Inflammation-targeted self-assembled nanoparticles, and methods of making and using the same
Through the cross-linking reaction of HA-VP@NPs nanoparticles, highly efficient targeted delivery and anti-inflammatory effects were achieved at the site of inflammation, solving the problem of the lack of effective treatment for acute lung injury and acute respiratory distress syndrome in existing technologies. It significantly reduced the expression of inflammatory factors and reduced the toxic side effects on normal tissues.
Patent Information
- Application Number
- CN202411221022.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-02
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2044-09-02
AI Technical Summary
There is a lack of effective inflammation-targeting self-assembled nanoparticles for the treatment of acute lung injury and acute respiratory distress syndrome, and traditional treatment methods have the problems of increasing the risk of lung injury or poor treatment effect.
HA-VP@NPs nanoparticles were constructed by cross-linking hyaluronic acid (HA) and verteporfin (VP) in vitro with NHS/EDC. By utilizing the targeting properties of HA and the anti-inflammatory effects of VP, highly efficient targeted delivery and inhibition of inflammation can be achieved at the site of inflammation.
It improves the delivery efficiency of VP at the site of inflammation, reduces toxic side effects on normal tissues, significantly inhibits the expression of inflammatory factors, and improves lung inflammation, making it suitable for the treatment of acute lung injury and acute respiratory distress syndrome.
Smart Images

Figure CN119097721B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a hyaluronic acid (HA) and verteporfin (VP) coupled nanoparticle, a preparation method and application thereof. BACKGROUND
[0002] Acute lung injury (ALI) is an acute interstitial lung disease and pulmonary edema caused by various infections, trauma, etc., and is a clinical syndrome with very complex etiology, which can even aggravate acute respiratory distress syndrome (ARDS). In terms of pathological characteristics, ALI / ARDS patients will have lung inflammation and increased microvascular permeability, and then develop pulmonary edema, form a transparent membrane, and interstitial fibrosis. The lung compliance, intrapulmonary shunt, and ventilation-perfusion ratio are affected by the pathological changes of ALI / ARDS, and the body eventually develops refractory hypoxemia and respiratory distress. So far, the clinical treatment method for ALI / ARDS still remains at the level of supportive treatment. Mechanical ventilation treatment methods can increase the risk of ventilator-induced lung injury (VILI) and aggravate lung injury. Extracorporeal membrane oxygenation (ECMO) can achieve the effect of making the lung "rest", but the treatment effect on ARDS is poor. Therefore, it is very important to develop new drugs or new strategies to cope with ALI and block its development to more serious diseases.
[0003] Bio-macromolecules can be self-assembled into nano-drug delivery systems in vitro by chemical methods. NHS (N-hydroxysuccinimide) is a common coupling agent that often reacts with amine compounds. EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) can be used as a coupling agent for the reaction of carboxyl and amine or phenol. NHS / EDC crosslinking reaction is carried out in MES (morpholine ethanesulfonic acid) buffer with pH of 5.5. EDC first reacts with carboxyl to form an active O-acyl urea intermediate, which is easily replaced by the nucleophilic attack of the primary amino group in the reaction mixture. The primary amine forms an amide bond with the original carboxyl group, and the byproduct produced is finally released in the form of a soluble urea derivative. The O-acyl isourea intermediate is unstable in aqueous solution and cannot react with amine, which leads to the hydrolysis of the intermediate, the regeneration of the carboxyl group, and the release of n-unsubstituted urea.
[0004] HA has unique physicochemical and physiological properties, which makes it widely used in facial treatment and biomedical field. The inflammation site is usually accompanied by high expression of CD44 receptor on the surface of activated macrophages. HA can reach the inflammation site by targeted delivery through binding with CD44 receptor. VP is a Yes-associated protein (YAP) inhibitor. Related studies have shown that Hippo signal transcription factor YAP maintains the stability of NLRP3 by blocking the binding between NLRP3 and E3 ubiquitin ligase β-TrCP1, thereby promoting the activation of NLRP3 inflammasome and promoting the occurrence of inflammation.
[0005] However, there is no report on HA-based inflammation-targeting self-assembled nanoparticles and related technologies for the treatment of ALI. SUMMARY
[0006] To solve the above technical problems, the present application provides an inflammation-targeting self-assembled nanoparticle and its preparation method and application. The present application uses HA as a targeting ligand, and utilizes the NHS / EDC cross-linking reaction between the carboxyl group of HA and the amine group of VP to successfully construct an inflammation-targeting nanoparticle HA-VP@NPs. The nanoparticle inherits the advantages of HA and CD44 targeted binding, and can exert the inhibitory effect of VP on inflammation. It can effectively target VP nanoparticles to the inflammation site in the inflammatory environment, improve the efficiency of VP delivery to the inflammation site, improve the targeting of inflammation, and reduce the toxic side effects of VP on normal tissues due to weak targeting. The nanoparticle in the present application has good treatment effect on lung inflammation, and is also suitable for the treatment of acute lung injury or acute respiratory distress syndrome and other related inflammation.
[0007] To achieve the above purpose, the present application adopts the following technical solutions:
[0008] The present application provides an inflammation-targeting self-assembled nanoparticle, which uses hyaluronic acid (HA) as a targeting ligand, and is constructed by NHS / EDC cross-linking reaction between the carboxyl group of HA and the amine group of verteporfin (VP) in vitro. The relative molecular mass of the HA is 3-15 kDa, and the molar ratio of the HA to the VP is 0.5:1-4:1.
[0009] The nanoparticle provided in the present application has a particle size of 200-300 nm.
[0010] The HA in the present application is a hydrophilic biological macromolecule.
[0011] Further, the relative molecular mass of the HA is 3-5 kDa.
[0012] Further, the relative molecular mass of the HA is 3 kDa.
[0013] The VP in the present application has a M.W of 1437.5884 and is hydrophobic.
[0014] Further, the molar ratio of the HA to the VP is 0.5:1-2:1.
[0015] Further, the molar ratio of the HA to the VP is 1:1.
[0016] In the present application, since the VP is hydrophobic and the HA has good water solubility, the HA-VP amphiphilic complex can self-assemble into a VP core and a HA surface hydrophilic layer in an aqueous solution.
[0017] The present application also provides a preparation method of the self-assembled nanoparticles, comprising the following steps:
[0018] (1) activating the HA with EDC and NHS;
[0019] (2) adding the VP into the reaction system in (1);
[0020] (3) purifying the nanoparticles obtained in (2) by dialysis to obtain the self-assembled nanoparticles HA-VP@NPs.
[0021] Further, the step (1) comprises the following steps:
[0022] (I) preparing a MES buffer solution with a concentration of 4-6 mg / mL and a pH of 5.0-6.0;
[0023] (II) weighing the HA, EDC and NHS respectively and adding them into the buffer solution, wherein the molar ratio of the HA, EDC and NHS is (0.8-1.2):(9-11):(9-11), and stirring at room temperature in the dark for 1.5-2.5 h.
[0024] Further, the concentration of the MES buffer solution is 5 mg / mL, the pH is 5.5, the molar ratio of the HA, EDC and NHS is 1:10:10, and the stirring is performed at room temperature in the dark for 2 h.
[0025] Further, the molar ratio of the VP to the HA in the step (2) is 0.5:1-2:1.
[0026] Further, the molar ratio of the VP to the HA is 1:1.
[0027] Further, in the step (3), the dialysis bag has a molecular weight cut-off of 3000-4000, the dialysis liquid is ultrapure water, the dialysis liquid is replaced for 6-8 times, dialysis is performed for 1.5-2.5 h after the last replacement, and then freeze-drying is performed to obtain the HA-VP@NPs.
[0028] Further, the dialysis bag traps M.W 3500, the dialysate is replaced 7 times, and the replacement time points are: 2h, 4h, 6h, 8h, 12h, 24h, 26h, and the dialysis is performed for 2h after the last replacement of the dialysate.
[0029] The application further provides application of the self-assembled nanoparticles or the preparation method in preparation of drugs for preventing and treating inflammation-related diseases.
[0030] Further, the inflammation-related disease is a lung inflammation-related disease.
[0031] Further, the inflammation-related disease is acute lung injury and / or acute respiratory distress syndrome.
[0032] Compared with the prior art, the application has the following technical effects:
[0033] The application successfully constructs an inflammation-targeted nanoparticle HA-VP@NPs by taking HA as a targeting ligand and utilizing the NHS / EDC cross-linking reaction between the carboxyl group of HA and the amine group of VP in vitro. The nanoparticle inherits the advantages of the targeted combination of HA and CD44, and can play the inhibitory role of VP on inflammation, can effectively target the VP nanoparticles to the inflammation site in the inflammation environment, improve the efficiency of VP delivery to the inflammation site, improve the targeting of inflammation, and reduce the toxic side effects of VP on normal tissues due to weak targeting while effectively reducing inflammation. The nanoparticle in the application has good treatment effect on lung inflammation, and is also suitable for the treatment of related inflammation such as acute lung injury or acute respiratory distress syndrome. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1 It is a schematic diagram of the overall experimental process of the application;
[0035] Figure 2 It is a particle size, PDI and binding rate analysis diagram of HA-VP@NPs synthesized in Example 1 of the application, wherein: Figure 2 A is a particle size diagram of n(HA):n(VP)=0.5:1; Figure 2 B is a particle size diagram of n(HA):n(VP)=1:1; Figure 2 C is a particle size diagram of n(HA):n(VP)=2:1; Figure 2 D is a particle size diagram of n(HA):n(VP)=3:1;
[0036] Figure 2 E is a particle size diagram of n(HA):n(VP)=4:1; Figure 2 F is a binding rate analysis diagram of HA-VP@NPs related to the ratio of n(HA):n(VP).
[0037] Figure 3 Figure A is a particle size analysis chart of HA-VP@NPs synthesized by HA with different M.W and VP; Figure 3 A is a particle size chart of HA-VP@NPs synthesized when M.W(HA) = 3kDa; Figure 3 B is a particle size chart of HA-VP@NPs synthesized when M.W(HA) = 5kDa; Figure 3 C is a particle size chart of HA-VP@NPs synthesized when M.W(HA) = 10kDa; Figure 3 D is a particle size chart of HA-VP@NPs synthesized when M.W(HA) = 3kDa; Figure 3 E is a binding rate analysis chart of HA-VP@NPs synthesized by HA with different M.W and VP;
[0038] Figure 4 Figure A is an analysis chart of the inhibitory effect of HA-VP@NPs synthesized by HA with different M.W and VP on NLRP3 protein;
[0039] Figure 5 Figure A is an analysis chart of the inhibitory effect of HA-VP@NPs synthesized by HA with different M.W and VP on IL-6, TNF-α and IL-1β;
[0040] Figure 6 Figure A is an identification chart of HA-VP@NPs synthesized when n(HA): n(VP) = 1:1 in Example 3 of the present application, wherein: Figure 6 A is a change line chart of particle size and PDI of nanoparticle HA-VP@NPs within 72h; Figure 6 B is a potential chart thereof; Figure 6 C is an electron microscope chart; Figure 6 D is a Fourier transform infrared spectrogram;
[0041] Figure 7 Figure A is a cell uptake chart of HA-VP@NPs in Example 4 of the present application, wherein: Figure 7 A is the expression of CD44 receptor on the surface of M1 macrophages, M0 macrophages, MLE-12 cells and L929 cells; Figure 7 B is a flow detection fluorescence intensity chart of M1 macrophages, M0 macrophages, MLE-12 cells and L929 cells respectively incubated with HA-VP@NPs under the same conditions; Figure 7 C is a confocal analysis chart of M1 macrophages, MLE-12 cells and L929 cells uptaking HA-VP@NPs;
[0042] Figure 8Figure for anti-inflammatory effect of HA-VP@NPs in vitro in Example 5 of the present application, wherein: Figure 8 A is a graph of the inhibitory effect of HA-VP@NPs on IL-6, TNF-α and IL-1β of macrophages at different concentrations; Figure 8 B is a graph of the expression effect of IL-6, TNF-α and IL-1β of macrophages under different groups of administration;
[0043] Figure 9 Figure for in vivo biodistribution of nanoparticles HA-VP@NPs in Example 6 of the present application, wherein: Figure 9 A is a small animal live imaging figure; Figure 9 B is a small animal live imaging figure of main organs;
[0044] Figure 10 Figure for the inhibitory effect of HA-VP@NPs on IL-6, TNF-α and IL-1β in vivo in Example 7 of the present application;
[0045] Figure 11 Figure for hematoxylin-eosin (H&E) staining of lung tissue sections in Example 7 of the present application. DETAILED DESCRIPTION
[0046] The following examples are used to illustrate the present application, but are not used to limit the scope of the present application. Modifications or replacements of the methods, steps or conditions of the present application, without departing from the spirit and essence of the present application, all belong to the scope of the present application. The reagents and instruments used in the following examples can be obtained from the market, and the methods used in the examples are consistent with the commonly used methods, unless otherwise specified.
[0047] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as understood by those skilled in the art to which the present application belongs. The terms used in the specification of the present application are only for the purpose of describing the specific embodiments and are not used to limit the present application.
[0048] Before the technical solutions of the present application are described, the terms used in the present application are defined as follows:
[0049] The term "HA-VP@NPs" refers to: nanoparticles of hyaluronic acid crosslinked with verteporfin.
[0050] The term "M.W" refers to: relative molecular mass.
[0051] The overall experimental process of the present application is shown in Figure 1
[0052] The technical solutions of the present application are further described in detail below in combination with examples.
[0053] Example 1
[0054] The embodiment provides a preparation method of self-assembled nanoparticles, which is constructed by using a hyaluronic acid (HA) as a targeting ligand and a NHS / EDC cross-linking reaction between a carboxyl group of the HA and an amine group of verteporfin (VP) in vitro, wherein the HA (Xi'an Haoran Biotechnology Co., Ltd., R-HF-010-3k) is a hydrophilic biological macromolecule with a M.W of 3000, and the VP (Mai Rui, M71080) has a M.W of 1437.5884 and is hydrophobic. The specific steps are as follows:
[0055] (1) HA is activated with EDC (Macklin, N808856) and NHS (Macklin, N811124);
[0056] (I) a MES (Macklin, M813439-100g) buffer solution with a concentration of 5 mg / mL and a pH of 5.5 is prepared;
[0057] (II) HA, EDC and NHS are weighed and put into the buffer solution, wherein the molar ratio of HA, EDC and NHS is 1:10:10, and stirring is carried out at room temperature for 2 hours in the dark;
[0058] (2) VP is put into the reaction system in (1);
[0059] (3) a dialysis bag with a M.W of 3500 is used, ultrapure water is used as a dialysis liquid, the time points for replacing the dialysis liquid are 2h, 4h, 6h, 8h, 12h, 24h and 26h, after the dialysis liquid is replaced for the last time, dialysis is carried out for 2h, and then freeze-drying is carried out, so that the powder obtained is HA-VP@NPs.
[0060] In order to screen the optimal combination ratio of HA and VP, different proportions of HA are put into the reaction with VP to prepare nanoparticles.
[0061] Experimental method: the molar ratios of HA and VP are 0.5:1, 1:1, 1.5:1, 2:1, 3:1 and 4:1 respectively, after the nanoparticles are prepared, the particle sizes of the nanoparticles prepared under different feeding ratios are determined by a Malvern particle size analyzer, and then the combination rate of HA and VP is determined by using a CTAB turbidity method.
[0062] Results: refer to Figure 2 A-E, the particle sizes of the nanoparticles HA-VP@NPs prepared under different feeding ratios are all less than 300nm, and Figure 2 F shows that when n(HA):n(VP) is 1:1, the combination rate of HA-VP@NPs is the highest (about 89%), so the HA-VP@NPs synthesized under the ratio are selected for subsequent research.
[0063] Embodiment 2
[0064] This example is used to further verify the anti-inflammatory effect of nanoparticles synthesized by HA of different M.W and VP in vivo.
[0065] Experimental method:
[0066] 1. Synthesis and characterization of nanoparticles
[0067] Select HA with M.W of 3kDA, 5kDa, 10kDa and 15kDa, respectively, and participate in EDC / NHS reaction according to n(HA):n(VP)=1:1 (other methods are the same as example 1), and obtain nanoparticles after dialysis purification, and then measure the particle size of the nanoparticles by Malvern particle size analyzer, and then determine the binding rate by CTAB turbidity method.
[0068] Results: Refer to Figure 3 A-D, when the M.W of HA is 3kDA (Xi'an Haoran Biotechnology Co., Ltd., R-HF-010-3k), 5kDa (Xi'an Haoran Biotechnology Co., Ltd., R-Y065-5K), 10kDa (Xi'an Haoran Biotechnology Co., Ltd., R-Y065-10k), and 15kDa (Xi'an Haoran Biotechnology Co., Ltd., R-Y065-15k), the particle size and PDI are 230.1nm and 0.397, 274.9nm and 0.306, 336.5nm and 0.294, and 360.0nm and 0.322, respectively. Figure 3 E, the binding rate of HA-VP@NPs of each M.W is ≥70%.
[0069] 2. In vivo anti-inflammatory evaluation of nanoparticles
[0070] Inoculate macrophages with a cell density of 25×10 4 After LPS induction, different concentrations of HA-VP were added to each well, and the cells were incubated in the dark for 24h. The cells were collected and lysed with RIPA buffer, and the protein expression was determined on the microplate reader. All samples were diluted with SDS-PAGE loading buffer and boiled in boiling water for 5min. Prepare 10% SDS-PAGE gel, and after electrophoresis, transfer the separation gel to PVDF membrane, block at room temperature for 1.5h with skimmed milk, wash the membrane with TBST, then incubate with 1:1000 primary antibody at 4°C for 12h, wash the membrane, incubate the corresponding secondary antibody with PVDF membrane, and finally perform imaging processing by enhanced chemiluminescence (ECL) reagent and Amersham 600 imager.
[0071] Results: Refer to Figure 4 Each M.W of HA-VP@NPs has obvious inhibitory effect on the expression of NLRP3 protein.
[0072] 3. Real-time quantitative PCR analysis to determine inflammatory factors
[0073] RNA in macrophages was extracted using universal RNA extraction kit II. Reverse transcription was performed using Evo M-MLV reverse transcription reagent premix. SYBR Green Pro Taq HS premix qPCR kit IV dot plate was used to detect Ct values in each well on a real-time fluorescent quantitative PCR instrument using a LightCycler 480 II system. The relative expression of RNA was calculated using the △△Ct method. The primer sequences are shown in Table 1 below.
[0074] Table 1 Primer sequences
[0075]
[0076] IL-6 TTCCATCCAGTTGCCTTCTTG (SEQ ID NO. 3) TTGGGAGTGGTATCCTCTGTGA (SEQ ID NO. 4)
[0077] IL-1β CTTCAGGCAGGCAGTATCACTCAT (SEQ ID NO. 5) TCTAATGGGAACGTCACACACCAG (SEQ ID NO. 6)
[0078] TNF - α CCCTCACACTCAGATCATCTTCT (SEQ ID NO. 7) GCTACGACGTGGGCTACAG (SEQ ID NO. 8) Figure 5 Figure 6 Figure 6 Figure 6
[0079] Results: Reference Figure 6 The PBS group is the LPS-treated group, and the expression levels of cell proinflammatory factors are significantly up-regulated after LPS treatment. Different kDA HA-VP@NPs have obvious inhibitory effects on the expression of IL-6 and TNF-α and IL-β, and the inhibitory effect of HA-VP@NPs synthesized by 3kDA HA is the best. Therefore, 3kDA HA-VP@NPs synthesized by 3kDA HA and VP are selected for subsequent research.
[0080] Example 3
[0081] The group of nanoparticles with the highest binding rate was selected for characterization, i.e. the nanoparticles synthesized when the ratio n(HA):n(VP) was 1:1. The characterization content included: determination of its potential by Malvern particle size instrument, change of particle size and PDI within 72h, observation of its morphology by transmission electron microscope, determination of its infrared spectrum by FTIR Fourier infrared instrument, and determination of its H spectrum by NMR superconducting nuclear magnetic resonance.
[0082] Experimental method:
[0083] The HA:VP:EDC:NHS ratio was 1:1:10:10, and the nanoparticles HA-VP@NPs were synthesized by reaction. After dialysis purification, the HA-VP@NPs were uniformly dispersed in ultrapure water, and the zeta potential was measured using a Malvern particle size analyzer. The PDI and particle size changes within 72h were observed.
[0084] 10μL of HA-VP@NPs nanoparticle sample was added to the electron microscope copper mesh, and after standing for 10min, the excess liquid was absorbed along the edge of the copper mesh using a water-absorbing paper. The copper mesh was placed at room temperature overnight to dry. According to the transmission electron microscope operation procedure, the electron microscope photos of the samples were taken to obtain the morphological characteristics of each sample nanoparticle.
[0085] The HA-VP@NPs sample was dissolved in deuterated DMSO and tested in an infrared transmission cell.
[0086] Results: Figure 7 A, the particle size and PDI of HA-VP@NPs were measured within 72h, and the stability was good. Figure 7 B, the zeta potential decreased from ~-3mV to ~-30mV, and the stability was improved. The morphology of the nanoparticles was observed under a transmission electron microscope (TEM), Figure 8 C, which showed that it was spherical. Referring to Figure 8 D, in the EDC / NHS reaction, the amine group of VP and the carboxyl group of HA formed a new tertiary amide structure, and the wave number was 1644cm -1 .
[0087] Example 4
[0088] This example is used to identify the cell uptake of nanoparticles HA-VP@NPs.
[0089] Experimental method:
[0090] M0 type macrophages, M1 type macrophages, MLE-12 cells, and L929 cells were inoculated in 6-well plates, and the cells were grown to 80% adherence. The cells were trypsinized and centrifuged at 3000rpm for 5min. After discarding the supernatant, the cells were blown evenly with 1ml PBS, and centrifuged at 3000rpm for 5min. CD44 antibody was added, and incubated in the dark for 30min. The CD44 expression on the surface of each cell membrane was observed under ImageStreamX imaging flow cytometry (Amnis, USA).
[0091] 1×10 5M1 macrophages, MLE-12 cells, L929 cells were seeded in 35 nm confocal dishes, when the cells grew to 80%, 4 ug / mL of drug was added, and incubated for 12 hours in the dark. Then, the cell imaging was observed by LSM880 laser confocal microscope (Carl Zeiss, Germany). In the same way, macrophages were seeded in six-well plates, and incubated at the same drug concentration. After 12 hours, the uptake of HA-VP@NPs by macrophages was observed under ImageStreamX imaging flow cytometry.
[0092] Results: Referring to result 7A, it can be seen that the expression of CD44 protein on the surface of M1 macrophages is higher than that of MLE-12 cells and L929 cells. Figure 9 B shows that the expression of CD44 on the surface of M1 macrophages is the most, followed by MLE-12 cells, and L929 cells express the least CD44. Figure 9 C shows that M1 macrophages have the best uptake ability for HA-VP@NPs, followed by MLE-12 cells, and L929 cells have the lowest drug uptake ability.
[0093] Example 5
[0094] This example is used to identify the anti-inflammatory effect of nanoparticle HA-VP@NPs in vitro. The expression levels of inflammatory factors such as IL-6, IL-1β, and TNF-α are determined by real-time fluorescence quantitative PCR analysis.
[0095] Experimental method: The operation method of real-time fluorescence quantitative PCR analysis for determining inflammatory factors in Example 2 is used to determine the expression of pro-inflammatory factors such as IL-6, TNF-α, and IL-β.
[0096] Results: Referring to Figure 10 A, after LPS treatment, the level of cell pro-inflammatory factors is significantly up-regulated. HA-VP@NPs have obvious inhibitory effect on the expression of IL-6, TNF-α, and IL-β, and the gene expression level of inflammatory factors decreases in a dose-dependent manner. Figure 11 B shows that VP also has inhibitory effect on the mRNA expression of IL-6, TNF-α, and IL-β. The inhibitory effect of HA-VP@NPs is slightly stronger than that of VP. These results all show that HA-VP@NPs can effectively reduce the expression of pro-inflammatory factors, thereby reducing the occurrence of inflammation.
[0097] Example 6
[0098] This example is used to analyze the in vivo animal targeting effect of nanoparticle HA-VP@NPs.
[0099] Experimental method: The experimental samples were divided into saline group, HA group, VP group, and HA-VP@NPs group. Small animal live imaging instrument was used to detect the specific distribution of the samples in mice.
[0100] After LPS infusion for 4 h, the mice were randomly divided into 4 groups, 3 in each group. The mice without LPS treatment were used as negative control, and the LPS-treated mice were injected with saline via tail vein as positive control. The other three groups were injected with equal amount of HA, VP, and HA-VP@NPs via tail vein, respectively. The imaging was detected by IVIS Lumina XRMS series III (XRMS, USA) at time points of 1, 4, 8, 12, 24, and 48 h. After the detection, the mice in each group were dissected, and their main organs (heart, liver, spleen, lung, and kidney) were imaged and detected for in vitro fluorescence intensity using the same method. The fluorescence analysis was performed using live Image V4.5.5 software.
[0101] Results: A. In normal mice, HA-VP@NPs mainly accumulated in the liver, while in LPS-infected pneumonia mouse models, VP mainly accumulated in the liver of mice. In addition, due to the production of lung inflammation, the surface of macrophages highly expressed CD44, and HA-VP@NPs also accumulated in the inflammatory site of the lung. After 24 h, the fluorescence in mice rapidly decreased. B. The ex vivo fluorescence results of main organs such as heart, liver, spleen, lung, and kidney showed that VP in pneumonia mice and HA-VP@NPs in normal mice mainly accumulated in the liver, while HA-VP@NPs in pneumonia mice mainly accumulated in the lung. These results indicated that HA-VP@NPs had inflammatory targeting in vivo.
[0102] Example 7
[0103] This example was used to analyze the anti-inflammatory effect of nanoparticles HA-VP@NPs in vivo.
[0104] Experimental method:
[0105] 1. Real-time fluorescence quantitative PCR analysis for determination of inflammatory factors
[0106] BALB / c mice were randomly divided into 5 groups: Normol group, saline group, HA group, VP group, HA-VP@NPs group, except for the Normol group, the rest of the mice were induced by intratracheal instillation of 5mg / kg of lipopolysaccharide (LPS) (Sigma-Aldrich, USA) to induce acute lung injury (ALI) and pneumonia in mice. Each group of mice was treated by tail vein injection of equal amounts of different drugs (saline, HA, VP, HA-VP@NPs). After treatment, the lung tissue of each mouse was collected, and the mRNA level of cytokines in the lung tissue was detected by real-time fluorescent quantitative PCR.
[0107] Results: Refer to It can be seen that HA-VP@NPs has a strong inhibitory effect on the expression of pro-inflammatory factors IL-6, TNF-α and IL-1β, and these results show that HA-VP@NPs can reduce the level of inflammation in mice.
[0108] 2, hematoxylin-eosin (H&E) staining
[0109] After treatment, the lung tissue of each group of mice was taken. The mouse tissue was fixed in 4% paraformaldehyde, paraffin-embedded, and the lung tissue sections were stained with hematoxylin-eosin (H&E).
[0110] Results: Refer to The results of lung tissue H&E sections show that the lung tissue of ALI mice has obvious damage, the treatment effect of HA is not obvious, VP and HA-VP@NPs can significantly improve the lung injury of mice, and the latter is more obvious.
[0111] The above-described embodiments are only to describe the preferred modes of the present application, and not to limit the scope of the present application, without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art, should fall within the protection scope determined by the claims of the present application.
Claims
1. An inflammation-targeting self-assembling nanoparticle, characterized in that, It is constructed by using hyaluronic acid (HA) as a targeting ligand and NHS / EDC cross-linking reaction between the carboxyl group of HA and the amine group of verteporfin (VP) in vitro; the relative molecular mass of the HA is 3 kDa, and the molar ratio of HA to VP is 1:1; The inflammation is acute lung injury.
2. The method of claim 1, wherein the self-assembled nanoparticles are prepared by the method comprising the steps of: The method comprises the following steps: (1) activating HA with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS); (2) adding VP into the reaction system in (1); (3) dialyzing and purifying the nanoparticles obtained in (2) to obtain the self-assembled nanoparticles HA-VP@NPs.
3. The production method according to claim 2, characterized by, The step (1) comprises the following steps: (I) preparing a MES buffer solution with a concentration of 4-6 mg / mL and a pH of 5.0-6.0; (II) weighing HA, EDC and NHS respectively and adding them into the buffer solution, wherein the molar ratio of HA, EDC and NHS is (0.8-1.2):(9-11):(9-11), and stirring at room temperature in the dark for 1.5-2.5 h.
4. The production method according to claim 2, characterized by, In the step (2), the molar ratio of VP to HA is 0.5:1-2:
1.
5. The preparation method according to claim 2, characterized in that, In the step (3), the dialysis bag has a molecular weight cut-off of 3000-4000, ultrapure water is used as the dialysate, the dialysate is replaced for 6-8 times, dialysis is performed for 1.5-2.5 h after the last replacement, and then freeze-drying is performed to obtain the powder, which is the HA-VP@NPs.
6. The self-assembled nanoparticles of claim 1 are used in the preparation of a drug for preventing and treating inflammation-related diseases.
7. Use according to claim 6, characterized in that, The inflammation-related disease is a lung inflammation-related disease.
8. Use according to claim 6, characterized in that, The inflammation-related disease is acute lung injury and / or acute respiratory distress syndrome.