A glycine betaine transporter mutant and its application

Abstract

The invention belongs to the field of bioengineering technology, and discloses a glycine betaine transporter mutant and its application, wherein the mutant is a mutant in which the 472nd alanine in the wild-type glycine betaine transporter is mutated into valine, and then the mutation is introduced into an L-lysine-producing strain by a homologous recombination method to obtain a mutant strain with improved L-lysine production capacity; and the mutant strain is used for industrial production. The mutant obtained by the present invention can significantly improve the yield and conversion rate of L-lysine when applied, is genetically stable, and has broad application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a glycine betaine transporter mutant and application thereof. Background Art

[0002] L-lysine is one of the essential amino acids that humans and animals cannot synthesize by themselves. Since L-lysine has multiple physiological functions, such as balancing amino acid composition, regulating metabolic balance in the body, improving the body's absorption and utilization of cereal protein, and promoting the body's growth and development, it is widely used in the feed industry, pharmaceutical industry, and food industry, among which more than 90% of lysine products are used as feed additives.

[0003] At present, there are three main methods for industrial production of L-lysine: protein hydrolysis, chemical synthesis and microbial fermentation. Among them, microbial fermentation has the advantages of low production cost, high production intensity, high specificity and low environmental pollution, making it the most widely used method for industrial production of L-lysine. The strains used for industrial production of L-lysine at home and abroad are mostly modified strains of Corynebacterium glutamicum and Escherichia coli. The main methods for selecting L-lysine strains are: (1) site-directed mutagenesis of key enzyme encoding genes in the lysine metabolic pathway to relieve feedback inhibition; (2) changing cell membrane permeability and regulating intracellular metabolite accumulation; (3) increasing the supply of precursor substances in the synthesis pathway and inhibiting branch metabolic pathways; (4) cutting off or changing the by-product synthesis pathway to reduce by-product accumulation; (5) increasing the supply of cofactor NADPH to meet the reducing power requirements of L-lysine synthesis. A large number of studies have shown that the yield of products can be greatly increased by selecting strains through genetic engineering technology, which is still an important direction for strain selection. Summary of the invention

[0004] The first technical problem to be solved by the present invention is to provide a glycine betaine transporter mutant, and to perform point mutation on the glycine betaine transporter gene (betP gene) of wild-type Corynebacterium glutamicum to obtain the glycine betaine transporter mutant.

[0005] The second technical problem to be solved by the present invention is to provide a method for constructing a strain containing a glycine betaine transporter mutant, and transform the glycine betaine transporter mutant into a lysine producing strain.

[0006] The third technical problem to be solved by the present invention is to provide an application of a strain containing a mutant of a glycine betaine transporter protein, and to produce lysine by using the above-mentioned production strain, thereby significantly improving the lysine yield.

[0007] In order to solve the above technical problems, the technical solution of the present invention is:

[0008] A glycine betaine transporter mutant is obtained by making a point mutation in the betP gene (cg1016 glycine betaine transporter, https: / / www.ncbi.nlm.nih.gov / gene / 3342778) in the genome of Corynebacterium glutamicum ATCC13032 published by NCBI, the amino acid sequence of which is shown in SEQ ID NO.1 (betP-WT595) and the nucleotide sequence of which is shown in SEQ ID NO.2 (betP-WT 1788bp), wherein the point mutation is to mutate the alanine at position 472 in the amino acid sequence to valine. The amino acid sequence after the mutation is shown in SEQ ID NO.3 (betP-A472V 595) and the nucleotide sequence is shown in SEQ ID NO.4 (betP-C1415T 1788bp).

[0009] A method for constructing a mutant strain containing a glycine betaine transporter comprises the following steps:

[0010] a. Search for the wild-type betP gene (cg1016 glycine betaine transporter) based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI; the specific website of the genome sequence is: https: / / www.ncbi.nlm.nih.gov / gene / 3342778;

[0011] Design primers based on gene sequence:

[0012] P1: CGCGGATCCTTCTATTGGCAACTACCTGTC (BamH I),

[0013] P2: GGTGCCCATGACGGTGGAAACAGAGTCAGCAGAGG,

[0014] P3: CCTCTGCTGACTCTGTTTCCACCGTCATGGGCACC,

[0015] P4: ACGCGTCGACACTCGCCTACGCTCCCT (Sal I);

[0016] b. Using the ATCC13032 genome as a template, PCR amplification was performed with primers P1 and P2, P3 and P4, respectively, to obtain DNA fragments of 439 bp (see SEQ ID NO.5) and 378 bp (see SEQ ID NO.6), respectively. The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified fragments were used as templates to amplify with primers P1 and P4 to obtain a fragment of 782 bp (see SEQ ID NO.7), and the two ends of the fragment contained BamH I and Sal I restriction sites, respectively; after the PCR reaction was completed, the amplified product was subjected to agarose gel electrophoresis, and the desired DNA fragment was purified using a column DNA gel recovery kit, and the fragment was double-digested (BamH I and Sal I) and then recovered, and connected with the shuttle plasmid pk18mobsacB after the same double-digestion (BamH I and Sal I) to obtain a plasmid pK18-m-betP, which contains a kanamycin resistance marker;

[0017] c. The obtained plasmid pK18-m-betP was electrotransformed into the lysine-producing bacteria (Corynebacterium glutamicum) strain M7 (deposit number: CGMCC No.8184, deposit time: September 13, 2013, deposit center: General Microbiology Center of China Microorganism Culture Collection Administration Committee), cultured on LBG solid medium, and the single colonies produced by the culture were identified by primers P1 and M13F. The strains that can amplify the size band of 817bp (see SEQ ID NO.8) are positive strains; the positive strains were cultured on LBS solid medium, and the single colonies produced by the culture were inoculated on LBG solid medium containing 50ug / ml kanamycin and LBG solid medium without kanamycin, respectively. The strains that did not grow on the LBG solid medium containing kanamycin were screened and identified using primers P5 and P6:

[0018] P5: ATGACTACATCTGACCCAAATCC,

[0019] P6: CTATCGACGCTTCCCCGCGC;

[0020] The 1788 bp fragment (see SEQ ID NO.4) amplified by PCR was sequenced, and through sequence comparison, it was found that the 1415th position of the nucleotide sequence was mutated from the wild-type C to T, proving that the homologous recombination of the strain was successful, and the strain was named M7-betP.

[0021] The invention discloses an application of a strain containing a mutant of a glycine betaine transporter, wherein the constructed strain M7-betP is used for fermentation production of L-lysine.

[0022] Due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0023] The invention mutates the alanine at position 472 in the wild-type glycine betaine transporter into valine, and then introduces the mutation into an L-lysine-producing strain by a homologous recombination method, thereby obtaining a mutant strain with improved L-lysine production capacity, significantly improved yield and conversion rate, stable strain expression, and can be used for the fermentation production of lysine in Corynebacterium glutamicum. DETAILED DESCRIPTION

[0024] The present invention will be further described below in conjunction with the embodiments.

[0025] Primer synthesis and sequencing services in all examples were provided by BGI Genomics Services Co., Ltd. PCR instrument (eppendorf), amino acid analyzer (sykam S433D);

[0026] The following medium formulation was used:

[0027] LB solid medium: Tryptone 10 g / L, Yeast Extract 5 g / L, NaCl 10 g / L, Agar 20 g / L, pH 7.0;

[0028] LB liquid medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0;

[0029] LBG liquid medium: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, glucose 5g / L, pH 7.0;

[0030] LBG solid medium: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, glucose 5g / L, agar 20g / L, pH 7.0;

[0031] LBS solid culture medium: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, sucrose 100g / L, agar 20g / L, pH 7.0.

[0032] Example 1 Construction of a strain containing a glycine betaine transporter mutant

[0033] a. According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, search for the wild-type betP gene (cg1016 glycine betaine transporter); design primers based on the wild-type betP gene sequence:

[0034] P1: CGCGGATCCTTCTATTGGCAACTACCTGTC (BamH I),

[0035] P2: GGTGCCCATGACGGTGGAAACAGAGTCAGCAGAGG,

[0036] P3: CCTCTGCTGACTCTGTTTCCACCGTCATGGGCACC,

[0037] P4: ACGCGTCGACACTCGCCTACGCTCCCT (Sal I);

[0038] b. Using the ATCC13032 genome as a template, PCR amplification was performed with primers P1 and P2, P3 and P4, respectively, to obtain DNA fragments of 439 bp (see SEQ ID NO. 5) and 378 bp (see SEQ ID NO. 6), respectively. The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified fragments were used as templates to amplify with primers P1 and P4 to obtain a fragment of 782 bp (see SEQ ID NO. 7), and the two ends of the fragment contained BamH I and Sal I restriction sites, respectively; after the PCR reaction was completed, the amplified product was subjected to agarose gel electrophoresis, and the desired DNA fragment was purified using a column DNA gel recovery kit, and the fragment was double-digested (BamH I and Sal I) and then recovered, and then compared with the same double-digested (BamH I and Sal I) fragment. I) The shuttle plasmid pk18mobsacB plasmid was connected using Takara's DNA ligation kit. In principle, the molar ratio of the vector DNA and the inserted target DNA fragment was 0.03pmol:0.2pmol; the connection temperature was 16°C and the reaction time was 4 hours; according to the heat shock transformation method, the connection product was transformed into Escherichia coli DH5α competent cells (purchased from TAKARA); after the transformed Escherichia coli was cultured at 37°C for 1 hour, it was spread on an LB solid plate containing kanamycin with a final concentration of 50ug / ml; after culturing at 37°C in an incubator for 24 hours, it was inoculated into LB liquid culture medium containing kanamycin with a final concentration of 50ug / ml, and cultured at 37°C for 24 hours. The recombinant plasmid was extracted using OMEGA's plasmid extraction kit to obtain the plasmid pK18-m-betP, which contains a kanamycin resistance marker;

[0039] The conditions for PCR amplification are:

[0040] Pre-denaturation: 95℃, 5min; Denaturation: 98℃, 10s; Annealing: 60℃, 15s; Extension: 72℃, 1min; 35 cycles; Post-extension: 72℃, 10min;

[0041] c. The obtained plasmid pK18-m-betP was electrotransformed into the lysine-producing bacteria (Corynebacterium glutamicum) strain M7 (deposit number: CGMCC No.8184, deposit time: September 13, 2013, deposit center: General Microbiological Center of China Microbiological Culture Collection Administration), and the conditions for electrotransformation were: capacitance 25μF, resistance 200Ω, voltage 2.5KV, 0.2cm electrotransformation cup, final DNA concentration 0.1μg / ml;

[0042] The transformed strain was spread on LBG solid medium containing kanamycin at a final concentration of 50ug / ml, and cultured at 30°C for 28 hours. The single colonies produced by the culture were identified by primers P1 and M13F. The strains that could amplify the size band of 817bp (see SEQ ID NO.8) were positive strains; the positive strains were cultured on LBS solid medium, and the single colonies produced by the culture were inoculated on LBG solid medium containing 50ug / ml kanamycin and LBG solid medium without kanamycin, respectively, and cultured at 30°C for 28 hours. Five strains that did not grow on LBG solid medium containing kanamycin were selected, all of which were preserved and identified by PCR using primers P5 and P6:

[0043] P5: ATGACTACATCTGACCCAAATCC,

[0044] P6: CTATCGACGCTTCCCCGCGC;

[0045] The conditions for PCR amplification were as follows: pre-denaturation: 95°C, 5 min; denaturation: 98°C, 10 s; annealing: 58°C, 15 s; extension: 72°C, 2 min; 35 cycles; post-extension: 72°C, 10 min;

[0046] The above five strains all amplified a fragment of 1788 bp (see SEQ ID NO.4). The fragment amplified from one of the strains was sequenced. Through sequence comparison, it was found that the 1415th position of the nucleotide sequence was mutated from the wild type C to T, proving that the homologous recombination of the strain was successful, and it was named M7-betP.

[0047] Example 2 Application of the mutant strain M7-betP containing glycine betaine transporter

[0048] The constructed strain M7-betP was fermented in small tanks for 3 times;

[0049] First, the M7-betP strain obtained by screening was cultured on LBG solid medium plates, and then the colonies were picked and inoculated into 100 ml of LBG liquid medium for shake flask culture. After culturing at 37°C and 200 rpm for 24 hours, it was inoculated into seed culture medium at a 1% inoculation rate for seed culture; the seed culture medium formula is shown in Table 1:

[0050] Table 1: Seed culture medium recipe

[0051]

[0052] Seed culture conditions: 37°C, pH 6.9, initial speed 200rpm, air volume 0.5vvm, tank pressure 0.05mPa, dissolved oxygen correction 100% before inoculation, when dissolved oxygen drops to 20%, the speed is adjusted to control dissolved oxygen at 20-25% until the end of seed culture; culture for about 24 hours, when OD grows to about 0.4 (OD value at 600nm is measured after the culture solution is diluted 26 times), inoculate into the fermentation medium with an inoculum of 5% for fermentation culture;

[0053] The fermentation medium formula is shown in Table 2:

[0054] Table 2: Fermentation medium formulation

[0055]

[0056] Fermentation culture conditions: 37°C, pH 6.9, initial speed 200rpm, air volume 0.5vvm, tank pressure 0.05mPa, dissolved oxygen correction 100% before inoculation, dissolved oxygen controlled in the range of 10%-20% by adjusting the speed and air volume (the maximum speed during adjustment was 700rpm, the maximum air volume was 2vvm, and the maximum tank pressure was 0.10Mpa), and when the dissolved oxygen began to rise after about 4.5h of culture, sugar was added in a stream, and a glucose solution with a mass concentration of 75% was added to control the reducing sugar concentration at 1-3g / L until the end of fermentation; when the culture was 9h, a 50% ammonium sulfate solution was added in a stream, and ammonia nitrogen was controlled at 0.15-0.25g / L from 0 to 30h of fermentation, and ammonia nitrogen was controlled at 0.1-0.15g / L from 30h to the end of fermentation. Liquid ammonia was used to adjust the pH to 6.9-7.0 throughout the fermentation, and the culture cycle was 48h.

[0057] After the cultivation, the L-lysine content in the fermentation broth supernatant was determined using an amino acid analyzer. Conversion rate (%) = lysine yield * end volume / (initial volume * initial sugar concentration + added sugar volume * added sugar concentration). The L-lysine content in the fermentation broth supernatant of the three fermentations was 10.8%, 10.6% and 10.8% respectively; the conversion rates were 43.3%, 43.1% and 43.4% respectively.

[0058] Comparative Example 1

[0059] The original production strain M7 (the strain without point mutation) was fermented in a small tank for 3 times according to the fermentation conditions of Example 2; after the fermentation, the yield and conversion rate of L-lysine were measured by the same method. The L-lysine content in the supernatant of the fermentation broth of the three fermentations was 9.8%, 9.7% and 9.7% respectively; the conversion rates were measured to be 39.2%, 39.5% and 39.3% respectively.

[0060] Results and Analysis

[0061] The yield and conversion rate results of Example 2 and Comparative Example 1 are shown in Table 3:

[0062] Table 3: Lysine fermentation experimental results

[0063]

[0064] The results are shown in Table 3. After the betP gene in Corynebacterium glutamicum was mutated, the yield and conversion rate of L-lysine were increased by about 10%. It can be seen that the mutant strain significantly improved the production capacity of L-lysine.

[0065] Stability test

[0066] After the strain M7-betP constructed in Example 1 was subcultured 50 times, a fermentation production test was carried out, and the yield and conversion rate of L-lysine did not change significantly, proving that it can be used for industrial production.

[0067] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope limited by the appended claims of the application.

Claims

1. A glycine betaine transporter mutant, characterized in that: The method is obtained by making a point mutation in the betP gene in the genome of Corynebacterium glutamicum ATCC13032 published by NCBI, the amino acid sequence of which is shown in SEQ ID NO.1 and the nucleotide sequence of which is shown in SEQ ID NO.

2. The point mutation is to mutate the 472nd alanine in the amino acid sequence to valine.

2. A method for constructing a strain containing the glycine betaine transporter mutant according to claim 1, characterized in that: The following steps are involved: a. According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, search for the wild-type betP gene; design primers based on the wild-type betP gene sequence: P1: CGCGGATCCTTCTATTGGCAACTACCTGTC, P2: GGTGCCCATGACGGTGGAAACAGAGTCAGCAGAGG, P3: CCTCTGCTGACTCTGTTTCCACCGTCATGGGCACC, P4: ACGCGTCGACACTCGCCTACGCTCCCT; b. Using the ATCC13032 genome as a template, PCR amplification was performed with primers P1 and P2, P3 and P4, respectively, to obtain DNA fragments of 439 bp and 378 bp in size, respectively. The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified fragments were used as templates, and primers P1 and P4 were used to amplify a 782 bp fragment, and both ends of the fragment contained BamH I and Sal I restriction sites, respectively; after the PCR reaction, the amplified product was subjected to agarose gel electrophoresis, and the desired DNA fragment was purified using a column DNA gel recovery kit, and the fragment was recovered after double digestion with BamH I and Sal I, and was connected to the shuttle plasmid pk18mobsacB after double digestion with BamH I and Sal I to obtain a plasmid pK18-m-betP, which contains a kanamycin resistance marker; c. The obtained plasmid pK18-m-betP was electrotransformed into the lysine production Corynebacterium glutamicum strain M7, cultured on LBG solid medium, and the single colonies produced by the culture were identified by primers P1 and M13F. The strains that could amplify the 817bp size band were positive strains; the positive strains were cultured on LBS solid medium, and the single colonies produced by the culture were inoculated on LBG solid medium containing 50ug / ml kanamycin and LBG solid medium without kanamycin, respectively. The strains that did not grow on LBG solid medium containing kanamycin were screened and identified using primers P5 and P6: P5: ATGACTACATCTGACCCAAATCC, P6: CTATCGACGCTTCCCCGCGC; The 1788 bp fragment amplified by PCR was sequenced, and through sequence comparison, it was found that the 1415th position of the nucleotide sequence mutated from C to T, proving that the homologous recombination of the strain was successful, and the strain was named M7-betP.

3. The use of a strain containing a glycine betaine transporter mutant constructed by the method as claimed in claim 2, characterized in that: Application of strain M7-betP containing a glycine betaine transporter mutant in L-lysine production.

Images