starting at 80 days of age, six times a week for 55 days. Behavioral experiments were conducted 45 days after drug administration, following the specific steps below:
[0039] Rotander test: Mice were trained on a rotander fatigue tester for 3 days. The instrument parameters were set as follows: acceleration time 20s, maximum rotation speed 20rpm, duration 180s. Mice that could stably move on the instrument were selected for measurement. The measurement parameters were set as follows: acceleration time 20s, maximum rotation speed 30rpm, duration 180s. Each mouse was measured 3 times, with an interval of 1 hour. The longest time a mouse remained on the rotander was recorded, and mice that did not fall off for 180s were recorded as having 180s.
[0040] String hanging experiment: Place the mouse in the center of the wire mesh, gently shake it to make it grip the wire mesh, gently flip the wire mesh, and record the time it takes for the mouse to fall off the wire mesh. Repeat the test 3 times, with an interval of 1 hour between each test. Record the longest hanging time. Mice that do not fall off for 90 seconds are recorded as 90 seconds.
[0041] Grasping force test: Mice were placed in the center of a grasping board, and their tails were gently pulled to encourage their forelimbs to grasp the board. Once the mouse had firmly grasped the board, its tail was pulled until it released the grip. This was repeated three times, with a one-hour interval between each measurement, and the maximum grasping force was recorded.
[0042] Sample collection method: 55 days after drug administration, mice were sacrificed and serum was collected. The gastrocnemius muscle and spinal cord of 5 mice in each group were fixed, and the brains of the other 15 mice were cryopreserved.
[0043] Experimental results:
[0044] like Figure 1 As shown, compared with the WT group, 135-day-old SOD1-G93A mice showed a decline in motor ability tests. L-NRB treatment significantly improved the behavioral performance of SOD1-G93A mice in the rotarod test. Figure 1 A). Simultaneously, after L-NRB injection, both grip strength and suspension endurance time increased. Figure 1 B- Figure 1 C). These data indicate that L-NRB improves motor function in SOD1-G93A mice.
[0045] Example 2: Determination of serum Nfl, p-NfH and urinary P75ecd levels in mice
[0046] Experimental methods:
[0047] Mouse serum was collected, and the levels of Nfl and p-NfH in the mouse serum were detected using ELISA according to the kit instructions. Mouse urine was collected, and the level of P75ecd in the mouse urine was detected using ELISA according to the kit instructions.
[0048] NfL: The detection was performed using the mouse light peptide neurofilament protein detection kit (catalog number: m1541258v) purchased from Shanghai Enzyme-Link Biotechnology Co., Ltd.
[0049] p-NfH: Detected using the phosphorylated neurofilament heavy chain detection kit (catalog number: F10714-A) purchased from Shanghai Sinovac Reagents.
[0050] P75ecd: The test was performed using the mouse NGFR / P75ecd rapid detection kit (catalog number: BEK-2220-1P) purchased from Biosensis.
[0051] Experimental results:
[0052] NfL and p-NfH levels are correlated with the rate of ALS progression. Therefore, we use NfL and p-NfH to reflect the progression of neuronal damage. Figure 2As shown in A-2B, serum NfL and p-NfH levels were elevated in SOD1-G93A mice. L-NRB and edaravone reduced serum NfL and p-NfH levels in ALS mice. P75NTR mediates apoptosis of damaged neurons during neuronal injury. The extracellular domain of P75NTR (P75ecd) is cleaved after binding to a pro-apoptotic ligand. Studies have shown that P75ecd is excreted in urine after neuronal injury. In our study, L-NRB and edaravone inhibited the upregulation of P75ecd in the urine of SOD1-G93A mice. Figure 2 C). In summary, L-NRB treatment can reduce the expression of ALS biomarkers in the serum and urine of ALS model mice and delay the progression of ALS disease.
[0053] Example 3: Nissl staining and immunohistochemical staining of GFAP and Iba1 in mouse spinal cord
[0054] Experimental methods:
[0055] The spinal cord of a mouse was sectioned after being broken at the waist, and then stained.
[0056] Nissl staining:
[0057] 1. Dewaxing paraffin sections to water: Immerse the sections in environmentally friendly dewaxing solution I for 20 minutes, environmentally friendly dewaxing solution II for 20 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, and 75% alcohol for 5 minutes, then rinse with tap water.
[0058] Frozen sections were warmed and fixed: Frozen sections were taken out of the -20°C freezer and brought to room temperature. They were fixed with tissue fixative for 15 minutes and then rinsed with running water.
[0059] 2. Nissl staining:
[0060] Immerse tissue sections in staining solution for 2-5 minutes, wash with water, slightly differentiate with 0.1% glacial acetic acid, stop the reaction by rinsing with tap water, control the degree of differentiation under a microscope, and after rinsing with tap water, place the sections in an oven to dry.
[0061] 3. Clearing and mounting: Place the sections in clean xylene for 10 minutes to clear, then mount with neutral resin.
[0062] 4. Microscopic examination, image acquisition and analysis.
[0063] Immunohistochemistry:
[0064] 1. Fixation of frozen sections: Air-dry frozen sections at room temperature, bake in an oven at 37°C for 10-20 minutes, fix in methanol for 20 minutes, and wash three times in PBS (pH 7.4) on a decolorizing shaker for 5 minutes each time.
[0065] 2. Antigen retrieval: See the table above for retrieval instructions. During this process, excessive evaporation of the buffer solution should be prevented, and the slides should not be dried out. After natural cooling, place the slides in PBS (pH 7.4) and wash them three times on a decolorizing shaker for 5 minutes each time.
[0066] 3. Blocking endogenous peroxidase: Place the slides in a 3% hydrogen peroxide solution and incubate at room temperature in the dark for 25 minutes. Then, place the slides in PBS (pH 7.4) and wash them three times on a decolorizing shaker for 5 minutes each time.
[0067] 4. Serum blocking: After the sections are dried, draw a circle around the tissue with a histochemical pen, and add 3% BSA evenly to the inside of the circle to block the tissue at room temperature for 30 minutes.
[0068] 5. Add primary antibody: Discard the blocking solution, add PBS to the slides with the primary antibody prepared in a certain ratio (recombinant anti-GFAP antibody, Seville Biotechnology, catalog number: GB15100-100, dilution ratio: 1:1000; recombinant anti-Iba1 antibody, Seville Biotechnology, catalog number: GB153502-100, dilution ratio: 1:1000), and incubate the slides flat in a humidified chamber at 4°C overnight.
[0069] 6. Add secondary antibody: Place the slide in PBS (pH 7.4) and wash three times on a decolorizing shaker for 5 minutes each time. After slightly drying the slide, add the secondary antibody (HRP-labeled) of the corresponding species from the histochemistry kit to the inside of the slide and incubate at room temperature for 50 minutes.
[0070] 7. DAB staining: Place the slide in PBS (pH 7.4) and wash it three times on a decolorizing shaker for 5 minutes each time. After slightly drying the slide, add freshly prepared DAB staining solution to the circle. Control the staining time under a microscope. A positive result is brownish-yellow. Rinse the slide with tap water to stop the staining process.
[0071] 8. Counterstaining cell nuclei: Counterstain with hematoxylin for about 3 minutes, wash with tap water, differentiate with hematoxylin differentiation solution for a few seconds, rinse with tap water, re-blue with hematoxylin blue solution, and rinse with running water.
[0072] 9. Dehydration and mounting: Place the sections in the following solutions in sequence: 75% alcohol for 5 min, 85% alcohol for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, n-butanol for 5 min, and xylene I for 5 min to dehydrate and clear the sections. Remove the sections from the xylene and let them dry slightly before mounting with mounting adhesive.
[0073] 10. Microscopic examination: The results were interpreted under a white light microscope (Nikon Instruments Co., Ltd., model: E100).
[0074] Experimental results:
[0075] Compared with the WT group, SOD1-G93A mice showed loss of spinal motor neurons, and L-NRB could improve neuronal damage. Figure 3 A, Figure 3 D). Neuroinflammation is a prominent feature of ALS. Compared with the WT group, the model group mice had an increased number of astrocytes and microglia in the spinal cord. L-NRB can inhibit the activation of astrocytes and microglia ( Figure 3 B-3C, 3E-3F).
[0076] Example 4: Determination of serum inflammatory factor levels in mice
[0077] Experimental methods:
[0078] Mouse serum was collected, and the levels of pro-inflammatory factors IL-1β, TNF-α, and IL-6 in the mouse serum were detected using the ELISA method according to the kit instructions.
[0079] IL-1β: The mouse IL-1β detection kit (catalog number: HY-H0001) purchased from Beijing Huaying Biotechnology Research Institute was used for detection.
[0080] TNF-α: The mouse TNF-α detection kit (catalog number: HY-H0019) purchased from Beijing Huaying Biotechnology Research Institute was used for detection.
[0081] IL-6: The mouse IL-6 detection kit (catalog number: HY-H0007) purchased from Beijing Huaying Biotechnology Research Institute was used for detection.
[0082] Experimental results:
[0083] L-NRB and edaravone injections can inhibit the expression of pro-inflammatory factors IL-1β, TNF-α and IL-6 in serum. Figure 4 A- Figure 4 C).
[0084] Example 5: Measurement of length and weight of mouse gastrocnemius muscle and HE staining
[0085] Experimental methods:
[0086] The gastrocnemius muscle of the right hind limb of a mouse was harvested, and its weight was measured using an analytical balance, while its length was measured using calipers. The gastrocnemius muscle was then placed in a fixative, followed by sectioning and hematoxylin and eosin (HE) staining. The HE staining procedure is as follows:
[0087] 1. Frozen sections are warmed and fixed: Frozen sections are taken out of the -20℃ freezer and brought to room temperature. They are fixed with tissue fixative for 15 minutes and then rinsed with running water.
[0088] 2. Pretreatment: Soak the sections in high-resolution constant staining pretreatment solution for 1 min.
[0089] 3. Hematoxylin staining: Immerse the sections in hematoxylin staining solution for 3-5 minutes, wash with tap water, differentiate with differentiation solution, wash with tap water, re-blue with blue solution, and rinse with running water.
[0090] 4. Eosin staining: Dehydrate the sections in 95% alcohol for 1 minute, then stain them in eosin staining solution for 15 seconds.
[0091] 5. Dehydration and mounting: The sections are sequentially immersed in anhydrous ethanol I for 2 min, anhydrous ethanol II for 2 min, anhydrous ethanol III for 2 min, n-butanol I for 2 min, n-butanol II for 2 min, xylene I for 2 min, and xylene II for 2 min. After clearing, the sections are mounted with neutral resin.
[0092] 6. Microscopic examination, image acquisition and analysis.
[0093] Experimental results:
[0094] Compared with the model group, L-NRB increased the length and weight of the gastrocnemius muscle in SOD1-G93A mice. Figure 5 (A-5C). For example... Figure 5 As shown in Figure D, L-NRB significantly preserves the cross-sectional area of the gastrocnemius muscle.
[0095] Example 6: TUNEL staining of mouse brain and expression of Bcl-2 and Bax
[0096] Experimental methods:
[0097] Tunel staining experimental method:
[0098] 1. Fixation of frozen sections: Bake frozen sections in an oven at 37°C for 10-20 minutes, then drain off excess moisture. Fix in 4% paraformaldehyde for 30 minutes, then wash three times in PBS (pH 7.4) on a decolorizing shaker for 5 minutes each time.
[0099] 2. Proteinase K retrieval: After slightly drying the slides, draw circles around the tissue with a histochemical pen (to prevent fluid from flowing away). Add proteinase K working solution to the circle to cover the tissue, and incubate at 37°C for 20 min. Place the slides in PBS (pH 7.4) and wash three times on a decolorizing shaker for 5 min each time. (Preparation method for proteinase K working solution: stock solution: PBS = 1:9).
[0100] 3. Room temperature equilibration: After slightly drying the sections, add buffer to the circle to cover the tissue, and incubate with the buffer at room temperature for 10 minutes.
[0101] 4. Add reaction solution: Take an appropriate amount of TDT enzyme, dUTP and buffer from the TUNEL kit according to the number of slides and the size of the tissue. Mix them in a ratio of 1:5:50 and add them to the circle to cover the tissue. Place the slides flat in a humidified chamber and incubate at 37°C for 1 hour. Add a small amount of water to the humidified chamber to maintain humidity.
[0102] 5. DAPI counterstaining of cell nuclei: Wash sections three times with PBS (pH 7.4), 5 min each time. After removing the PBS, add DAPI staining solution to the circle and incubate at room temperature in the dark for 10 min.
[0103] 6. Mounting: Place the slides in PBS (pH 7.4) and wash three times on a decolorizing shaker for 5 minutes each time. After slightly drying the sections, mount them with an anti-fluorescence quenching mounting medium.
[0104] 7. Microscopic examination and photography: Observe the slides under a fluorescence microscope and acquire images. (DAPI is excited by ultraviolet light at a wavelength of 330-380nm, emits blue light at a wavelength of 420nm; 488 is excited by ultraviolet light at a wavelength of 465-495nm, emits green light at a wavelength of 515-555nm.)
[0105] Western Blot experimental procedure: Approximately 30 mg of mouse cerebral cortex tissue was placed in a 2 ml centrifuge tube. Magnetic beads and 300 μl of RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors were added. The mixture was homogenized using a tissue homogenizer, incubated at 4°C for 30 min, and then centrifuged at 12,000 rpm for 30 min. The supernatant was collected, loaded with loading buffer, mixed, and incubated in a 100°C metal bath for 10 min. Add 4 μl of sample to each well for loading, perform electrophoresis at 80V for 1.5 h, transfer membrane at 300 mA in an ice-water bath for 45 min, block with 5% skim milk for 2 h, incubate with primary antibody overnight (Bcl-2 recombinant antibody purchased from Abcam, catalog number: Ab182858, dilution ratio 1:2000; anti-Bax polyclonal antibody purchased from Wuhan Sanying, catalog number: 50599-2-Ig, dilution ratio 1:1000), wash the membrane 3 times with TBST for 10 min each time, then add 5% skim milk and incubate with secondary antibody diluted 1:2000 for 1 h, wash the membrane 3 times with TBST for 10 min each time, and then develop using an E-BLOT contact chemiluminescence imaging system.
[0106] Experimental results:
[0107] Compared with WT mice, SOD1-G93A mice showed a significant increase in Tunel-positive neurons in the cortical region. L-NRB treatment improved the upregulation of Tunel-positive neurons compared with the model group. Figure 6 A- Figure 6 B). Meanwhile, compared to the model group, L-NRB can reduce the Bcl-2 / Bax ratio ( Figure 6 C- Figure 6 D).
[0108] Example 7: Mouse brain transcriptome sequencing and mechanism verification
[0109] Experimental methods:
[0110] Gene expression profiles in the brains of WT and SOD1-G93A mice were analyzed using RNA sequencing. cDNA fragments were amplified by PCR to construct cDNA libraries. These libraries were then sequenced using an Illumina sequencing platform (Novaseq-PE250). Total RNA was extracted from mouse brain tissue using TRIZOL reagent. cDNA was then synthesized from the RNA using the PrimeScript RT Reagent kit (RR036A; Takara Bio). Finally, quantitative real-time analysis was performed using a quantitative real-time assay kit (RR820A; Takara Bio). The primer sequences are as follows: Htr4: F:TCTGGATGTCCTACTTACCACAG (SEQ ID NO.1), R:GCAGCAGATGGCGTAATACCT (SEQ ID NO.2); P11: F:TTTCACAGGTTTGCAGGCGA (SEQ ID NO.3), R:CACTTTGCCATCTCGGCACT (SEQ ID NO.4); Gapdh: F:AGGTCGGTGTGAACGGATTTG (SEQ ID NO.5), R:GGGGTCGTTGATGGCAACA (SEQ ID NO.6). As described in Example 5, the expression of Htr4 and P11 in the mouse brain was determined by Western blotting (Htr4 polyclonal antibody was purchased from Wuhan Sanying, catalog number: 21165-1-AP; P11 polyclonal antibody was purchased from Wuhan Sanying, catalog number: 11250-1-AP).
[0111] Experimental results:
[0112] KEGG analysis revealed that differentially expressed genes between the WT group and the model group were enriched in neuroactive ligand-receptor interactions. Figures 7A-7B ), related genes such as Figure 7C As shown. We examined the transcription and expression of Htr4 and its upstream target P11 in the cortex. Our results indicate that L-NRB can activate the P11-Htr4 pathway in the brain of SOD1-G93A mice. Figures 7D-7E ).
[0113] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. The application of L-NRB in the preparation of drugs for the prevention and treatment of amyotrophic lateral sclerosis (ALS), wherein the chemical formula of L-NRB is shown in Formula I: 。 2. The application according to claim 1, wherein the amyotrophic lateral sclerosis (ALS) is an ALS caused by a mutation in the SOD1 gene.
3. The application according to claim 1 or 2, wherein the drug inhibits the expression of inflammatory factors and the activation of astrocytes and microglia in the spinal cord.
4. The application according to claim 1 or 2, wherein the drug improves the pathological condition of the gastrocnemius muscle.
5. The application according to claim 1 or 2, wherein the drug inhibits brain cell apoptosis.
6. The application according to claim 1 or 2, wherein the drug activates the P11-Htr4 signaling pathway in the brain.
7. The application according to claim 1 or 2, wherein the drug is an oral, injectable, or transdermal dosage form.
Citation Information
Patent Citations
Hydroxypentyl benzoic acid diester compound as well as preparation method and pharmaceutical application thereof
CN114315585A
Novel quinoline derivative inhibitor
CN110857293A
Quinoline derivative of TAM family kinase inhibitor
CN112625026A