A microfluidic chip for detecting quarantine pathogens in raw grains

Abstract

The present application discloses a microfluidic chip for detecting quarantine pathogens of raw grains. Each microfluidic chip of the present application includes at least 8 detection channels, and each detection channel includes at least 48 reaction zones, and the 48 reaction zones are used for detecting 11 kinds of quarantine pathogens of raw grains; the 11 kinds of quarantine pathogens of raw grains include **Diaporthe phaseolorum var. caulivora**, **Phialophora gregata**, **Fusarium virguliforme**, **Curtobacterium flaccumfaciens pv. flaccumfaciens**, **Tilletia indica**, **Tilletia walkeri**, **Wheat streak mosaic virus**, **Xanthomonas stewartii subsp. stewartii**, **Clavibacter michiganensis subsp. nebraskensis**, **Maize chlorotic mottle virus** and **Clavibacter michiganensis subsp. michiganensis**. The microfluidic chip of the present application can simultaneously detect 11 kinds of quarantine pathogens of raw grains for 8 samples to be tested, improves the detection efficiency, and has important significance for the inspection and quarantine work of quarantine pathogens of raw grains. **Note**: The scientific names of the pathogens are provided in Latin for accuracy in the technical field, and they can be adjusted according to specific requirements or common usage in the relevant industry. If you need to use more common or simplified names, please let me know and I can modify accordingly.

Description

Technical Field

[0001] This application relates to the technical field of raw grain pathogen detection, and particularly to a microfluidic chip for detecting quarantine pathogens in raw grains. Background Art

[0002] Raw grains refer to the general term for unprocessed grains or crops such as soybeans, wheat, and corn. Raw grain pathogens include fungi, bacteria, viruses, oomycetes, etc., which are important factors seriously affecting raw grain production and trade. Among many raw grain pathogens, quarantine pathogens are particularly harmful; these include Diaporthe phaseolorum var. caulivora, Cadophora gregata, Fusarium virguliforme, Curtobacterium flaccumfaciens pv. flaccumfaciens, Tilletia indica, Tilletia walkeri, Wheat streak mosaic virus (WSMV), Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. nebraskensis, Maize chlorotic mottle virus (MCMV), Clavibacter michiganensis subsp. michiganensis, etc.

[0003] Existing detection methods for raw grain quarantine pathogens include traditional morphological identification detection methods based on Koch's postulates, serological detection methods, conventional PCR detection methods, isothermal amplification detection methods, real-time fluorescence PCR detection methods, etc. These methods can only detect a single pathogen each time, or can only simultaneously detect a few pathogens, with relatively low efficiency.

[0004] Moreover, existing detection methods all have different defects and deficiencies. Traditional morphological identification detection methods: 1. The cultivation takes a long time, generally requiring 7 to 14 days of cultivation; 2. The workload is large, and usually a large number of selective media need to be prepared for cultivation; 3. For pathogens such as bacteria and viruses that are difficult to observe characteristics by microscopy, it is difficult to directly obtain detection results quickly and accurately; 4. Factors such as medium selection and laboratory environment (such as pH, temperature, etc.) will affect the growth of microorganisms, and there is a risk of medium contamination, all of which will affect the identification results. Serological detection methods: 1. The preparation of antiserum takes a long time, and there are often false positive reactions, resulting in reduced detection sensitivity; 2. When the amount of antibody and antigen is small or the quality is not high, this method cannot be used for detection. Conventional PCR detection methods: 1. Operations such as gel preparation and gel running are harmful to the human body; 2. Opening the PCR tube during the operation process is prone to aerosol contamination. Disadvantages of isothermal amplification methods: 1. This detection method has high requirements for primer design; 2. This method is extremely prone to contamination and false positives. Disadvantages of real-time fluorescence PCR detection technology: The process of preparing the working solution is cumbersome and time-consuming.

[0005] In summary, there is currently a lack of simple, effective, high-throughput and rapid detection technologies for quarantine pathogens in raw grains, which has greatly affected the inspection and quarantine work of quarantine pathogens in raw grains. Summary of the Invention

[0006] The purpose of the present application is to provide a new microfluidic chip for detecting quarantine pathogens in raw grains.

[0007] The present application adopts the following technical solutions:

[0008] One aspect of the present application discloses a microfluidic chip for detecting quarantine pathogens in raw grains. Each microfluidic chip includes 8 detection channels, and each detection channel includes 48 reaction zones. The 48 reaction zones are used to detect 11 quarantine pathogens in raw grains; the 11 quarantine pathogens in raw grains include *Diaporthe phaseolorum* var. *meridionalis*, *Phialophora gregata*, *Fusarium virguliforme*, *Curtobacterium flaccumfaciens* pv. *flaccumfaciens*, *Tilletia indica*, *Tilletia walkeri*, *Wheat streak mosaic virus*, *Pantoea stewartii* subsp. *stewartii*, *Clavibacter nebraskensis*, *Maize chlorotic mottle virus*, *Clavibacter michiganensis* subsp. *michiganensis*.

[0009] It should be noted that the microfluidic chip of the present application creatively integrates 11 quarantine pathogens that cause great harm to raw grains onto one microfluidic chip, and designs detection primers and probes for the 11 quarantine pathogens in raw grains, so that the 11 quarantine pathogens in raw grains can be detected simultaneously and with high throughput on the same microfluidic chip, improving the detection efficiency of quarantine pathogens in raw grains, which is of great significance for the inspection and quarantine work of quarantine pathogens in raw grains.

[0010] In one implementation of the present application, the reaction zone for detecting **Diaporthe phaseolorum var. caulivora** contains specific detection primers and probes for **Diaporthe phaseolorum var. caulivora**, the reaction zone for detecting **Phialophora gregata** contains specific detection primers and probes for **Phialophora gregata**, the reaction zone for detecting **Fusarium virguliforme** contains specific detection primers and probes for **Fusarium virguliforme**, the reaction zone for detecting **Curtobacterium flaccumfaciens pv. flaccumfaciens** contains specific detection primers and probes for **Curtobacterium flaccumfaciens pv. flaccumfaciens**, the reaction zone for detecting **Tilletia indica** contains specific detection primers and probes for **Tilletia indica**, the reaction zone for detecting **Tilletia walkeri** contains specific detection primers and probes for **Tilletia walkeri**, the reaction zone for detecting **Wheat streak mosaic virus** contains specific detection primers and probes for **Wheat streak mosaic virus**, the reaction zone for detecting **Xanthomonas stewartii subsp. stewartii** contains specific detection primers and probes for **Xanthomonas stewartii subsp. stewartii**, the reaction zone for detecting **Clavibacter michiganensis subsp. nebraskensis** contains specific detection primers and probes for **Clavibacter michiganensis subsp. nebraskensis**, the reaction zone for detecting **Maize chlorotic mottle virus** contains specific detection primers and probes for **Maize chlorotic mottle virus**, and the reaction zone for detecting **Clavibacter michiganensis subsp. michiganensis** contains specific detection primers and probes for **Clavibacter michiganensis subsp. michiganensis**.

[0011] Note: The scientific names in the original text are translated into English in the translation. For the accuracy of the translation, it is recommended to double-check with relevant scientific literature or experts.In one implementation of the present application, the upstream and downstream primers of the specific detection primers and probes for **Diaporthe phaseolorum** var. **sojae** are the sequences shown in Seq ID No.1 and 2 in sequence, and the probe is the sequence shown in Seq ID No.3; the specific upstream and downstream primers for **Phialophora gregata** are the sequences shown in Seq ID No.4 and 5 in sequence, and the probe is the sequence shown in Seq ID No.6; the specific upstream and downstream primers for **Fusarium virguliforme** are the sequences shown in Seq ID No.7 and 8 in sequence, and the probe is the sequence shown in Seq ID No.9; the upstream and downstream primers of the specific detection primers and probes for **Curtobacterium flaccumfaciens** pv. **flaccumfaciens** are the sequences shown in Seq ID No.10 and 11 in sequence, and the probe is the sequence shown in Seq ID No.12; the upstream and downstream primers of the specific detection primers and probes for **Tilletia indica** are the sequences shown in Seq ID No.13 and 14 in sequence, and the probe is the sequence shown in Seq ID No.15; the upstream and downstream primers of the specific detection primers and probes for **Tilletia walkeri** are the sequences shown in Seq ID No.16 and 17 in sequence, and the probe is the sequence shown in Seq ID No.18; the upstream and downstream primers of the specific detection primers and probes for **Wheat streak mosaic virus** are the sequences shown in Seq ID No.19 and 20 in sequence, and the probe is the sequence shown in Seq ID No.21; the upstream and downstream primers of the specific detection primers and probes for **Xanthomonas campestris** pv. **zeae** are the sequences shown in Seq ID No.22 and 23 in sequence, and the probe is the sequence shown in Seq ID No.24; the upstream and downstream primers of the specific detection primers and probes for **Clavibacter michiganensis** subsp. **nebraskensis** are the sequences shown in Seq ID No.25 and 26 in sequence, and the probe is the sequence shown in Seq ID No.27; the upstream and downstream primers of the specific detection primers and probes for **Maize chlorotic mottle virus** are the sequences shown in Seq ID No.28 and 29 in sequence, and the probe is the sequence shown in Seq ID No.30; the upstream and downstream primers of the specific detection primers and probes for **Clavibacter michiganensis** subsp. **michiganensis** are the sequences shown in Seq ID No.31 and 32 in sequence, and the probe is the sequence shown in Seq ID No.33.

[0012] In one implementation of the present application, the specific detection primers and probes corresponding to the quarantine pathogens in raw grains are pre-embedded in the corresponding detection reaction zones. For example, the specific detection primers and probes for **Diaporthe phaseolorum** var. **sojae** are pre-embedded in the reaction zone for detecting **Diaporthe phaseolorum** var. **sojae**. During detection, it only requires introducing the mixed solution of the reaction solution and the detection sample into the detection channel. In one implementation of the present application, the microfluidic chip includes 8 detection channels, enabling simultaneous detection of 8 different samples.

[0013] In one implementation of the present application, the volume of each reaction zone is 1 μL.

[0014] On the other hand, the present application discloses the use of the microfluidic chip of the present application in the preparation of a detection kit for quarantine pathogens in raw grains.

[0015] On yet another aspect, the present application discloses a detection kit for quarantine pathogens in raw grains, which contains the microfluidic chip of the present application.

[0016] In one implementation of the present application, the kit further contains positive and / or negative controls for 11 quarantine pathogens in raw grains.

[0017] In one implementation of the present application, the positive control is a plasmid containing the detection fragment of the quarantine pathogen in raw grains.

[0018] In one implementation of the present application, the kit further contains a probe-based real-time fluorescence quantitative PCR detection reagent.

[0019] It should be noted that for convenience of use, the microfluidic chip of the present application is assembled with the supporting positive control, negative control, probe-based real-time fluorescence quantitative PCR detection reagent, etc. into a kit; it can be understood that except for the microfluidic chip of the present application, other components can be purchased separately on the market.

[0020] The beneficial effects of the present application are as follows:

[0021] The microfluidic chip of the present application has high detection efficiency. Each chip can simultaneously detect 11 quarantine pathogens in raw grains for 8 samples to be tested, improving the detection efficiency of quarantine pathogens in raw grains, which is of great significance for the inspection and quarantine work of quarantine pathogens in raw grains. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is a design schematic diagram of the microfluidic chip in the embodiment of the present application;

[0023] Figure 2 is a schematic diagram of reaction condition parameters on the microfluidic chip in the embodiment of the present application;

[0024] Figure 3 is the chip specificity verification result of the soybean northern stem canker pathogen in the embodiment of the present application;

[0025] Figure 4 is the chip specificity verification result of the soybean stem brown rot pathogen in the embodiment of the present application;

[0026] Figure 5 is the chip specificity verification result of the North American soybean sudden death syndrome pathogen in the embodiment of the present application;

[0027] Figure 6 is the chip specificity verification result of the bean bacterial wilt pathogen in the embodiment of the present application;

[0028] Figure 7 It is the chip specificity verification result of Tilletia indica Mitra in the embodiments of this application;

[0029] Figure 8 It is the chip specificity verification result of Tilletia walkeri in the embodiments of this application;

[0030] Figure 9 It is the chip specificity verification result of Wheat streak mosaic virus in the embodiments of this application;

[0031] Figure 10 It is the chip specificity verification result of Xanthomonas stewartii subsp. stewartii in the embodiments of this application;

[0032] Figure 11 It is the chip specificity verification result of Corynebacterium nebraskense in the embodiments of this application;

[0033] Figure 12 It is the chip specificity verification result of Maize chlorotic mottle virus in the embodiments of this application;

[0034] Figure 13 It is the chip specificity verification result of Clavibacter michiganensis subsp. michiganensis in the embodiments of this application;

[0035] Figure 14 It is the chip sensitivity verification result of Diaporthe phaseolorum var. caulivora in the embodiments of this application;

[0036] Figure 15 It is the chip sensitivity verification result of Phialophora gregata in the embodiments of this application;

[0037] Figure 16 It is the chip sensitivity verification result of Fusarium virguliforme in the embodiments of this application;

[0038] Figure 17 It is the chip sensitivity verification result of Curtobacterium flaccumfaciens pv. flaccumfaciens in the embodiments of this application;

[0039] Figure 18 It is the chip sensitivity verification result of Tilletia indica Mitra in the embodiments of this application;

[0040] Figure 19 It is the chip sensitivity verification result of Tilletia walkeri in the embodiments of this application;

[0041] Figure 20 It is the chip sensitivity verification result of Wheat streak mosaic virus in the embodiments of this application;

[0042] Figure 21 It is the chip sensitivity verification result of Xanthomonas stewartii subsp. stewartii in the embodiments of this application;

[0043] Figure 22 It is the chip sensitivity verification result of *Diplodia maydis* in the embodiments of this application;

[0044] Figure 23 It is the chip sensitivity verification result of *Maize chlorotic mottle virus* in the embodiments of this application;

[0045] Figure 24 It is the chip sensitivity verification result of *Clavibacter michiganensis subsp. michiganensis* in the embodiments of this application;

[0046] Figure 25 It is the result of the microfluidic chip detecting soybeans carrying *Diaporthe phaseolorum var. caulivora* in the embodiments of this application;

[0047] Figure 26 It is the result of the microfluidic chip detecting soybeans carrying *Curtobacterium flaccumfaciens pv. flaccumfaciens* in the embodiments of this application;

[0048] Figure 27 It is the result of the microfluidic chip detecting *Diaporthe phaseolorum var. caulivora* carried in a mixed sample in the embodiments of this application;

[0049] Figure 28 It is the result of the microfluidic chip detecting *Curtobacterium flaccumfaciens pv. flaccumfaciens* carried in a mixed sample in the embodiments of this application;

[0050] Figure 29 It is the specific detection result of the existing primers and probes for *Diaporthe phaseolorum var. caulivora* in the embodiments of this application;

[0051] Figure 30 It is the sensitivity detection result of the existing primers and probes for *Diaporthe phaseolorum var. caulivora* in the embodiments of this application;

[0052] Figure 31 It is the specific detection result of the existing primers and probes for *Tilletia indica* in the embodiments of this application;

[0053] Figure 32 It is the sensitivity detection result of the existing primers and probes for *Tilletia indica* in the embodiments of this application. Detailed implementation manners

[0054] A microfluidic chip is a chip that can precisely control the entry of nanoliter to microliter droplets into corresponding regions in a tiny channel for reaction. Its basic structure includes a sample loading hole, a liquid storage area, a unidirectional microfluidic droplet channel, and a reaction area. Generally, it will also be combined with various sensors, flow meters, gas or liquid power devices, etc. Its principle is to use microfluidic channels or flow meters to detect and control the direction, flow rate, flow volume, and pressure of the fluid. Through the characteristics of multiple outlets and single-channel input of the microfluidic tube, it can effectively control the liquid flow process, pressure, flow direction, and flow volume when controlled by signals. When necessary, the microfluidic tube can be programmed to adjust and control the microfluidic droplets according to the needs of different experiments.

[0055] This application creatively combines a microfluidic chip with Taqman probe real-time fluorescence PCR, that is, combines the specific primers and probes of 11 quarantine pathogens of raw grains, including quarantine fungi, bacteria, viruses, and oomycetes, with the microfluidic chip to achieve the simultaneous detection of these quarantine pathogens, thereby improving the detection efficiency and quality of quarantine pathogens of raw grains.

[0056] The microfluidic chip for the detection of quarantine pathogens of raw grains in this application can achieve the simultaneous and high-throughput detection of quarantine pathogens of different nucleic acid types such as quarantine fungi, bacteria, viruses, and oomycetes on raw grains, which cannot be achieved by the existing technology. Therefore, compared with the existing methods for detecting quarantine pathogens of raw grains, the microfluidic chip of this application has the following advantages:

[0057] High throughput: Each chip can complete a total of 176 reactions for 8 samples to be tested.

[0058] High detection efficiency: Each chip can simultaneously detect 11 quarantine pathogens for 8 samples to be tested.

[0059] Less consumption of experimental materials and reagents: The volume of each reaction area is only 1 μL, which can effectively reduce the consumption of samples and reagents.

[0060] High accuracy: It can accurately detect 11 target pathogens.

[0061] Strong specificity: It can specifically distinguish 11 target quarantine pathogens and their similar species.

[0062] High sensitivity: The sensitivity can reach single copy per μL;

[0063] Convenience: The operation is simple. The specific primers and probes are pre-embedded in the reaction area of the microfluidic chip. The operator only needs to mix the sample to be tested with the Taqman reaction Mix solution and then load the sample into the microfluidic chip through the sample loading hole to perform the detection.

[0064] The present application will be further described in detail below through specific embodiments. The following embodiments are only for further illustration of the present application and should not be construed as limitations on the present application.

[0065] Example

[0066] 1 Materials and Methods

[0067] 1.1 Main Reagents and Instruments

[0068] ABI TaqPath TM 1-Step RT-qPCR MM, CG, 1.5 mL RNase-Free centrifuge tubes, 1.5 mL DNase-Free centrifuge tubes, 11 kinds of pathogen qPCR primers and probes, ddH2O, QIAGEN DNeasy Plant Pro Kit, TIANGEN RNAprep pure Plant Kit, DTT solution, microfluidic chip (Thermo Fisher Scientific (China) Co., Ltd

[0069] Thermo Fisher Scientific), PCR 96-Well reaction plates, etc. Some of the instruments are shown in Table 1.

[0070] Table 1 List of Main Instruments

[0071] Instrument Name Model Manufacturer Microfluidic Chip Detector <![CDATA[QuantStudio TM 7Flex]]> Thermo Fisher Scientific (China) Co., Ltd. Laminar Flow Hood HERAGUARD ECO Thermo Fisher Scientific (China) Co., Ltd. Microfluidic Chip Centrifuge ST40R Thermo Fisher Scientific (China) Co., Ltd. Desktop Microcentrifuge Spectrafuge 24D Labnet International, Inc. Vortex Oscillator Vortex Mixer 200 Labnet International, Inc. Pure Water Instrument OSJ-PLUS-UP-250VF Shandong OLB Scientific Instrument Co., Ltd. High-Speed Centrifuge 5418R Eppendorf AG Automated Sample Crusher TissuelyserⅡ QIAGEN GmbH

[0072] 1.2 Test Samples

[0073] Soybeans detected at the port carrying the pathogen of soybean northern stem canker, soybeans artificially inoculated with the pathogen of bean bacterial wilt, and the remaining test pathogens are shown in Table 2.

[0074] Table 2 Test Pathogens

[0075]

[0076]

[0077] 1.3 Nucleic Acid Extraction

[0078] Use the QIAGEN DNeasy Plant Pro Kit for DNA extraction and the TIANGEN RNAprep pure Plant Kit for RNA extraction. The specific steps are as follows:

[0079] Steps for DNA extraction and purification:

[0080] a) Homogenization treatment: 100 mg of soybean samples are quickly ground into powder in liquid nitrogen, and 500 μL of lysis buffer 1 is added to a 2 mL tissue grinding tube, and vortexed vigorously to mix evenly.

[0081] b) Centrifuge at 12,000 rpm for 2 min, and transfer the supernatant solution to a 1.5 mL centrifuge tube.

[0082] c) Add 200 μL of Lysis Buffer 2 to the centrifuge tube and vortex for 5 s.

[0083] d) Centrifuge at 12,000 rpm for 1 min at room temperature. To prevent precipitation, quickly transfer the supernatant to a clean 1.5 mL centrifuge tube.

[0084] e) Add 500 μL of Wash Buffer 1 to the centrifuge tube and vortex for 5 s.

[0085] f) Add 600 μL of the lysate solution to the adsorption column MB and centrifuge at 12,000 rpm for 1 min.

[0086] g) Discard the filtrate, and repeat step f until all the lysate has passed through the column.

[0087] h) Place the adsorption column MB in a clean 2 mL collection tube. Add 650 μL of Wash Buffer 2 to the adsorption column MB and centrifuge at 12,000 rpm for 1 min. Discard the filtrate and place the adsorption column MB in the same 2 mL collection tube.

[0088] i) Add 650 μL of Wash Buffer 3 to the adsorption column MB and centrifuge at 12,000 rpm for 1 min. Discard the filtrate and place the adsorption column MB in the same 2 mL collection tube.

[0089] j) Centrifuge at 16,000 g for 2 min. Place the adsorption column MB in a new clean 1.5 mL centrifuge tube. Add 100 μL of elution buffer to the white center of the adsorption column MB and centrifuge at 12,000 rpm for 1 min. Discard the adsorption column MB to obtain the DNA solution.

[0090] Steps for RNA extraction and purification:

[0091] a) Homogenization treatment: Quickly grind 100 mg of soybean sample into powder in liquid nitrogen, add 450 μL of lysis buffer, and vortex vigorously to mix evenly.

[0092] b) Transfer all the solution to the filter column (the filter column is placed in the collection tube), centrifuge at 12,000 rpm for 5 min, carefully aspirate the supernatant in the collection tube into an RNase-Free centrifuge tube, and try to avoid the pipette tip touching the cell debris precipitate in the collection tube.

[0093] c) Slowly add anhydrous ethanol with a volume 0.5 times that of the supernatant (usually 225 μL), mix well (precipitation may occur at this time), transfer the resulting solution and precipitate together into adsorption column CR3, centrifuge at 12,000 rpm for 60 s, pour out the waste liquid in the collection tube, and put adsorption column CR3 back into the collection tube. If there is a loss in the volume of the supernatant, adjust the amount of ethanol added.

[0094] d) Add 350 μL of protein removal solution to adsorption column CR3, centrifuge at 12,000 rpm for 60 s, pour out the waste liquid in the collection tube, and put adsorption column CR3 back into the collection tube.

[0095] e) Preparation of DNase 1 working solution: Take 10 μL of DNase 1 stock solution and put it into a new RNase-Free centrifuge tube, add 70 μL of RDD buffer, and gently mix well.

[0096] f) Add 80 μL of DNase 1 working solution to the center of adsorption column CR3, and let it stand at room temperature for 15 min.

[0097] g) Add 350 μL of protein removal solution to adsorption column CR3, centrifuge at 12,000 rpm for 60 s, pour out the waste liquid in the collection tube, and put adsorption column CR3 back into the collection tube.

[0098] h) Add 500 μL of wash solution to adsorption column CR3, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 60 s, pour out the waste liquid in the collection tube, and put adsorption column CR3 back into the collection tube. Repeat once.

[0099] i) Centrifuge at 12,000 rpm for 2 min, and pour out the waste liquid. Place adsorption column CR3 at room temperature for several minutes to thoroughly dry the residual wash solution in the adsorption material.

[0100] j) Note: The purpose of this step is to remove the residual wash solution in adsorption column CR3. The residue of the wash solution may affect subsequent experiments such as RT. Put adsorption column CR3 into a new RNase-Free centrifuge tube, suspend and add 30 - 100 μL of RNase-Free ddH2O dropwise to the middle part of the adsorption membrane, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min, and obtain the RNA solution.

[0101] 1.4 Primer and probe design and sequence optimization

[0102] In this experiment, TaqMan qPCR microfluidic chip technology is used to collect information on the target pathogens on the raw grains, and to modify and design specific qPCR primers and probes.

[0103] Specifically, primer and probe sequences were designed for the coat protein-like gene target of wheat streak mosaic virus, for the ITS gene fragment target of Diaporthe phaseolorum var. meridionalis, for the mitochondrial target of Tilletia indica, and for the mitochondrial target of Tilletia walkeri.

[0104] Probe sequences were designed for the coat protein gene target of maize chlorotic mottle virus, for the 16S rRNA gene target of Curtobacterium flaccumfaciens pv. flaccumfaciens, for the cpsA-cpsB intergenic spacer target of Pantoea stewartii subsp. stewartii, for the 16S rRNA gene target of Clavibacter michiganensis subsp. nebraskensis, for the 16S rRNA gene target of Clavibacter michiganensis subsp. michiganensis, for the coat protein-like gene target of southern bean mosaic virus, for the coat protein gene target of Arabis mosaic virus, for the coat protein-like gene target of tomato ringspot virus, for the NTS gene fragment target of Phialophora gregata, and for the IGS gene target of Fusarium virguliforme.

[0105] The primer and probe sequences are shown in Table 3, and all primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The amplified fragments of the primers in this example are shown in Table 4.

[0106] For the amplified target fragments of the specific primers, in this experiment, the target fragments were cloned into the pUC57 plasmid and used as positive controls. The plasmid cloning was carried out by Sangon Biotech (Shanghai) Co., Ltd.

[0107] Table 3 Primer and Probe Sequences

[0108] Name Sequence (5’-3’) SEQ ID No. Soybean Northern Stem Canker F CCAGAAACCCTTTGTGAACTT 1 Soybean Northern Stem Canker R ATGTTTATTTCTCAGAGTTTCAGTG 2 Soybean Northern Stem Canker P FAM-CGGCCAAGCTAACTCTTG-MGB 3 Soybean Stem Brown Rot F GGAATTGGTGGGAGAGG 4 Soybean Stem Brown Rot R GACTTCTAGGGTATGTCTACAGTG 5 Soybean Stem Brown Rot P FAM-AGG CTA CTC TTA CAG GCT CTC-MGB 6 North American Soybean Sudden Death Syndrome F GGTGCAGGGTAGGTCAGATTTG 7 North American Soybean Sudden Death Syndrome R ACCATCCGTCTGGGAATTTTAACTA 8 North American Soybean Sudden Death Syndrome P FAM-TCCCACTAAATCTGGT-MGB 9 Common Bean Bacterial Wilt F GTTATGACTGAACTTCACTCC 10 Common Bean Bacterial Wilt R GATGTTCCCGGTGTTCAG 11 Common Bean Bacterial Wilt P TCAATTGCCGCCACCCGGTC 12 Wheat Karnal Bunt F GGCACCAGAGTACAGCTG 13 Wheat Karnal Bunt R GCGAAGCGGTCCATGTC 14 Wheat Karnal Bunt P FAM-ATGATGGCCTCGATACCA-MGB 15 Lolium temulentum Bunt F ATGACTTTCATGATGGCCTCT 16 Lolium temulentum Bunt R GCGAAGCGGTCCATGTT 17 Lolium temulentum Bunt P CCGACGTTGGTCTC 18 Wheat Streak Mosaic F ACGACAATCAGCAAGAGACCAA 19 Wheat Streak Mosaic R TGAGGATCGCTGTGTTTCAGTC 20 Wheat Streak Mosaic P FAM-ATGGAGTTCAAGAGAATATGA-MGB 21 Maize Bacterial Blight F AGAAAACGCTGATGCCAGAC 22 Maize Bacterial Blight R ACTATCCTGACTCAGGCACT 23 Bacterial wilt of maize P FAM-CAACCGTTTTCATAGTACCA-MGB 24 Internal necrosis of maize F TGTCGAGGGCATGTTGCACG 25 Internal necrosis of maize R GGAGACAGAATTGACCAATGAT 26 Internal necrosis of maize P FAM-TCGGACCCTTTCCGTC-MGB 27 Maize chlorotic mottle F CCATGTCCGAAATTCTGCTTG 28 Maize chlorotic mottle R GATGCGCACAGAGTTGAACAC 29 Maize chlorotic mottle P FAM-CGAGATTCCAGTGTGCG-MGB 30 Tomato canker F TCAGGCGTCTGTTCTGGC 31 Tomato canker R CCCACCACCATCCACAAC 32 Tomato canker P FAM-TCGGGCTGCTAGTACG-MGB 33

[0109] Table 4 Primer Amplified Fragments

[0110]

[0111]

[0112] It should be noted that primers and probes for separately detecting the 11 quarantine pathogens of raw grains detected in this example are available in publicly available literature or materials; however, in order to meet the simultaneous detection of the 11 quarantine pathogens of raw grains by the microfluidic chip in this example, primers or probes that meet the usage requirements of this example were redesigned respectively for the detection targets of these quarantine pathogens of raw grains. For example, for *Diaporthe phaseolorum* var. *sojae*, the primers and probes newly designed in this example have better specificity and are less likely to form hairpin structures and dimer structures. Experimental results show that the primers and probes newly designed in this example have higher amplification efficiency and better specificity compared with the existing primers and probes.

[0113] In this example, the existing primers and probes for *Diaporthe phaseolorum* var. *sojae*: DC2F, DC2R, DC2Pb, were used as a comparison for specificity and sensitivity tests. The sequences of the existing primers and probes are as follows:

[0114] DC2F, SEQ ID No.34: 5’-CCGGCGGCCAAGCTA-3’

[0115] DC2R, SEQ ID No.35: 5’-AGAACCAAGAGATCCGTTGTTGAA-3’

[0116] DC2Pb, SEQ ID No.36: 5’-FAM-CATTTATGTTTATTTCTCAGAGTTT-MGB-3’

[0117] Using the same reaction system and conditions in this example, the above primers and probes were tested in the same microfluidic chip.

[0118] The existing standard method for *Fusarium virguliforme* is the duplex PCR method, and there is no qPCR detection method yet. In this example, new qPCR primers and probes were designed for it.

[0119] For the existing qPCR detection method of *Tilletia indica* on wheat, the forward and reverse primers and probes newly designed in this example have good specificity; and, the newly designed primers are less likely to form hairpin structures compared with the original primers.

[0120] In this example, the existing primers and probes for *Tilletia indica* on wheat: Wheat Karnal Bunt F, Wheat Karnal Bunt R, Wheat Karnal Bunt P, were used as a comparison for specificity and sensitivity tests. The sequences of the existing primers and probes are as follows:

[0121] Wheat Karnal Bunt F, SEQ ID No.37: 5’-AGCCATCACTGGAGTTGTCATG-3’

[0122] Wheat Karnal bunt R, SEQ ID No.38: 5’-CCCAGCAAGGTCACCTTTGA-3’

[0123] Wheat Karnal bunt P, SEQ ID No.39: 5’-FAM-CCGACCGTATCGGTCT-MGB-3’

[0124] Using the same reaction system and conditions as in this example, the above primer-probes were tested in the same microfluidic chip.

[0125] 1.5 Microfluidic chip design

[0126] The upper layer of the microfluidic chip is a sealed cover, which can prevent liquid evaporation and aerosol contamination; the lower layer is an eight-channel reaction chip made of polycarbonate (PC) and polyethylene (PE) materials. Each channel corresponds to a sample addition port and contains 48 reaction zones with a volume of 1 μL. Therefore, 384 qPCR reactions can be independently run simultaneously. The qPCR primers and probes corresponding to the target pathogens were pre-embedded in each reaction zone of the microfluidic chip, and also included a sample nucleic acid extraction quality control gene 18S internal reference, which was provided by Thermo Fisher Scientific. The design of the microfluidic chip is detailed in Figure 1 .

[0127] 1.6 Specificity test

[0128] Specificity detection was performed on the fabricated microfluidic chip using the positive plasmid and nucleic acid of the target pathogen. Nucleic acids of 11 important quarantine plant pathogens on raw grains were used for TaqMan qPCR microfluidic chip detection, and specificity analysis was carried out to judge whether there was cross-reaction between different pathogens. After measuring the concentration of each target pathogen nucleic acid solution, the concentration was converted into DNA / RNA copy number, and it was diluted with ddH2O without nucleic acid for the specificity experiment.

[0129] For Diaporthe phaseolorum var. caulivora, DNA extracted from 3 different strains was used, labeled as 2012SC01 DNA, 2013SA01 DNA, and 2013SC02 DNA, as positive controls. Diaporthe phaseolorum var. meridionalis, Diaporthe helianthi, Cadophora gregata, Phytophthora sojae, Fusarium virguliforme, and Fusarium tucumaniae were used as negative controls, and ddH2O was set as a blank control.

[0130] For the positive control, DNA extracted from three strains of Cadophora gregata with different sources (labeled as 2015SU85 DNA, 2014SU85 DNA, 2014SU84 DNA) was used. For the negative control, Fusarium virguliforme, Fusarium tucumaniae, Diaporthe phaseolorum var. caulivora, Diaporthe phaseolorum var. meridionalis, and Phytophthora sojae were used. And ddH2O was set as the blank control.

[0131] For the positive control, DNA extracted from three strains of Fusarium virguliforme with different sources (labeled as 22490DNA, 22825DNA, ARG1.1 DNA) was used. For the negative control, Fusarium graminearum, Fusarium brasiliense, Fusarium tucumaniae, Diaporthe phaseolorum var. caulivora, Diaporthe phaseolorum var. meridionalis, Cadophora gregata, and Phytophthora sojae were used. And ddH2O was set as the blank control.

[0132] For the positive control, DNA extracted from three strains of Curtobacterium flaccumfaciens pv. flaccumfaciens with different sources (labeled as 470360DNA, 470359DNA, 470358DNA) was used. For the negative control, Curtobacterium flaccumfaciens.pv. oortii, Curtobacterium flaccumfaciens pv. betae, Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. michiganensis were used. And ddH2O was set as the blank control.

[0133] DNA extracted from three strains of Tilletia indica with different sources (labeled as 5114DNA, TIM2-180926DNA, TIM1-180919DNA) was used as the positive control, Tilletia walkeri, Tilletia controversa, Tilletia fusca, Tilletia foetida, and Tilletia laevis were used as negative controls, and ddH2O was set as the blank control.

[0134] DNA extracted from three strains of Tilletia walkeri with different sources (CBS121956DNA, CBS121955DNA, T39 DNA) was used as the positive control, Tilletia indica, Tilletia controversa, Tilletia fusca, Tilletia foetida, and Tilletia laevis were used as negative controls, and ddH2O was set as the blank control.

[0135] RNA extracted from three strains of Wheat streak mosaic virus (WSMV) with different sources (labeled as WSMVC2725RNA, WSMV JC RNA, WSMV 1RNA) was used as the positive control, BPMV, SBMV, MCMV, ArMV, ToRSV, and BYMV were used as negative controls, and ddH2O was set as the blank control.

[0136] DNA extracted from three strains of Pantoea stewartii subsp. stewartii with different sources (labeled as 470524DNA, 470522DNA, 470523DNA) was used as the positive control, Pantoea dispersa, Clavibacter michiganensis subsp. nebraskensis, Curtobacterium flaccumfaciens pv. oortii, and Curtobacterium flaccumfaciens pv. betae were used as negative controls, and ddH2O was set as the blank control.

[0137] For Clavibacter michiganensis subsp. nebraskensis, DNA extracted from its three strains with different sources (labeled as 470321DNA, 470324DNA, 470322DNA) was used as the positive control, Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. tessellarius, Clavibacter michiganensis subsp. sepedonicus, Pantoea stewartii subsp. stewartii were used as the negative controls, and ddH2O was set as the blank control.

[0138] For Maize chlorotic mottle virus MCMV, RNA extracted from its three strains with different sources (labeled as MCMVC2453RNA, MCMV JC1 RNA, MCMV+RNA) was used as the positive control, BPMV, SBMV, WSMV, ArMV, ToRSV, BYMV were used as the negative controls, and ddH2O was set as the blank control.

[0139] For Clavibacter michiganensis subsp. michiganensis, DNA extracted from its three strains with different sources (labeled as 470302DNA, 470307DNA, 470303DNA) was used as the positive control, Clavibacter michiganensis subsp. nebraskensis, Clavibacter michiganensis subsp. tessellarius, Clavibacter michiganensis subsp. sepedonicus, Pantoea stewartii subsp. stewartii were used as the negative controls, and ddH2O was set as the blank control.

[0140] The qPCR reaction system of the microfluidic chip includes: TaqPath TM 1-Step RT-qPCR MM, CG(4×) 25 μL, nucleic acid sample 50 μL, ddH2O 25 μL, with a total volume of 100 μL.

[0141] Add the working fluid into the sample loading hole of the microfluidic chip through the sample loading port, and centrifuge it at 1000 g for 2 min in the ST40R microfluidic chip centrifuge to evenly distribute the working fluid into 384 PCR reaction zones. Use a sealer to seal the channels of each reaction cavity on the microfluidic chip and prepare for the reaction.

[0142] On the QuantStudio TM 7Flex type Real-Time PCR instrument, the qPCR amplification reaction running parameters are as Figure 2 shown, specifically including: 25 °C for 2 min, 50 °C for 15 min, 95 °C for 10 min, and then enter 40 cycles: 95 °C for 3 s, 60 °C for 1 min. After the cycle ends, standby at 4 °C.

[0143] 1.7 Sensitivity test

[0144] 1.7.1 Sensitivity of plasmid standards

[0145] Add 1000 μL of ddH2O without nucleic acid to each plasmid tube to prepare a plasmid solution with a concentration of 4 ng / μL. Then, according to the plasmid fragment length, use the Thermo Fisher DNA Copy Number and Dilution Calculator to dilute it to a plasmid solution of 10 7 copies / μL. Take 10 μL of each target pathogen positive plasmid with a concentration of 10 7 copies / μL and add them to 880 μL of enzyme-free water in sequence to prepare a 1000 μL positive plasmid mixture with a concentration of 10 5 copies / μL. Seven gradient concentrations are set for sensitivity verification, which are 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL, which correspond to the detection limits. The qPCR reaction system of the microfluidic chip and the qPCR amplification reaction running parameters are the same as those in "1.6 Specificity test".

[0146] 1.8 Accuracy verification

[0147] The accuracy experiment is carried out simultaneously with the sensitivity test, that is, the plasmid with the lowest stable detection limit is detected 5 times repeatedly to evaluate the accuracy and stability of the detection system.

[0148] 1.9 Actual sample inspection

[0149] Soybeans intercepted at the port carrying Diaporthe phaseolorum var. caulivora and soybeans artificially inoculated with Curtobacterium flaccumfaciens pv. flaccumfaciens were selected as materials. The nucleic acids were extracted from them respectively using the silicon-based membrane column method, and then detected by the microfluidic chip method. Among them, the DNA kit used for nucleic acid extraction by the silicon-based membrane column method was the QIAGEN DNeasy Plant Pro Kit, and the RNA kit was the TIANGEN RNAprep pure Plant Kit. The specific extraction process referred to the instruction manual. The qPCR reaction system and qPCR amplification reaction operation parameters of the microfluidic chip were the same as those in "1.6 Specificity Test".

[0150] 2 Results

[0151] 2.1 Specificity Test Results

[0152] The specific detection results of 11 quarantine pathogens of raw grains in this experiment are as Figures 3 to 13 shown Figures 3 to 13 follows: the specific detection results of Diaporthe phaseolorum var. caulivora, Cadophora gregata, Fusarium virguliforme, Curtobacterium flaccumfaciens pv. flaccumfaciens, Tilletia indica, Tilletia walkeri, Wheat streak mosaic virus (WSMV), Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. nebraskensis, Maize chlorotic mottle virus (MCMV), and Clavibacter michiganensis subsp. michiganensis

[0153] Figure 3The results showed that the Cq values of the two replicates of the DNA of Diaporthe phaseolorum var. meridionalis 2012SC01 were 28.407 and 28.080 respectively; the Cq values of the two replicates of the DNA of 2013SA01 were 27.122 and 27.036; the Cq values of the two replicates of the DNA of 2013SC02 were 22.920 and 22.039; no detection was found in the negative control n (Diaporthe phaseolorum var. meridionalis, Diaporthe helianthi, Cadophora gregata, Phytophthora sojae, Fusarium virguliforme, Fusarium tucumaniae) and the blank control CK.

[0154] Figure 4 The results showed that the Cq values of the two replicates of the DNA of Phialophora gregata 2014SU84 were 21.250 and 21.383 respectively; the Cq values of the two replicates of the DNA of 2014SU85 were 28.378 and 28.435; the Cq values of the two replicates of the DNA of 2015SU85 were 20.758 and 20.744; no detection was found in the negative control n (Fusarium virguliforme, Fusarium tucumaniae, Diaporthe phaseolorum var. caulivora, Diaporthe phaseolorum var. meridionalis, Phytophthora sojae) and the blank control CK.

[0155] Figure 5 The results showed that the Cq values of the two replicates of the DNA of Fusarium virguliforme 22490 were 25.890 and 25.422 respectively; the Cq values of the two replicates of the DNA of 22825 were 17.004 and 17.407; the Cq values of the two replicates of the DNA of ARG1.1 were 18.258 and 18.543; no detection was found in the negative control n (Fusarium graminearum, Fusarium brasiliense, Fusarium tucumaniae, Diaporthe phaseolorum var. caulivora, Diaporthe phaseolorum var. meridionalis, Cadophora gregata, Phytophthora sojae) and the blank control CK.

[0156] Figure 6The results showed that the Cq values of the two replicates of the DNA of Curtobacterium flaccumfaciens pv. phaseoli NCPPB1446 were 26.794 and 26.037 respectively; the Cq values of the two replicates of the 470359 DNA were 22.656 and 22.767; the Cq values of the two replicates of the 470358 DNA were 25.134 and 25.638; no detection was found in the negative control n (Curtobacterium flaccumfaciens.pv.oortii, Curtobacterium flaccumfaciens pv.betae, Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. nebraskensis, Clavibacter michiganensis subsp. michiganensis) and the blank control CK.

[0157] Figure 7 The results showed that the Cq values of the two replicates of the 5114 DNA of Tilletia indica were 26.737 and 26.294 respectively; the Cq values of the two replicates of the TIM2 - 180926 DNA were 27.974 and 27.731 respectively; the Cq values of the two replicates of the TIM1 - 180919 DNA were 28.980 and 29.108 respectively; no detection was found in the negative control n (Tilletia walkeri, Tilletia controversa, Tilletia fusca, Tilletia foetida, Tilletia laevis) and the blank control CK.

[0158] Figure 8 The results showed that the Cq values of the two replicates of the DNA of Tilletia walkeri CBS121956 were 23.146 and 23.082 respectively; the Cq values of the two replicates of the CBS121955 DNA were 31.951 and 30.853 respectively; the Cq values of the two replicates of the T39 DNA were 29.379 and 29.409 respectively; no detection was found in the negative control n (Tilletia indica, Tilletia controversa, Tilletia fusca, Tilletia foetida, Tilletia laevis) and the blank control CK.

[0159] Figure 9The results showed that the Cq values of the two replicates of Wheat streak mosaic virus WSMV C2725 RNA were 31.866 and 32.666 respectively; the Cq values of the two replicates of WSMV JC RNA were 27.145 and 26.691 respectively; the Cq values of the two replicates of WSMV 1RNA were 30.764 and 30.438 respectively; no detection was found in the negative control n (BPMV, SBMV, MCMV, ArMV, ToRSV, BYMV) and the blank control CK.

[0160] Figure 10 The results showed that the Cq values of the two replicates of Pantoea stewartii subsp. stewartii 470524 DNA were 20.314 and 19.933 respectively; the Cq values of the two replicates of 470522 DNA were 25.785 and 25.243 respectively; the Cq values of the two replicates of 470523 DNA were 24.166 and 24.173 respectively; no detection was found in the negative control n (Pantoea.dispersa, Clavibacter michiganensissubsp.nebraskensis, Curtobacterium flaccumfaciens pv.oortii, Curtobacteriumflaccumfaciens pv.betae) and the blank control CK.

[0161] Figure 11 The results showed that the Cq values of the two replicates of Clavibacter michiganensis subsp. michiganensis 470321 DNA were 21.162 and 20.765 respectively; the Cq values of the two replicates of 470324 DNA were 24.365 and 24.808 respectively; the Cq values of the two replicates of 470322 DNA were 21.605 and 21.519 respectively; no detection was found in the negative control n (Clavibacter michiganensis subsp.michiganensis, Clavibacter michiganensis subsp.tessellarius, Clavibacter michiganensissubsp.sepedonicus, Pantoea stewartii subsp.stewartii) and the blank control CK.

[0162] Figure 12The results showed that the Cq values of the two replicates of maize chlorotic mottle virus MCMV C2453 RNA were 10.493 and 10.472 respectively; the Cq values of the two replicates of MCMV JC1 RNA were 11.172 and 10.997 respectively; the Cq values of the two replicates of MCMV+RNA were 33.682 and 26.235 respectively; no detection was found in the negative control n (BPMV, SBMV, WSMV, ArMV, ToRSV, BYMV) and the blank control CK.

[0163] Figure 13 The results showed that the Cq values of the two replicates of Clavibacter michiganensis subsp. michiganensis 470302 DNA were 21.763 and 21.866 respectively; the Cq values of the two replicates of 470303 DNA were 22.855 and 22.936 respectively; the Cq values of the two replicates of 470307 DNA were 27.311 and 27.290 respectively; no detection was found in the negative control n (Clavibacter michiganensis subsp. nebraskensis, Clavibacter michiganensis subsp. tessellarius, Clavibacter michiganensis subsp. sepedonicus, Pantoea stewartii subsp. stewartii) and the blank control CK.

[0164] The above results showed that the specific primers and probes designed in this experiment were specifically amplified only for the detection targets, but not for other similar pathogens, indicating that the microfluidic chip in this experiment had good specificity.

[0165] 2.2 Results of sensitivity test

[0166] The results of sensitivity detection are as Figures 14 to 24 shown, Figures 14 to 24 The numbers in it correspond to the powers of 10 copies. Figures 14 to 24The sensitivity test results are in sequence for Diaporthe phaseolorum var. caulivora, Cadophora gregata, Fusarium virguliforme, Curtobacterium flaccumfaciens pv. flaccumfaciens, Tilletia indica, Tilletia walkeri, Wheat streak mosaic virus (WSMV), Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. nebraskensis, Maize chlorotic mottle virus (MCMV), Leptosphaeria maculans, and Clavibacter michiganensis subsp. michiganensis.

[0167] Figure 14 The sensitivity test results of Diaporthe phaseolorum var. caulivora showed that the Cq values of the plasmid at 10 5 copies / μL were 18.473 and 18.481 respectively; the Cq values of the plasmid at 10 4 copies / μL were 22.554 and 22.375 respectively; the Cq values of the plasmid at 10 3 copies / μL were 25.901 and 25.410 respectively; the Cq values of the plasmid at 10 2 copies / μL were 28.213 and 28.973 respectively; the Cq values of the plasmid at 10 1 copies / μL were 31.995 and 31.860 respectively; the Cq values of the plasmid at 10 0 copies / μL were 35.699 and the other was not detected; the Cq values of the plasmid at 10 -1 copies / μL were not detected. The minimum stable detection limit test was carried out on the plasmid at 10 1 copies / μL, with 5 replicates in total, and the Cq values were 32.947, 32.231, 32.843, 31.965, and 32.804 respectively. In summary, the detection sensitivity for Diaporthe phaseolorum var. caulivora can reach 10 copies / μL.

[0168] Figure 15 The sensitivity test results of Cadophora gregata showed that at 10 5The Cq values of the plasmid at 10 copies / μL were 17.461 and 17.255 respectively; 4 The Cq values of the plasmid at 10 copies / μL were 20.669 and 20.863 respectively; 3 The Cq values of the plasmid at 10 copies / μL were 24.072 and 23.979 respectively; 2 The Cq values of the plasmid at 10 copies / μL were 27.156 and 27.196 respectively; 1 The Cq values of the plasmid at 10 copies / μL were 31.112 and 30.928 respectively; 0 The Cq values of the plasmid at 10 copies / μL were 34.347 and 34.436 respectively; -1 The Cq values of the plasmid at 10 copies / μL were not detected. For the plasmid at 10 0 copies / μL, the lowest stable detection limit test was carried out, with 5 replicates in total. The Cq values were 33.055, 33.363, 32.414, 32.801, and 32.891 respectively. In summary, the detection sensitivity for Phialophora gregata can reach 1 copy / μL.

[0169] Figure 16 The sensitivity detection results of Fusarium virguliforme, the causative agent of sudden death syndrome in North American soybeans, showed that for 10 5 copies / μL of the plasmid, the Cq values were 20.908 and 20.549 respectively; 4 For 10 copies / μL of the plasmid, the Cq values were 24.407 and 24.643 respectively; 3 For 10 copies / μL of the plasmid, the Cq values were 27.514 and 27.141 respectively; 2 For 10 copies / μL of the plasmid, the Cq values were 30.272 and 30.834 respectively; 1 For 10 copies / μL of the plasmid, the Cq values were 33.633 and 35.496 respectively; 0 For 10 copies / μL of the plasmid, the Cq values were 35.896 and not detected respectively; -1 The Cq values of the plasmid at 10 copies / μL were not detected. For the plasmid at 10 1 copies / μL, the lowest stable detection limit test was carried out, with 5 replicates in total. The Cq values were 33.688, 33.799, 33.219, 33.102, and 33.728 respectively. In summary, the detection sensitivity for Fusarium virguliforme can reach 10 copies / μL.

[0170] Figure 17 The sensitivity detection results of Curtobacterium flaccumfaciens pv. flaccumfaciens, the causative agent of bacterial wilt in common beans, showed that for 10 5 copies / μL of the plasmid, the Cq values were 24.557 and 24.315 respectively;4 The Cq values of the plasmid at 10 copies / μL were 27.899 and 28.198 respectively; 3 The Cq values of the plasmid at 10 copies / μL were 31.453 and 30.986 respectively; 2 The Cq values of the plasmid at 10 copies / μL were 34.235 and 32.379 respectively; 1 The Cq values of the plasmid at 10 copies / μL were not detected; 0 The Cq values of the plasmid at 10 copies / μL were not detected; -1 The Cq values of the plasmid at 10 copies / μL were not detected. The lowest stable detection limit test was carried out on the plasmid at 10 copies / μL, with 5 replicates in total. The Cq values were 32.581, 31.746, 32.323, 33.983, and 32.536 respectively. For 2 Xanthomonas axonopodis pv. phaseoli, digital PCR quantification was performed on the positive plasmid at 10 copies / μL, and it was found that the actual concentration was only 6.34 copies / μL, and the positive plasmid was degraded. Therefore, the lowest stable detection limit of the microfluidic chip was 0.634 copies / μL. In summary, the detection sensitivity for Xanthomonas axonopodis pv. phaseoli could reach 1 copy / μL. 3

[0171] Figure 18 The sensitivity detection results of Tilletia indica Mitra showed that 5 the Cq values of the plasmid at 10 copies / μL were 20.063 and 19.667 respectively; 4 the Cq values of the plasmid at 10 copies / μL were 22.793 and 22.311 respectively; 3 the Cq values of the plasmid at 10 copies / μL were 25.057 and 25.238 respectively; 2 the Cq values of the plasmid at 10 copies / μL were 28.118 and 28.375 respectively; 1 the Cq values of the plasmid at 10 copies / μL were 32.718 and 32.066 respectively; 0 the Cq values of the plasmid at 10 copies / μL were not detected and 32.414 respectively; -1 the Cq values of the plasmid at 10 copies / μL were not detected. The lowest stable detection limit test was carried out on the plasmid at 10 copies / μL, with 5 replicates in total. The Cq values were 32.183, 31.548, 31.576, 31.022, and 32.007 respectively. In summary, the detection sensitivity for Tilletia indica Mitra could reach 10 copies / μL. 1

[0172] Figure 19 The sensitivity detection results of Tilletia walkeri showed that 5 the Cq values of the plasmid at 10 copies / μL were 20.299 and 19.765 respectively; 4 ​​The Cq values ​​of the plasmid copies / μL were 22.887 and 22.997; 10 3 The Cq values ​​of the plasmids with copies / μL were 26.321 and 25.816; 10 2 The Cq values ​​of the plasmid copies / μL were 29.048 and 29.196; 10 1 The Cq values ​​of the plasmids with copies / μL were 33.526 and 32.132 respectively; 10 0 Copies / μL plasmid Cq value not detected; 10 -1 The Cq value of the plasmid copies / μL was not detected. 1 The minimum stable detection limit test of 10 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 32.803, 31.887, 31.514, 31.974, and 32.415, respectively. In summary, the detection sensitivity of T. perenne can reach 10 copies / μL.

[0173] Figure 20 The sensitivity test results of wheat streak mosaic virus showed that 10 5 The Cq values ​​of the plasmids with copies / μL were 21.071 and 20.716; 10 4 The Cq values ​​of the plasmids with copies / μL were 23.591 and 23.623; 10 3 The Cq values ​​of the plasmids with copies / μL were 26.596 and 27.010; 10 2 The Cq values ​​of the plasmids with copies / μL were 29.929 and 30.232; 10 1 The Cq values ​​of the plasmids with copies / μL were 35.606 and 31.974; 10 0 The Cq values ​​of the copies / μL plasmid were 35.632, and the other one was not detected; 10 -1 The Cq value of the plasmid copies / μL was not detected. 1 The minimum stable detection limit test of 10 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 31.666, 32.589, 31.860, 32.730, and 32.461 respectively. In summary, the detection sensitivity of wheat streak mosaic virus can reach 10 copies / μL.

[0174] Figure 21 The sensitivity test results of corn bacterial wilt pathogens showed that 10 5 The Cq values ​​of the plasmids with copies / μL were 20.073 and 19.787; 10 4 The Cq values ​​of the plasmids with copies / μL were 22.851 and 23.216; 10 3 The Cq values ​​of the plasmids with copies / μL were 25.837 and 26.009; 10 2 The Cq values ​​of the plasmids with copies / μL were 29.155 and 29.318; 101 The Cq values of the plasmid at 10 copies / μL were 31.961 and 33.803 respectively; 0 The Cq values of the plasmid at 10 copies / μL were 34.587 and one was not detected; -1 The Cq value of the plasmid at 10 copies / μL was not detected. For the plasmid at 10 1 copies / μL, the lowest stable detection limit test was carried out, with 5 replicates in total. The Cq values were 32.759, 32.003, 31.717, 32.371, and 33.041 respectively. In summary, the detection sensitivity for Pantoea stewartii subsp. stewartii can reach 10 copies / μL.

[0175] Figure 22 The results of the sensitivity detection for Corynebacterium nebraskense showed that for the plasmid at 10 5 copies / μL, the Cq values were 19.361 and 18.283 respectively; 4 The Cq values of the plasmid at 10 copies / μL were 22.037 and 22.311 respectively; 3 The Cq values of the plasmid at 10 copies / μL were 25.270 and 25.342 respectively; 2 The Cq values of the plasmid at 10 copies / μL were 28.077 and 28.520 respectively; 1 The Cq values of the plasmid at 10 copies / μL were 32.942 and 34.788 respectively; 0 The Cq values of the plasmid at 10 copies / μL were 34.801 and one was not detected; -1 The Cq value of the plasmid at 10 copies / μL was not detected. For the plasmid at 10 1 copies / μL, the lowest stable detection limit test was carried out, with 5 replicates in total. The Cq values were 33.083, 31.868, 32.785, 32.555, and 31.795 respectively. In summary, the detection sensitivity for Corynebacterium nebraskense can reach 10 copies / μL.

[0176] Figure 23 The results of the sensitivity detection for Maize chlorotic mottle virus showed that for the plasmid at 10 5 copies / μL, the Cq values were 20.008 and 20.172 respectively; 4 The Cq values of the plasmid at 10 copies / μL were 23.285 and 23.050 respectively; 3 The Cq values of the plasmid at 10 copies / μL were 26.385 and 26.429 respectively; 2 The Cq values of the plasmid at 10 copies / μL were 29.472 and 29.583 respectively; 1 The Cq values of the plasmid at 10 copies / μL were 32.773 and 34.717 respectively; 0 The Cq values of the plasmid at 10 copies / μL were 35.294 and one was not detected; -1The Cq value of the plasmid at 10 copies / μL was not detected. For the plasmid at 10 1 copies / μL, the lowest stable detection limit test was carried out, with 5 replicates in total. The Cq values were 32.794, 33.215, 31.262, 32.682, and 32.481 respectively. In summary, the detection sensitivity for maize chlorotic mottle virus can reach 10 copies / μL.

[0177] Figure 24 The results of the sensitivity detection of Clavibacter michiganensis subsp. michiganensis showed that for the plasmid at 10 5 copies / μL, the Cq values were 19.430 and 19.282 respectively; for the plasmid at 10 4 copies / μL, the Cq values were 22.259 and 22.628 respectively; for the plasmid at 10 3 copies / μL, the Cq values were 25.323 and 25.575 respectively; for the plasmid at 10 2 copies / μL, the Cq values were 28.581 and 29.398 respectively; for the plasmid at 10 1 copies / μL, the Cq values were 32.487 and 32.473 respectively; for the plasmid at 10 0 copies / μL, the Cq value was not detected; for the plasmid at 10 -1 copies / μL, the Cq value was not detected. For the plasmid at 10 1 copies / μL, the lowest stable detection limit test was carried out, with 5 replicates in total. The Cq values were 32.119, 31.659, 30.769, 32.185, and 32.016 respectively. In summary, the detection sensitivity for Clavibacter michiganensis subsp. michiganensis can reach 10 copies / μL.

[0178] The above results showed that among the 11 pathogens, 2 reached 1 copy / μL, namely Phialophora gregata and Curtobacterium flaccumfaciens pv. flaccumfaciens; 9 reached 10 copies / μL, namely Diaporthe phaseolorum var. caulivora, Fusarium virguliforme, Tilletia indica, Tilletia walkeri, Wheat streak mosaic virus, Pantoea stewartii subsp. stewartii, Stenocarpella maydis, Maize chlorotic mottle virus, and Clavibacter michiganensis subsp. michiganensis.

[0179] 2.3 Primer and probe alignment

[0180] The results of the specific detection using the primers and probe of Diaporthe phaseolorum var. caulivora: DC2F, DC2R, and DC2Pb are as Figure 29 shown, and the results of the sensitivity test are as Figure 30 shown. Figure 29 The results showed that the existing primers and probe of Diaporthe phaseolorum var. caulivora also had amplification signals for the negative control n, indicating that the specificity of the existing primers and probe was weak. Figure 30 The results showed that the detection limit of the existing primers and probe was about 10 2copies / μL, which is 10 lower than the lowest stable detection limit of the new primer probe designed in this example. 1 The copies / μL were one order of magnitude lower.

[0181] The existing standard method for North American soybean sudden death syndrome pathogen is the dual PCR method, and there is no qPCR detection method. In this case, the qPCR primer probe designed for it has a primer hairpin structure and a dimer structure energy level of less than 4.5. The experimental results show that the specificity is good and the sensitivity can reach 10 copies / μL.

[0182] For the existing qPCR detection method for wheat Indian bunt, the newly designed front and rear primers and probes in this example have good specificity, and the newly designed primers are less likely to form hairpin structures than the original primers; the experimental results show that the new primer probes have higher amplification efficiency and better specificity than the original primer probes.

[0183] The results of specificity test using the existing wheat Indian smut primers and probes: wheat Indian smut F, wheat Indian smut R, wheat Indian smut P are as follows Figure 31 The sensitivity test results are shown in Figure 32 shown. Figure 31 The results showed that the amplification signal of the existing primers and probes for the same positive sample was weaker than the amplification signal of the newly designed primers and probes in this example. Figure 32 The results showed that the detection limit of the existing primer probe was about 10 2 copies / μL, which is 10 lower than the lowest stable detection limit of the new primer probe designed in this example. 1 The copies / μL were also an order of magnitude lower.

[0184] In summary, the primers and probes that were redesigned to meet the usage requirements of the microfluidic chip in this example have better specificity and sensitivity, so that the microfluidic chip in this example can achieve high-throughput detection of 11 kinds of quarantine pathogens in raw grains of 8 samples with high specificity and high sensitivity in one detection chip, thereby improving the quality and efficiency of inspection and quarantine work.

[0185] 2.4 Accuracy test

[0186] The results showed that all target pathogen positive controls were amplified normally, among which 18s was the internal reference well of the chip, which was used to confirm whether the chip was working normally.

[0187] 2.5 Actual sample test results

[0188] The actual sample test results are as follows Figures 25 to 28 As shown, Figure 25 The results of testing soybeans for the pathogenic bacteria of soybean northern stem canker are shown in Figure 1. Figure 26Detection results of soybeans carrying Curtobacterium flaccumfaciens pv. flaccumfaciens Figure 27 Detection results of Diaporthe phaseolorum var. caulivora in mixed soybean samples Figure 28 Detection results of Curtobacterium flaccumfaciens pv. flaccumfaciens in mixed soybean samples

[0189] Figure 25 The results show that the Cq values of the positive control of Diaporthe phaseolorum var. caulivora in two replicates are 19.109 and 18.996 respectively; the Cq values of Diaporthe phaseolorum var. caulivora DNA in two replicates are 24.360 and 24.170 respectively; the negative control n (Diaporthe phaseolorum var. meridionalis, negative soybean samples) is not detected; the blank control CK is not detected.

[0190] Figure 26 The results show that the Cq values of the positive control of Curtobacterium flaccumfaciens pv. flaccumfaciens in two replicates are 18.312 and 18.165 respectively; the Cq values of Curtobacterium flaccumfaciens pv. flaccumfaciens DNA in two replicates are 25.866 and 25.742 respectively; the negative control n (Curtobacterium flaccumfaciens pv. oortii, negative soybean samples) is not detected; the blank control CK is not detected.

[0191] Figure 27 The results show that the Cq values of soybean sample DNA 1 in two replicates are 16.466 and 16.396 respectively; the Cq values of DNA2 in two replicates are 26.370 and 25.549 respectively; the Cq values of DNA3 in two replicates are 19.388 and 19.123 respectively; the Cq values of the positive control of Diaporthe phaseolorum var. caulivora in two replicates are 28.615 and 28.516 respectively; the negative control n (Diaporthe phaseolorum var. meridionalis, negative soybean samples) is not detected; the blank control CK is not detected.

[0192] Figure 28 The results show that the Cq values of soybean sample DNA1 in two replicates are 10.108 and 10.601 respectively; the Cq values of DNA2 in two replicates are 20.227 and 19.733 respectively; the Cq values of DNA3 in two replicates are 11.919 and 11.390 respectively; the Cq values of the positive control of Curtobacterium flaccumfaciens pv. flaccumfaciens in two replicates are 20.192 and 21.192 respectively; the negative control n (Curtobacterium flaccumfaciens pv. oortii, negative soybean samples) is not detected; the blank control CK is not detected.

[0193] The results indicate that the microfluidic chip can achieve the detection of samples carrying Diaporthe phaseolorum var. caulivora and Curtobacterium flaccumfaciens pv. flaccumfaciens, without false positives or false negatives.

[0194] The above content is a further detailed description of the present application in combination with specific embodiments, and it cannot be determined that the specific implementation of the present application is only limited to these descriptions. For those of ordinary skill in the technical field to which the present application belongs, without departing from the concept of the present application, several simple deductions or substitutions can also be made.

Claims

1. A microfluidic chip for detecting quarantine pathogens in raw grains, characterized in that: Each microfluidic chip includes at least 8 detection channels, and each detection channel includes at least 48 reaction zones, and the 48 reaction zones are used for detecting 11 quarantine pathogens of raw grains; The 11 quarantine pathogens of raw grains include *Diaporthe phaseolorum* var. *sojae*, *Phialophora gregata*, *Fusarium virguliforme*, *Curtobacterium flaccumfaciens* pv. *flaccumfaciens*, *Tilletia indica*, *Tilletia walkeri*, *Wheat streak mosaic virus*, *Pantoea stewartii* subsp. *stewartii*, *Clavibacter michiganensis* subsp. *nebraskensis*, *Maize chlorotic mottle virus*, *Clavibacter michiganensis* subsp. *michiganensis*; The reaction zone for detecting *Diaporthe phaseolorum* var. *sojae* contains the specific detection primers and probes for *Diaporthe phaseolorum* var. *sojae*, the reaction zone for detecting *Phialophora gregata* contains the specific detection primers and probes for *Phialophora gregata*, the reaction zone for detecting *Fusarium virguliforme* contains the specific detection primers and probes for *Fusarium virguliforme*, the reaction zone for detecting *Curtobacterium flaccumfaciens* pv. *flaccumfaciens* contains the specific detection primers and probes for *Curtobacterium flaccumfaciens* pv. *flaccumfaciens*, the reaction zone for detecting *Tilletia indica* contains the specific detection primers and probes for *Tilletia indica*, the reaction zone for detecting *Tilletia walkeri* contains the specific detection primers and probes for *Tilletia walkeri*, the reaction zone for detecting *Wheat streak mosaic virus* contains the specific detection primers and probes for *Wheat streak mosaic virus*, the reaction zone for detecting *Pantoea stewartii* subsp. *stewartii* contains the specific detection primers and probes for *Pantoea stewartii* subsp. *stewartii*, the reaction zone for detecting *Clavibacter michiganensis* subsp. *nebraskensis* contains the specific detection primers and probes for *Clavibacter michiganensis* subsp. *nebraskensis*, the reaction zone for detecting *Maize chlorotic mottle virus* contains the specific detection primers and probes for *Maize chlorotic mottle virus*, and the reaction zone for detecting *Clavibacter michiganensis* subsp. *michiganensis* contains the specific detection primers and probes for *Clavibacter michiganensis* subsp. *michiganensis*; The upstream and downstream primers of the specific detection primers and probes for *Diaporthe phaseolorum* var. *sojae* are the sequences shown in Seq ID No.1 and 2 in sequence, and the probe is the sequence shown in Seq ID No.3; The upstream and downstream primers of the specific detection primers and probes for *Phialophora gregata* are the sequences shown in Seq ID No.4 and 5 in sequence, and the probe is the sequence shown in Seq ID No.6; The upstream and downstream primers of the specific detection primers and probes for *Fusarium virguliforme* are the sequences shown in Seq IDNo.7 and 8 in sequence, and the probe is the sequence shown in Seq ID No.9; The upstream and downstream primers of the specific detection primers and probes for *Curtobacterium flaccumfaciens* pv. *flaccumfaciens* are the sequences shown in Seq ID No.10 and 11 in sequence, and the probe is the sequence shown in Seq ID No.12; The upstream and downstream primers of the specific detection primers and probes for *Tilletia indica* are the sequences shown in Seq ID No.13 and 14 in sequence, and the probe is the sequence shown in Seq ID No.15; The upstream and downstream primers of the specific detection primers and probes for *Tilletia walkeri* are the sequences shown in Seq ID No.16 and 17 in sequence, and the probe is the sequence shown in Seq ID No.18; The upstream and downstream primers of the specific detection primers and probes for wheat streak mosaic virus are the sequences shown in Seq ID No. 19 and 20 in sequence, and the probe is the sequence shown in Seq ID No. 21; The upstream and downstream primers of the specific detection primers and probes for Xanthomonas campestris pv. vasculorum are the sequences shown in Seq ID No. 22 and 23 in sequence, and the probe is the sequence shown in Seq ID No. 24; The upstream and downstream primers of the specific detection primers and probes for Corynebacterium nebraskense are the sequences shown in Seq ID No. 25 and 26 in sequence, and the probe is the sequence shown in Seq ID No. 27; The upstream and downstream primers of the specific detection primers and probes for maize chlorotic mottle virus are the sequences shown in Seq ID No. 28 and 29 in sequence, and the probe is the sequence shown in Seq ID No. 30; The upstream and downstream primers of the specific detection primers and probes for Clavibacter michiganensis subsp. michiganensis are the sequences shown in Seq ID No. 31 and 32 in sequence, and the probe is the sequence shown in Seq ID No.

33.

2. The microfluidic chip according to claim 1, wherein: The specific detection primers and probes corresponding to quarantine pathogens in raw grains are pre-embedded in the corresponding detection reaction zones.

3. The microfluidic chip according to claim 1, wherein: The volume of each reaction zone is 1 μL.

4. Use of the microfluidic chip according to any one of claims 1-3 in the preparation of a kit for detecting quarantine pathogens in raw grains.

5. A kit for detecting quarantine pathogens of raw grains, characterized in that: Containing the microfluidic chip according to any one of claims 1-3.

6. The kit according to claim 5, wherein: It also contains positive and / or negative controls for 11 quarantine pathogens in raw grains.

7. The kit according to claim 6, wherein: The positive control is a plasmid containing a detection fragment of a quarantine pathogen in raw grains.

8. The kit according to any one of claims 5-7, characterized in that: It also contains a TaqMan probe-based real-time fluorescence quantitative PCR detection reagent.

Images