Dual-differentiated or multi-differentiated organoid

Abstract

The present invention relates to an in vitro method for producing a double-differentiated or multi-differentiated tissue having at least two tissue types, the double-differentiated or multi-differentiated tissue obtained by such a method; to the use of the tissue and to kits for carrying out the method; the method comprises the steps of developing a first tissue to a differentiation stage of interest, developing a second tissue to a differentiation stage of interest different from the differentiation stage of interest of the first tissue, placing the first and second tissues in proximity sufficient to fuse by growth, thus, the first and second tissues are allowed to grow and fuse with each other, thereby producing a dual-differentiated or multi-differentiated tissue comprising the first and second tissues having different differentiation stages.

Description

[0001] This application is a divisional application of the invention patent application with the application date of April 25, 2018, the priority date of April 25, 2017, the application number 201880027801.3, and the invention name “Dual-differentiated or multi-differentiated organoids”. Technical Field

[0002] The present invention relates to the field of artificial organoid model tissues. Background Art

[0003] Three-dimensional (3D) organoid culture technology allows the development of complex organoid tissues similar to in vivo development (WO2014 / 090993; Lancaster et al., Nature 501, 373–379 (2013); Lancaster & Knoblich, Science 345, 1247125 (2014)). Importantly, brain organoids recapitulate many aspects of embryonic cortical development, including the generation of a variety of cell types corresponding to the identities of different brain parts (Lancaster & Knoblich, Nat Protoc 9, 2329–2340 (2014)). For example, brain organoids can generate dorsal and ventral forebrain progenitors that generate excitatory neurons and inhibitory interneurons, respectively. In addition, brain organoids can be generated from induced pluripotent stem cells (hiPSCs) derived from human patients and used for functional genomic studies of neurological disorders such as microcephaly and autism.

[0004] Maroof et al., Cell Stem Cell 12, 559–572 (2013) and Nicholas et al., Cell Stem Cell 12, 573–586 (2013) describe methods for modeling human neuronal development in mice. The method involves culturing stem cells in vitro on cortical feeder layers and then transplanting the cells into the newly formed neocortex of immunocompromised mice for further development. Liu et al., Nat Protoc 8, 1670–1679 (2013) describe culturing cells into small neurospheres (20 μm-50 μm) and differentiating the cells of the neurospheres into GABA in culture. + Neuron.

[0005] US2016 / 289635 A1 describes a method for producing artificial telencephalon tissue.

[0006] WO 2014 / 033322 A1 relates to a method for generating pancreatic endoderm by differentiating precursor cells.

[0007] WO 2011 / 055855 A1 relates to a method for inducing differentiation in cultured stem cells.

[0008] US2016 / 312181 A1 describes neuronal cell differentiation from stem cells.

[0009] Such existing model systems still cannot simulate any physiological development. For example, the cerebral cortex contains two major neuronal populations: excitatory glutamatergic pyramidal neurons and inhibitory γ-aminobutyric acid (GABA)-producing interneurons. Excitatory cortical neurons are mainly generated by dorsal forebrain ancestors, while inhibitory GABAergic cortical interneurons are generated by ventral forebrain ancestors. In order to integrate into the cortical circuit, interneurons migrate long distances from their ventral origin to their target dorsal cortical area. This long-range tangential migration is controlled by many signal transduction pathways, and mutations in some neurological disease-related genes can disrupt interneuron migration. However, in the absence of a suitable experimental human model system, the relationship between patient-specific mutations and human brain development remains unknown.

[0010] Therefore, there is a need to model additional features of the native brain, especially the human brain, in large in vitro cultures that closely resemble the brain and to model brain development to as late / large a stage as possible. Summary of the invention

[0011] The present invention provides a method for producing a bi-differentiated or multi-differentiated tissue having at least two tissue types, the method comprising the following steps: providing a first tissue that has developed to a differentiation stage of interest; providing a second tissue that has developed to a differentiation stage of interest that is different from the differentiation stage of interest of the first tissue; placing the first and second tissues in sufficient proximity to fuse by growth; allowing the first and second tissues to grow and fuse with each other; thereby producing a bi-differentiated or multi-differentiated tissue comprising the first and second tissues having different differentiation stages.

[0012] Also provided is a method for producing a bi-differentiated or multi-differentiated tissue having at least two tissue types, the method comprising the steps of: developing a first tissue to a differentiation stage of interest; developing a second tissue to a differentiation stage of interest that is different from the differentiation stage of interest of the first tissue; placing the first and second tissues in sufficient proximity to fuse by growth; allowing the first and second tissues to grow and fuse with each other; thereby producing a bi-differentiated or multi-differentiated tissue comprising first and second tissues having different differentiation stages.

[0013] The present invention further provides bi-differentiated or multi-differentiated tissues obtainable in vitro by such methods. In particular, bi-differentiated or multi-differentiated tissues having at least two tissue types at different stages of differentiation are provided, wherein at least one of the tissue types comprises ventral neuronal tissue, and at least another tissue type is substantially non-ventral, but contains migrating cells from the ventral neuronal tissue, accounting for no more than 5% of the cells of the substantially non-ventral tissue, and the bi-differentiated or multi-differentiated tissue has a size of 100 μm to 10 mm in its longest dimension.

[0014] Further provided is a method of testing a candidate compound that affects the development of a bi-differentiated or multi-differentiated tissue, comprising contacting a cell or tissue of the method of the invention with a candidate compound or contacting a tissue of the invention with a candidate compound, and maintaining the contacted tissue in culture, and observing any developmental changes in the tissue compared to the tissue not contacted with the candidate compound.

[0015] Also provided is a kit suitable for providing tissue culture, comprising a ventral differentiation inducer and a dorsal differentiation inducer, preferably a WNT inhibitor and / or a SSH enhancer as the ventral differentiation inducer and preferably a SSH inhibitor as the dorsal differentiation inducer. The kit is useful for the method of the invention and can be used in the method of the invention.

[0016] All embodiments of the present invention are described together in the detailed description below, and all preferred embodiments relate to all embodiments, aspects, methods, tissues, and kits, etc. For example, a kit or its components can be used in the method of the present invention or are suitable for the method of the present invention. Any component used in the method can be in a kit. The tissue of the present invention is the result of the method of the present invention or can be used in the method of the present invention. The preferred and detailed description of the method of the present invention similarly explains the applicability of the present invention and the resulting tissue. Unless otherwise stated, all embodiments can be combined with each other. DETAILED DESCRIPTION

[0017] The present invention provides a method for producing a bi-differentiation or multi-differentiation tissue having at least two tissue types, the method comprising the following steps: providing a first tissue at a differentiation stage of interest or developing the first tissue to a differentiation stage of interest; providing a second tissue at a differentiation stage of interest different from the differentiation stage of interest of the first tissue or developing the second tissue to a differentiation stage of interest different from the differentiation stage of interest of the first tissue; placing the first and second tissues in a proximity sufficient to fuse by growth; allowing the first and second tissues to grow and fuse with each other; thereby producing a bi-differentiation or multi-differentiation tissue comprising the first and second tissues having different differentiation stages. The method is generally performed in vitro or ex vivo, for example in a container such as a vial or dish or other cell culture device. Typically, the first and / or second tissues, especially both (and optionally further tissues) are derived in vitro, i.e., from an in vitro culture. Preferably, the first and / or second tissues, especially both (and optionally further tissues) are derived in vitro from pluripotent stem cells, or in other words, derived from an in vitro culture of pluripotent stem cells. It is particularly preferred that the first and / or second tissue, especially both (and optionally further tissues) are derived from induced pluripotent stem cells (which in turn may for example be derived from cells isolated from a patient), or in other words, from an in vitro culture of induced pluripotent stem cells.

[0018] Artificial tissue culture methods (including 3D culture) are known from WO2014 / 090993, Lancaster et al., Nature 501, 373–379 (2013), Lancaster & Knoblich, Science 345, 1247125–1247125 (2014) and Lancaster & Knoblich, Nat Protoc 9, 2329–2340 (2014) (all incorporated herein by reference). Such existing methods can be used according to the present invention to develop the first and second and any further tissues that form part of the bi-differentiated or multi-differentiated tissue of the present invention. PCT / EP2017 / 050469 (incorporated herein by reference) describes an improved method for creating organoids on a support in a three-dimensional matrix. Such methods can also be used according to the present invention. US2011 / 0143433 also describes culturing stem cells that can develop into tissues, which can be used according to the present invention. Previous organoids have successfully created artificial in vitro neuronal tissues with natural brain-like features and layers.

[0019] In short, many tissues have been developed. Such tissues can be used as the starting point of the present invention, as the first tissue developed in a given differentiation stage of interest, and as the second (and optionally any further) tissue in a given differentiation stage of interest. Of particular interest is nerve or neuronal tissue. Nervous tissue undergoes complex differentiation patterns, and correct human brain modeling has caused difficulties for developmental biology. Although progress has been made (all papers of Lancaster et al. and Lancaster & Knoblich (the same)), it is still impossible to model the complete development of tissues that can evolve into animals or human brains (Brüstle, Nature 501 (2013): 319-320; Chambers et al., Cell Stem Cell (2013) 13: 377-378). Although due to specific beneficial effects and results have been shown for neural tissue, the method and tissue of the present invention preferably relate to these tissues, but due to any kind of tissue may be beneficial, this should not be construed as limiting the contribution of the present invention to specific tissues.

[0020] The cell of first, second and optionally further tissue can develop into specific organ type, or can have begun to differentiate to specific differentiation fate.The cell of tissue can become multidirectional (multipotent) (from previously multipotent or even not quite differentiated), and some cells can even be unipotent or somatic tissue cells.Tissue fate can be towards any tissue.Preferably, target tissue is selected from neuronal tissue, connective tissue, liver tissue, pancreatic tissue, kidney tissue, bone marrow tissue, heart tissue, retinal tissue, intestinal tissue, lung tissue and endothelial tissue.For example, tissue can comprise any stem cell of this type of tissue that has undergone tissue-specific differentiation.Preferably, tissue comprises and is selected from following cell: neuron or neurogenic, adipogenic, myogenic, tenogenic (tenogenic), chondrogenic, osteogenic, ligamentogenic (ligamentogenic), dermatogenic (dermatogenic), liver or endothelial cell.In some cases, combination is also possible, for example, organ cell (for example neuron, myogenic, liver) and will develop into the cell (for example endothelial, adipogenic, ligamentogenic cell) of supporting tissue. In each method, differentiation can be initiated by commonly known tissue-specific growth or differentiation factors, also referred to as differentiation inducers. They are, for example, known in the art, such as disclosed in WO 2009 / 023246A2, WO 2004 / 084950A2 and WO 2003 / 042405 A2. In addition, differentiation or growth factor can be bone morphogenetic protein, cartilage-derived morphogenetic protein, growth differentiation factor, angiogenic factor, platelet-derived growth factor, vascular endothelial growth factor, epidermal growth factor, fibroblast growth factor, hepatocyte growth factor, insulin-like growth factor, nerve growth factor, colony stimulating factor, neurotrophin, growth hormone, interleukin, connective tissue growth factor, parathyroid hormone-related protein (such as disclosed in WO 2004 / 084950 A2). These factors / reagents are commercially available and do not need to be further described. Of course, for any one of the above-mentioned tissue types, such factors / reagents can be included in the test kit of the present invention. Preferably, neurons or neurogenic material are used in the method or provided in the kit, and preferably, neurons or neurogenic cells are present in the tissue of the invention.

[0021] Tissue can comprise the progenitor cell of any tissue (particularly the above-mentioned tissue), for example stem cell. Progenitor cell is preferably selected from the group consisting of omnipotent stem cell, pluripotent stem cell, multipotent stem cell, mesenchymal stem cell, neuronal stem cell, hematopoietic stem cell, pancreatic stem cell, cardiac stem cell, embryonic stem cell, embryonic germ cell, neural stem cell, especially neural crest stem cell, kidney stem cell, liver stem cell, lung stem cell, angioblast and endothelial progenitor cell. The pluripotent cell or progenitor cell used in the method can be derived from dedifferentiated chondroblast, myogenic cell, osteoblast, tenoblast, ligament cell, adipocyte or skin-derived cell.

[0022] Differentiation can be achieved by contacting cells with tissue-specific growth or differentiation factors. Then the cells can develop into the desired tissue. Such tissue-specific growth or differentiation factors can be neurons or neurogenic, myogenic, tendinogenic, chondrogenic or osteogenic differentiation factors, especially preferably neuronal differentiation factors. This will determine the development into various types of cell tissues in the subsequent development. Therefore, cells will be transformed from pluripotent cells into multidirectional cells. Then, other tissue types should not be made or only multipotent states may be restored again. Generally, not all cells are differentiated into selected tissue types. It is usually sufficient that about 30% or more or at least 40% or at least 50%, or at least 60% or at least 70% or at least 80% of the cells begin to differentiate to the selected tissue type, and are transformed to reduce the differentiation potential (%-value is the fraction of the amount of cells) of multidirectional cells with respective tissue fates. Of course, this differentiation fate is only applicable to cells that have not been restored to an undifferentiated or less differentiated state by using artificial growth and dedifferentiation stimulants. Obviously, even somatic cells can be restored to pluripotent cells, which does not mean that differentiation states are defined in this article. Preferably, factors that would revert the cells to pluripotency are not introduced into the cells.

[0023] The first, second and optionally further tissues of the present invention have different development or differentiation stages. Such different differentiation means that the tissue has at least begun to differentiate into different tissue types, including subtypes or other different organ sites or organ structural areas (areas), such as ventral and dorsal development and / or the development of different brain regions and / or the development of left and right cerebral hemispheres.

[0024] Then the first, second and optionally further tissues are placed in proximity and allowed to grow or fuse together. Surprisingly, this leads to striking new observations in the development of the now combined or fused tissues (also referred to as bi-differentiation or multi-differentiation tissues). For example, the development of the forebrain involves long-distance migration of GABAergic interneurons from the ventral to dorsal sites. Although defects in interneuron migration are associated with neuropsychiatric diseases such as epilepsy, autism and schizophrenia, there is still a lack of model systems for studying this process in people. Organoid co-culture "fusion" paradigms have been developed to successfully combine independently patterned organoids into a single tissue. The bi-differentiation or multi-differentiation tissues of the present invention not only obtain the benefits of previous organoid models, but are also most importantly suitable for providing models for cell migration (such as human interneuron migration) between tissue types. In the case of brain organoids, a continuous dorsal-ventral axis has been shown by fusing specific organoids to the dorsal and ventral forebrain. Using fluorescent reporters, directional GABAergic interneuron migration from the ventral to the dorsal forebrain can be monitored. The molecular taxonomy and migration dynamics of these cells are similar to those of cortical interneurons. Time-lapse imaging of human interneuron migration is possible. Inhibition of such migration (e.g., by the CXCR4 antagonist AMD3100) is also observable. The results show that brain organoid fusion culture can model the complex interactions between different brain parts. Combined with reprogramming technology, fusions provide the possibility of using cells from patients with neuropsychiatric diseases to analyze complex neurodevelopmental defects and test potential therapeutic compounds.

[0025] Cell co-culture is known in the art. For example, stem cells are mixed with other cells to provide additional support or developmental factors for stem cells (Paschos et al., Tissue Eng Regen Med (2014) DOI: 10.1002 / term.1870). The present invention relates to a different co-culture. The present invention provides co-cultures at the tissue level, in which two or more differently developed tissues are cultured together to form fused tissues, i.e., bi-differentiated or multi-differentiated tissues. Practitioners do not mix individual cells of different original tissues, because the original different tissues maintain separate locations of tissue types within bi-differentiated or multi-differentiated tissues. However, cell migration is certainly allowed. In fact, it is expected that cells migrate naturally from one tissue to another and show the natural development of fused tissues. Some cells form connections between different tissue types.

[0026] The growth of tissue can be carried out to form bi-differentiation or multi-differentiation tissue, as known in the field of tissue culture. It is preferably cultured in a three-dimensional matrix. The three-dimensional matrix is ​​different from 2D culture, such as 2D culture in a dish on a flat surface. "Three-dimensional culture" means that the culture can be expanded in all three dimensions without being blocked by a side wall (such as the bottom plate of a dish). Preferably, such culture is suspended. The three-dimensional matrix can be a gel, especially a rigid and stable gel, which causes further expansion and differentiation of the growing cell culture / tissue. Suitable three-dimensional matrix can include collagen. More preferably, the three-dimensional matrix includes an extracellular matrix (ECM) or any component thereof selected from collagen, laminin, entactin and heparin sulfated proteoglycan or any combination thereof. The extracellular matrix can be from Engelbreth-Holm-Swarm tumor or any component thereof, such as laminin, collagen (preferably type 4 collagen), nestin and optionally additional heparan sulfated proteoglycan or any combination thereof. Such matrix is ​​matrigel. Matrigel is known in the art (US 4,829,000) and has previously been used to model 3D cardiac tissue (WO 01 / 55297A2) or neuronal tissue (WO 2014 / 090993). Preferably, the matrix comprises laminin, collagen and haptic protein, preferably at a concentration of 30%-85% laminin, 3%-50% collagen and haptic protein sufficient to form a gel of the matrix, typically 0.5%-10% haptic protein. If the amount of collagen is insufficient to form a gel, the laminin may require the presence of haptic protein to form a gel. Even more preferably, the matrix comprises at least 3.7 mg / ml containing (by weight) about 50%-85% laminin, 5%-40% collagen IV, optionally 1%-10% nidogen, optionally 1%-10% heparan sulfate proteoglycan and 1%-10% haptic protein. The solid components of the matrix glue generally contain about 60% laminin, 30% collagen IV and 8% haptoprotein. All % values ​​given for the matrix components are in % by weight. Haptoprotein is a bridging molecule that interacts with laminin and collagen. Such matrix components can be added in step r). These components are also a preferred part of the kit of the present invention. The three-dimensional matrix can further contain growth factors, such as any one of EGF (epidermal growth factor), FGF (fibroblast growth factor), NGF, PDGF, IGF (insulin-like growth factor), especially IGF-1, TGF-β, tissue plasminogen activator. The three-dimensional matrix can also be free of any of these growth factors.

[0027] Generally, three-dimensional matrix is ​​the three-dimensional structure of biocompatible matrix. It preferably comprises collagen, gelatin, chitosan, hyaluronic acid, methylcellulose, laminin and / or alginate. Matrix can be gel, particularly hydrogel. Organic chemical hydrogel can comprise polyvinyl alcohol, sodium polyacrylate, acrylate polymer and copolymer with a large amount of hydrophilic groups. Hydrogel comprises the network of hydrophilic polymer chain, sometimes finds with colloidal gel, wherein water is dispersion medium. Hydrogel is highly absorbent (it can contain more than 99% by weight of water) natural or synthetic polymer. Hydrogel also has the flexibility degree very similar to natural tissue due to its considerable water content. Three-dimensional matrix or its component (especially ECM or collagen) may still remain in the tissue culture produced. Preferably, this three-dimensional matrix is ​​collagen matrix, preferably it contains type I and / or type IV collagen.

[0028] The first, second and optionally further tissues used as fusion starting materials can also be cultivated or differentiated in the three-dimensional matrix as above--certainly, as mentioned above, suitable growth factors can also be used to differentiate into the desired tissue type. Therefore, the present invention also provides culturing cells in the three-dimensional matrix, preferably stem cells and making cell differentiation into the first and / or second and / or further tissue step that will be further used in the inventive method. The present invention also provides the use of tissues cultivated in the three-dimensional matrix.

[0029] Preferably, the first tissue development to the interested differentiation stage is separated from the second tissue development to different interested differentiation stages.Separate the differentiation of the first and second tissues (and if intended to use, and further organized) allows better control of differentiation.Certainly common differentiation is also possible, at least to a certain stage, for example towards a general organ destination, such as general neuronal tissue or any other organ or tissue category as described above, separate to specific tissue subtype, such as dorsal or ventral tissue differentiation.Separate differentiation can be for example in separate containers, for example in different bottles, flasks or dishes.

[0030] In particular, artificial tissue cultures comprising the first and / or second tissues are provided. Such cultures can be cultured in vitro from cells or aggregates of cells. The culture is particularly not a culture of a brain or tissue sample thereof developed in vivo. The first and second tissues used as the starting block for producing the present invention are preferably separable, i.e., have not been cultured together. They can be separated without breaking cell or ECM (extracellular matrix) bonds, for example by cutting or tearing.

[0031] The first and second tissues are then placed in proximity allowing fusion by growth. Tissues can be placed directly adjacent or with very little space between (e.g., filled with matrix material, such as the matrix material of the above-mentioned three-dimensional matrix), which allows tissues to be connected by growth. Such distances can be 0.001 μm to 50 μm, preferably 0.01 μm to 20 μm or 0.1 μm to 10 μm or up to 1 μm. The first and second tissues are placed in proximity sufficient to fuse by growth and the step of allowing the first and second tissues to grow and fuse to each other is preferably carried out in suspension culture, such as after being placed in sufficient culture medium or matrix (e.g., 3D matrix such as hydrogel).

[0032] During the connection period and also afterwards, preferably culture tissue in three-dimensional matrix.Therefore, as mentioned above, the first and second (and optionally further) tissues are placed in a three-dimensional matrix material (preferably a hydrogel).Then, the tissue will continue to grow and merge to form a bi-differentiation or multi-differentiation tissue.Bi-differentiation or multi-differentiation tissue can continue to grow or be maintained in a three-dimensional matrix such as a hydrogel to further develop.This type of further development can include allowing cells to migrate to another type of tissue from one type of tissue.Types of tissue are those tissues produced by the original first and second tissues (if present, optionally further organized) separated.Therefore in a preferred embodiment, the present invention is included in the bi-differentiation or multi-differentiation tissue and cells are migrated from the first tissue to the second tissue.

[0033] Preferably, even after joining (fusion), the tissue is further cultured. After joining, interesting processes such as cell migration between tissue types can be observed. Further development can occur. Preferably, the bi-differentiated or multi-differentiated tissue is cultured for at least 5 days after joining, preferably at least 10 days after joining.

[0034] In a preferred embodiment of the present invention, the tissue is a neuronal tissue, in particular, the bi-differentiated or multi-differentiated tissue of the present invention is a brain organoid. Brain organoids are disclosed, for example, in WO2014 / 090993, PCT / EP2017 / 050469, Lancaster et al., Lancaster & Knoblich (all the same). Organoids are miniaturized and simplified forms of organs produced in vitro in three dimensions, which show realistic microscopic anatomy. They are derived from one or more cells from tissues, embryonic stem cells or induced pluripotent stem cells, which can self-organize in three-dimensional culture due to their self-renewal and differentiation capabilities. In view of the corresponding growth or differentiation factor stimulators, the first, second and optionally further tissues may already be organoids or be able to develop into organoids. Preferably, at least the bi-differentiated or multi-differentiated tissue is cultured into an organoid, which then becomes a bi-differentiated or multi-differentiated organoid.

[0035] In a preferred embodiment, at least the first tissue comprises neuronal tissue, preferably outer radial glial cells, cortical subventricular zone and cortical fiber layer (and / or comprises neural progenitor cells and neurons). Alternatively or in addition, in particular in addition, preferably at least the second tissue comprises neuronal tissue, preferably outer radial glial cells, cortical subventricular zone and cortical fiber layer (and / or comprises neural progenitor cells and neurons). These parts, zones and layers are hallmarks of late-stage developing brain organoids, and preferably exist to study late neural development. Preferably, bi-differentiation or multi-differentiation tissue comprises neuronal tissue, preferably outer radial glial cells, cortical subventricular zone and cortical fiber layer (and / or comprises neural progenitor cells and neurons).

[0036] Preferably, the differentiation stage of the first tissue comprises ventral forebrain progenitor tissue or rostral forebrain tissue. Differentiation to ventral or ventral-like tissue types can be initiated by WNT inhibition and / or SHH signaling enhancement. A suitable WNT inhibitor that can be used to treat cells of the first tissue is IWP2 ("WNT production inhibitor-2", for example CAS No.: 686770-61-6). A suitable SHH signaling enhancer that can be used to treat cells of the first tissue is SAG ("smoothened agonist", for example CAS No.: 364590-63-6). Concentrations as described in the examples can be used. WNT inhibition and / or SHH signaling enhancement preferably occur simultaneously with neural induction (i.e., differentiation of progenitor cells toward neural tissue development). Also preferably, the differentiation stage of the second tissue comprises dorsal forebrain tissue or neural ectoderm that is not differentiated into ventral or dorsal forebrain. Differentiation to dorsal or dorsal-like tissue types can be initiated by SHH activity inhibition. A suitable SHH activity inhibitor that can be used to treat cells of the second tissue is cyclopamine A (CycA). Concentrations as described in the examples can be used. SHH inhibition preferably occurs simultaneously with neural induction (i.e. differentiation of progenitor cells towards neural tissue development).Preferably, bi-differentiation or multi-differentiation tissues include ventral forebrain progenitor tissues or kiss ventral forebrain tissues in a tissue position (corresponding to the first tissue), and dorsal forebrain tissues or neural ectoderm that are not differentiated into ventral or dorsal forebrain in another position (corresponding to the second tissue).In short, ventral and dorsal tissues allow to observe late neural development, such as the neural cells migrating, particularly GABAergic neuron cells, such as those forming interneurons.Such cells can migrate out of the ventral position, so it is preferably present in the first tissue of the present invention and / or bi-differentiation or multi-differentiation tissues.

[0037] Preferably, the bi-differentiated or multi-differentiated tissue is differentiated to develop into a neural plate or further develop into a neural tube. The neural plate or the neural tube may be present in the bi-differentiated or multi-differentiated tissue of the present invention.

[0038] In a preferred embodiment of the present invention, the first tissue is cultured to a size of at least 100 μm, preferably at least 150 μm, and particularly preferably at least 200 μm. Also preferably, the second tissue is cultured to a size of at least 100 μm, preferably at least 150 μm, and particularly preferably at least 200 μm. Preferably, the first and second tissues are cultured to approximately the same size and then allowed to fuse to form a bi-differentiated or multi-differentiated tissue. Approximately the same size means that the volume differs by at most 40%, preferably at most 30%, at most 20% or at most 10%. "Size" refers to the longest dimension in 3D space. Preferably, the tissue is spherical, in particular the shortest dimension is not less than 20% of the longest dimension, in particular not less than 30% or not less than 40% of the longest dimension. Preferably, the volume of the first and / or second tissue is at least 1x10 6 μm 3 , particularly preferably at least 2x10 6 μm 3 , at least 4x10 6 μm 3 , at least 6x10 6 μm 3 The bi-differentiated or multi-differentiated tissues may be of the same size, shape and volume, or even larger in size and volume, e.g., at least 8×10 6 μm 3 , at least 10x10 6 μm 3 , at least 15x10 6 μm 3 A volume of at least 250 μm and / or a size of at least 350 μm.

[0039] The first and second tissues are typically small cell aggregates and may have a size of at most 2 mm, preferably at most 1250 μm or at most 800 μm, for example at most 8 mm 3 , up to 2mm 3 or at most 1mm 3 In some embodiments, the bi-differentiated or multi-differentiated tissue may be larger, having a size of at most 15 mm, preferably at most 10 mm or at most 5 mm, for example, having a size of at most 60 mm. 3 , up to 30mm 3 or up to 10mm 3 volume.

[0040] The first tissue and the second tissue may express certain differentiation markers, or lack the expression of such markers, as a signal of specific differentiation. The expression markers are signs of different differentiation of the two tissues.

[0041] Preferably, the first tissue and / or the bi-differentiated or multi-differentiated tissue of the present invention comprises cells, which express DLX2. DLX2 is expressed in cells of ventral forebrain identity. Preferably, this tissue type is comprised in the tissue of the present invention.

[0042] Preferably, the first tissue and / or the bi-differentiated or multi-differentiated tissue of the present invention comprises cells that express GSX2. GSX2 is expressed in cells of the dorsal-lateral ganglionic eminence and the caudal ganglionic eminence. Preferably, this tissue type is comprised in the tissue of the present invention.

[0043] Preferably, the first tissue and / or the bi-differentiated or multi-differentiated tissue of the present invention comprises cells, which express NKX2-1. NKX2-1 is expressed in cells of the ventro-medial ganglionic eminence identity. Preferably, this tissue type is comprised in the tissue of the present invention.

[0044] Preferably, the first tissue and / or the bi-differentiated or multi-differentiated tissue of the present invention comprises cells, which express LHX6. LHX6 is expressed in cells of a sub-region of the ventro-medial ganglionic eminence identity. Preferably, this tissue type is comprised in the tissue of the present invention.

[0045] Preferably, the first tissue, the second tissue and / or the bi-differentiated or multi-differentiated tissue of the present invention comprises cells that express FoxG1. FoxG1 is expressed in cells of dorsal cortical identity. Preferably, this tissue type is included in the tissue of the present invention.

[0046] Preferably, the second tissue and / or bi- or multi-differentiated tissue of the invention comprises cells, which express TBR1. TBR1 is expressed in cells of dorsal forebrain identity. Preferably, this tissue type is comprised in the tissue of the invention.

[0047] Preferably, the second tissue and / or bi-differentiated or multi-differentiated tissue of the present invention comprises cells, which express TBR2. TBR2 is expressed in cells of dorsal cortical identity. Preferably, this tissue type is comprised in the tissue of the present invention.

[0048] The bi-differentiated or multi-differentiated tissues of the present invention can contain a fusion site between tissue types similar to the first and second tissues from which they are generated. Such fused sites can allow for the juxtaposition of sites of tissue types, thereby generating a tissue as a continuous tissue, wherein one side is of the first tissue type and the other side is of the second tissue type.

[0049] Preferably, the first and / or second tissue expresses a detectable marker, which is not expressed by the other of the group from the first and second tissues. In a preferred embodiment, it is also applicable to further tissue (if present). Detectable markers should not be confused with the expression markers of the previous paragraph. Here, detectable markers refer to markers introduced into (e.g., for recombinant expression) the cells of the first and / or second tissues as the markers of the tissues. Emphasis is on easy detection and measurement, such as in the case of fluorescent markers. Detectable markers preferably provide light signals, such as color or fluorescence. Detectable markers can be used to track cells throughout the first or second tissue sources (tissue types) of bidifferentiation or multidifferentiation tissues. As described, cells can migrate and travel between tissue types.

[0050] The present invention also provides bi-differentiated or multi-differentiated tissues obtainable by the method of the present invention. According to the method of the present invention, when performed in vitro, tissues are also provided in vitro. Alternatively, it can be implanted into a non-human animal, such as a rodent.

[0051] The present invention provides bi-differentiation or multi-differentiation tissues of at least two tissue types with different differentiation stages, wherein at least one of the tissue types comprises ventral neuronal tissue, and at least another tissue type is substantially non-ventral, but contains no more than 5% of the migratory cells from the ventral neuronal tissue accounting for the cells of the substantially non-ventral tissue. The tissue can also be provided in vitro or implanted in a non-human animal, such as a rodent. In vitro, in the same sense as above, the tissue is preferably provided in a container such as a vial. It can be provided suspended or suspendable (i.e., not fixed on the wall of the container).

[0052] Due to the use of tissues developed to different differentiation stages, the tissue of the present invention is the product of the fusion of different tissues, so the bi-differentiation or multi-differentiation tissue of the present invention will reflect and include these different tissue fusions.Preferably any developmental stage as described above, such as ventral or dorsal developmental tissue.Other embodiments provide fusions of healthy and disease developmental stages, such as selected from neuropsychiatric diseases such as epilepsy, autism and schizophrenia, as described above.The fusion of two different disease states is also possible.Such fusions show characteristic cell migration or its damage according to the disease.Migration can be monitored in other (usually healthy) tissues.Health means not being in a diseased state.Preferably, a three-dimensional matrix, such as a hydrogel, is still present in bi-differentiation or multi-differentiation tissues.

[0053] Preferably, the non-human animal used for implantation is immunocompromised to avoid tissue rejection.

[0054] Such tissues constitute the tissue of the first tissue of ventral differentiation and another non-ventral differentiation, such as the second tissue of dorsal differentiation or the tissue of neuronal differentiation (no further ventral differentiation) fusion, as discussed in more detail above.Certainly, all of the above preferred embodiments also relate to this tissue, particularly embodiments such as position, size and detection marker or expression marker.For example, at least one expression of tissue type can detect marker, preferably fluorescent marker, which is not expressed by another tissue type of bidifferentiation or multidifferentiation tissue.This allows easy detection of the tissue and cell thereof, and the cell can migrate to other tissue types.Preferably, the tissue type with marker is the first tissue of ventral differentiation.

[0055] The tissue provided can have cells that are migrating or have migrated. Such cells can have moved to another type of tissue that is substantially non-ventral (e.g., dorsal). In non-ventral tissue, the migratory cells from the ventral neuronal tissue can account for no more than 5% (% of the cell amount of the non-ventral / second tissue) of the cells of the non-ventral tissue substantially. Preferably, in non-ventral tissue or generally the second or optionally further tissue, find 5% or less, 4% or less, 3% or less, 2% or less or 1% or less of the ventral cells or generally the cells of the first tissue (% of the cell amount of the tissue in which the ventral / first tissue cells are found).

[0056] The bi- or multi-differentiated tissue preferably has a size of 100 μm to 10 mm in its longest dimension, or any size, shape or volume already mentioned. A size of 250 μm to 10 mm or 500 μm to 5 mm is preferred.

[0057] The bi-differentiated or multi-differentiated tissues of the present invention can be provided in the form of spheroids, for example, as described above in any given shape or aspect ratio (dimension ratio). Bi-differentiated or multi-differentiated tissues can also be provided as tissue sections. Bi-differentiated or multi-differentiated tissues can be cultured as described in detail above, and then tissue sections can be obtained. Such sections can have, for example, a thickness of 3 μm to 100 μm or 5 μm to 50 μm or 10 μm to 30 μm, preferably about 20 μm. Other dimensions, such as the longest dimension as described above, can still be displayed by sections. Sectioning is preferably performed in a frozen state. Sections can be used to detect detection and / or expression markers in tissue sections. Sections can be used for microscopic imaging.

[0058] The tissue is considered to be an artificial tissue. "Artificial" means that it is cultured in vitro and has certain characteristics of artificial culture, such as size, consistency, shape and cell structure. The shape can be irregular and different from naturally occurring tissue, and due to size restrictions, the cell structure can be different. Specifically, "artificial" excludes naturally occurring tissues and organs and parts thereof, such as natural tissue sections. The three-dimensional matrix can still be in culture and / or the artificial tissue can have a shape determined by growing in such a matrix. For example, the culture can be obtained by growing in a three-dimensional matrix (particularly those as described above). Preferably, the tissue of the present invention is an organoid, especially a brain organoid.

[0059] The tissue can be any of the tissue types mentioned above, such as neuronal tissue, connective tissue, liver tissue, pancreatic tissue, kidney tissue, bone marrow tissue, heart tissue, retinal tissue, intestinal tissue, lung tissue and endothelial tissue; and can contain any cells, such as the stem cells mentioned above.

[0060] The present invention provides an organoid fusion assay that allows analysis of human cortical interneuron migration. This technology enhances the repertoire of phenotypic assays available for brain organoids and, in turn, increases the complexity of phenotypes that can be used to study the developmental cell biology of human neurological diseases.

[0061] For example, a method of testing or screening for candidate compounds that affect the development of bi-differentiated or multi-differentiated tissues is provided, the method comprising contacting a cell or tissue in any of the methods of the invention with a candidate compound or contacting a tissue of the invention with a candidate compound and maintaining the contacted tissue in culture, and observing any developmental changes in the tissue compared to the tissue not contacted with the candidate compound.

[0062] The contact step is a treatment step of cells or tissues or their precursor tissues (such as the first, second and / or any further tissues) to be developed into tissues of the present invention. Candidate compounds can be small organic molecules, for example molecules with a mass of 100Da to 5000Da. Other candidate compounds can be biomolecules, such as proteins, nucleic acids or carbohydrates. Other candidate compounds can be bulk chemicals, such as solvents, for example ethanol (of course, used at a concentration that is usually feasible for cells) or polymers. Processing should be carried out at a concentration that can be expected to have a specific effect on the compound. Various concentrations can be tested in parallel. Typically, the concentration of candidate compounds is 1ng / ml to 100mg / ml, for example 100ng / ml to 1mg / ml.

[0063] Particularly preferably, the method or tissue of the present invention can be used to test candidate drugs as side effects in candidate compounds. Preferably, the cause, nature and possible cure of congenital disorders are studied by monitoring any changes. For example, when contacted with potential pathogenic substances / environmental changes / genetic modifications, teratogenic effects can be tested by monitoring the development and / or growth of the tissue of the present invention.

[0064] By this method, the developmental effects or diseases affected by candidate compounds or other environmental influences can be studied. If only during the initial differentiation period, the expected effect is expected, for example, when the cell is differentiated and cultured as the first / and / or second or optionally further tissue, it is sufficient to contact the cell. If the expected effect (for example, organ-specific teratogen) is expected during the subsequent differentiation and / or differentiation of the cell arrangement or growth period, it is sufficient to contact the first and / or second or optionally further tissue. Tissue can also be contacted after fusion or during fusion. Of course, this can be combined with the contact during cell differentiation. For example, this type of teratogenic compound is ethanol, and if the embryo or fetus is exposed to ethanol during development, it causes fetal alcohol disease, for example fetal alcohol syndrome. The effect of ethanol on developing tissue (for example, brain tissue during development) can be studied with the method of the present invention.

[0065] According to a preferred embodiment, the present invention provides a method for studying the effects of developmental tissues, comprising: at any stage during the method of the present invention, i) reducing or increasing the expression of a gene of interest in a cell, or ii) administering a candidate drug to the cell, wherein the cell is cultured toward a bi-differentiation or multi-differentiation tissue according to the present invention, preferably during differentiation into tissue types and / or fusion.

[0066] Also provided are methods for screening candidate therapeutic agents suitable for treating a developmental tissue defect of interest, comprising performing the differentiation and / or fusion methods of the invention and administering the candidate agent to the cells at any stage during the method (as described above), preferably at all stages.

[0067] Also provided are methods for testing candidate drugs for developmental effects, particularly effects on congenital disorders, comprising administering a candidate drug to a tissue according to the invention or during the method (e.g. during differentiation, development of a first / second tissue, during fusion or after fusion) and determining an activity of interest in cells of said tissue, and comparing said activity with the activity of cells of a tissue to which said candidate drug has not been administered, wherein a differential activity (relative to a control) is indicative of a developmental effect.

[0068] Also provided are kits of compounds and substances. The kit may contain means for carrying out any of the methods of the invention. Of course, since some are standard chemicals or are commonly available, it is not necessary to include all the substances. However, core substances are preferably provided. In other kits, relatively rare substances are provided. Of course, the kit of the invention or its substances may be combined. The components in the kit are usually provided in separate containers, such as vials or flasks. The containers may be packaged together. Preferably, the kit contains a manual or instructions for carrying out the method of the invention or its steps.

[0069] A kit suitable for providing a tissue culture according to the present invention is provided. The kit may comprise a ventral differentiation inducer and a dorsal differentiation inducer, preferably a WNT inhibitor and / or a SSH enhancer as a ventral differentiation inducer, and preferably a SSH inhibitor as a dorsal differentiation inducer. Neural growth or differentiation factors without ventral or dorsal differentiation activity are also possible. Such kits may be used for neural differentiation, for example to generate brain organoids. In alternative kits, growth or differentiation factors of any of the above-mentioned tissues, tissue types, and organs may be included.

[0070] Preferably, the kit comprises a three-dimensional matrix as described above, or its components to generate such a three-dimensional matrix. The matrix component can be provided in a solid state (e.g., a lyophilized state) to be reconstructed into a matrix, for example, by hydration. Any matrix or its components as described above can be included in the kit. Preferably, the matrix is ​​a hydrogel, especially a collagen hydrogel as described above. The kit may include such reconstructable (preferably collagenous) components. Further preferred matrix components are carbohydrates, particularly in polymer form (polysaccharides). Preferred polysaccharides are agarose.

[0071] Any kit may further comprise cell growth nutrients, preferably DMEM / F12, fetal bovine serum, basic fibroblast growth factor (bFGF), 2-mercaptoethanol or any combination thereof.Any compound mentioned in the examples may be included in the kit.

[0072] It is contemplated that any method or product described herein may be performed with respect to any other method or product described herein, and that the different embodiments may be combined.

[0073] The claims originally filed are intended to cover multiple dependent claims of any filed claim or combination of filed claims. It is contemplated that any embodiment discussed herein may be performed with respect to any method or product of the invention, and vice versa. Any embodiment discussed with respect to a particular condition may be applied or performed with respect to a different condition. In addition, the compositions and kits of the invention may be used to implement the methods of the invention.

[0074] "Comprising" is understood as an open term, ie, allowing for additional components or steps of substances. "Consisting of" is understood as a closed term, not having any additional components or steps of substances.

[0075] Throughout this application, the term "about" may be used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value, or may refer to ±10% in the stated value.

[0076] The invention is further described by the following figures and examples without necessarily being limited to these embodiments of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 .Ventral drug treatment generates brain organoids containing the ventral forebrain. (A) Schematic diagram of the brain organoid protocol with ventral drug patterning application (2.5 μM IWP2 and 100 nM SAG) during the neural induction step. (B) Schematic diagram of human coronal brain sections indicating the site expression of patterning markers for qPCR / IHC analysis. (C) qPCR analysis of the expression of markers for different brain sites, showing increased ventral forebrain identity and decreased dorsal forebrain identity in ventral brain organoids. Values ​​are plotted as relative expression levels relative to the reference gene TBP (2 -ΔCt ). Each data point corresponds to a pooled batch of 8-10 organoids. Data are expressed as mean ± SD, and statistical significance was tested using student's t-test (df = 9) for control (n = 6 batches) versus IWP2 + SAG (n = 5 batches) treatment. (DE) Wide-field images of immunostaining analysis of control and ventral brain organoids demonstrate ventral forebrain identity of ventral organoids (D), and dorsal forebrain identity of control organoids (E). Scale bar 200 μm.

[0078] Figure 2 Fusion of brain organoids allows for cell migration between ventral and dorsal forebrain tissue. (A) Experimental overview of the brain organoid fusion co-culture method. (B) Representative wide-field images at different stages throughout the organoid fusion protocol. (C) Tile-scan image of an immunostained cryosection of a ventral::dorsal organoid fusion demonstrating ventral (NKX2-1 + ) and dorsal (TBR1 + (D) Immunostained ventral::dorsal organoid fusion cryosections from organoids at different ages showing GFP + Time course of cell migration from the ventral to the dorsal tissue. (E) GFP expression in dorsal tissue in sections from 32 (n=3 organoids), 46 (n=3), 58 (n=4), and 80 (n=4) day old organoids. +Cell density was quantified. Data are expressed as mean ± SD and statistical significance was tested using one-way ANOVA [F(3,10) = 12.59, p = 0.0010] with Tukey post hoc test for comparison between groups. Scale bar, 500 μm.

[0079] Figure 3 .Tissue components of mixed brain organoid fusions demonstrate the most robust migration from ventral to dorsal sites. (A) Brain organoid fusions were created containing different combinations of ventral (V), control (C), or dorsal (D) treated tissues. Components were labeled with GFP (green) or tdTomato (red). (A) Whole mount images of organoid fusions at approximately 80 days of age show that tdTomato + GFP appeared in tissues + (B) Confocal image of a tile-scan cryosection of a mixed organoid fusion immunostained for GFP + Cells migrate across the midline (dashed line) into GFP-organoids. (C) GFP from tissue sections - GFP in tissue + Quantification of cell density. Each data point corresponds to an individual organoid and data are presented as mean ± SD, with statistical significance tested using one-way ANOVA [F(3,19) = 8.214, p = 0.0010] with Tukey post hoc test for comparison between groups. Ventral::control (n = 7 organoids) and ventral::dorsal (n = 8) fusions showed GFP compared to control::control (n = 4 organoids) and dorsal::dorsal (n = 4) fusions. + Maximum migration of cells. Scale bar is 500 μm.

[0080] Figure 4 GABAergic interneurons migrate between fused dorsal-ventral brain organoids. (A) Whole organoid confocal tile scan of a cryosection of an 80-day-old ventral::dorsal organoid fusion immunostained for GFP. + Cells that have GFP + The ventral migration across the fusion midline (dashed line) to GFP - In dorsal tissues. The GABAergic marker GAD1 can be observed in a pattern similar to GFP (arrow). (BC) Magnified views of the periphery (B) and internal regions (C) of the organoid fusion in (A). GFP expressing GAD1 can be observed in both regions (arrows). +(D) Confocal image of GFP / RELN immunostaining in the dorsal part of a cryosection of an 80-day-old ventral::dorsal organoid fusion, showing migrating GFP + Cells (arrows) do not express RELN. (E) Confocal image of GFP / DCX / NeuN immunostaining in the dorsal part of a cryosection of a 58-day-old ventral::dorsal organoid fusion, showing migrating GFP + DCX + Immature neurons (yellow arrows) and some mature (DCX + / NeuN + ) Neurons (blue arrows). Scale bars are (A) 500 μm, (B, E) 20 μm.

[0081] Figure 5 Migrating interneurons in ventral::dorsal brain organoid fusions express various interneuron subtype markers. (AH) Confocal images of immunostaining in the dorsal part of 80-day-old ventral::dorsal organoid fusion cryosections. Expression of the GABAergic markers GAD1 or VGAT was used to identify interneurons. Various migrating GFP expressing GAD1 or VGAT were observed. + Examples of interneurons expressing the MGE-derived interneuron marker SOX6 (A) or subtype markers SOM (B), NPY (C), CB (D), and PV (E). + Interneurons also express the LGE / CGE-derived interneuron markers SP8 (F), COUP-TFII (G), or the subtype marker CR (H). Scale bar, 20 μm. Abbreviations: SOM = somatostatin, NPY = neuropeptide Y, CB = calcium binding protein, PV = parvalbumin, CR = calreticulin, VGAT = vesicular GABA transporter, GAD1 = glutamate decarboxylase 1.

[0082] Figure 6 Migrating cells in brain organoid fusions exhibit migratory kinetics similar to interneurons migrating in the tangential direction and are sensitive to CXCR4 activity. (A) Schematic diagram of organoid fusion slice culture assays for short-term time-lapse imaging of migration kinetics or long-term drug treatment. Representative tile scans of entire ventral::dorsal organoid fusion slices are shown, with ventral GFP + The site is labeled in green and the unlabeled or tdTomato dorsal site is outlined in red. The site containing migrating cells shown in (B) is marked with a yellow box. (B) shows the migrating GFP +Still images of a 3-day time-lapse experiment of cells. Branched guidance processes exhibit both extended (closed arrows) and retracted (open arrows) branches as the cell body follows one of the guidance processes. (C) Extended neurites (closed arrows) with clusters of what appear to be axonal growth cones travel in one direction across the field of view. (D) Migration of tdTomato from long-term organoid fusion slice cultures that were untreated (control) or treated with a CXCR4 inhibitor (AMD3100) + GFP in the dorsal region (red outline) + Wide field images of cells. (E) Quantification of migrating GFP + Cell density, where data are expressed as mean ± SD, where control (n = 3 organoids) were compared to AMD3100 (n = 3) treatment, and statistical significance was tested using student's t test (df = 4). Each data point represents a slice from a single organoid. Fewer migrating cells were observed in slice cultures treated with AMD3100. Scale bars are (A) 500 μm, (BC) 50 μm, and (D) 500 μm.

[0083] Example

[0084] Example 1: Cell culture

[0085] Feeder-dependent human induced pluripotent stem cells (hiPSCs) (Systems Biosciences, catalog number SC101A-1) were obtained from System Biosciences, with verified pluripotency and no contamination. Human embryonic stem cells were used on gelatin (0.1% gelatin in PBS) coated 6-well culture plates. (hESC)Culture medium Feeder-dependent hiPSCs were cultured with irradiated mouse embryonic fibroblast (MEF) feeder cells (MTI-GlobalStem, catalog number 6001G) in human embryonic stem cell (hESC) culture medium: DMEM / F12 (Invitrogen), containing 20ng / mL bFGF (produced by IMBA institute Molecular Biology Service core facility), 3.5μL / 500mL of 2-mercaptoethanol medium, 20% KnockOut serum (Invitrogen), 1% GlutaMAX (Invitrogen), 1% MEM-NEAA (Sigma) and 3% FBS. Feeder-free H9 human embryonic stem cells (hESCs) were obtained from WiCell, with a verified normal karyotype and no contamination. Feeder-free hESCs were cultured on 6-well plates coated with hESC-qualified matrigel (Corning, catalog number 354277) using mTeSR1 (Stemcell Technologies). All stem cells were maintained in a 5% CO2 incubator at 37°C. hPSCs were cultured and isolated using standard protocols as previously described (Lancaster & Knoblich Nat Protoc 9, 2329–2340 (2014)). All cell lines were routinely tested for contamination and confirmed to be mycoplasma negative.

[0086] Example 2: Cloning / Molecular Biology / Generation of hPSC Cell Lines

[0087] To ubiquitously fluorescently label cells, reporter constructs were inserted into the safe harbor AAVS1 locus in hPSCs using the AAVS1 SA-2A-Puro donor vector as a template, as previously done with TALEN technology (Hockemeyere et al. Nat. Biotechnol. 27, 851–857 (2009)). A modified backbone containing flanking tandem repeats of the core chicken HS4 insulator (2xCHS4) was created. A fluorescent reporter expression cassette was inserted between the flanking insulator sequences. The following expression constructs were inserted into iPSCs: 1) 2xCHS4-EF1α-eGFP-SV40-2xCHS4, 2) 2xCHS4-EF1α-tdTomato-SV40-2xCHS4. In feeder-free H9 hESCS, the 2xCHS4-CAG-eGFP-WPRE-SV40-2xCHS4 construct was inserted to enhance GFP expression for time-lapse imaging experiments.

[0088] Use and preparation of EB 11The same cell dissociation protocol, hPSC is prepared as a single cell suspension for nuclear transfection. Each nuclear transfection containing 1 μg of each TALEN guide and 3 μg of donor plasmid DNA uses 800,000 cells following the manufacturer's guidelines, and the Amaxa nuclear transfection device (Lonza) is used together with the stem cell kit 1. After nuclear transfection, 200 μL of a total of 600 μL of nuclear transfection solution is plated on a 10 cm cell culture dish. Colonies from single cells are grown for 4 days and then treated with Puromycin (Puro) (Jena Bio-science, catalog number NU-931-5). For feeder-dependent cells, 1.1 μg / mL Puromycin is applied, and for feeder-free cells, 0.7 μg / mL is applied. Puromycin treatment lasts for 5-7 days until the surviving colonies are large enough to be manually picked and transferred to a 24-well plate. When colonies were isolated from 24-well plates, half of the cells were used for genotyping, while the other half were expanded to 12-well and then 6-well formats and then used for further experiments. For genotyping, DNA was extracted using QuickExtract solution (EpiCentre) and PCR was performed using the following primers to identify correctly targeted AAVS1 insertions: 1) Puro (AAVS1_Puro-fwd: tcccctcttccgatgttgag (SEQ ID NO: 1) and AAVS1_Puro-rev: gttcttgcagctcggtgac (SEQ ID NO: 2)), 2) eGFP (AAVS1_eGFP-fwd: GAACGGCATCAAGGTGAACT (SEQ ID NO: 3) and AAVS1_eGFP-rev: cttcttggccacgtaacctg (SEQ ID NO: 4)), and 3) tdTomato (AAVS1_tdTomato-fwd: ctacaaggtgaagatgcgcg (SEQ ID NO: 5)) and (AAVS1_tdTomato-rev: tccagcccctcctactctag (SEQ ID NO: 6)). To determine whether the insertion was heterozygous or homozygous, additional PCR primers were used to test for the presence of the WT allele: 4) WT (AAVS1_WT-fwd: tcccctcttccgatgttgag (SEQ ID NO: 7) and AAVS1_WT-rev: tccagcccctcctactctag (SEQ ID NO: 8)). Cell clones with correctly targeted heterozygous or homozygous insertions were archived by freezing with Cell Banker 2 solution (Amsbio, catalog number 11891) and / or cultured for further experiments.

[0089] Example 3: Brain organoid generation and fusion

[0090] Brain organoids were generated with slight modifications following protocols previously described in WO2014 / 090993, Lancaster et al., Nature 501, 373-379 (2013), Lancaster & Knoblich, Science 345, 1247125-1247125 (2014), and Lancaster & Knoblich, Nat Protoc 9, 2329-2340 (2014). Drug patterning treatments were applied during the neural induction step (approximately day 5-11) of the protocol using one of the following treatments: 1) control, no drug, 2) ventral, 2.5 μM IWP2 (Sigma, catalog number I0536) and 100 nM SAG (Millipore, catalog number 566660), 3) dorsal, 5 μM CycA (Calbiochem, catalog number 239803). Drug stocks were created as follows: IWP2 (5 mM in DMSO), SAG (1 mM in H2O), and CycA (5 mM in DMSO). Organoids were cultured in 10 cm cell culture dishes containing 25 mL of differentiation medium after embedding in matrigel (Corning, catalog number 356235) and maintained on an orbital shaker after the first medium change, with medium changes performed every 5-7 days. After day 40 of the protocol, when organoids began to grow out of the matrigel droplets, the differentiation medium was supplemented with 1% matrigel.

[0091] In order to create organoid fusions, EBs were grown separately and patterned using control, dorsal or ventral schemes as described above. During matrigel embedding, two EBs were transferred to the same paraffin film well and embedded in a single droplet (about 30 μL) of matrigel. EBs were gently pushed as close as possible using a 20 μL pipette tip to ensure that EBs would be kept in the middle of a solidified matrigel droplet with extreme proximity.

[0092] Example 4: RNA extraction / qPCR

[0093] For each drug patterning treatment group, 8-12 organoids were collected in 2mL RNase-free tubes at 30-40 days and cooled on ice throughout the protocol. Organoids were washed 3 times in cold PBS, and then the matrigel was dissolved by incubating the organoids at 4°C for 1 hour in the cooled Cell Recovery Solution (Corning, catalog number 354253). The dissolved matrigel was removed by rinsing 3 times in cold PBS. RNA was extracted using RNeasy mini kit (Qiagen). cDNA synthesis was performed according to the manufacturer's protocol using 2 μg of total RNA and Superscript II (Invitrogen) enzyme. qPCR reactions were performed using Sybr Green premix (Promega) on a BioRad 384-well instrument (CXF384) using the following reaction protocol: 1) 95°C for 3 min, 2) 95°C for 10 sec, 3) 62°C for 10 sec, 4) 72°C for 40 sec, 5) Go to 2, 40 cycles, 6) 95°C for 1 min, 7) 50°C for 10 sec. Quantification was performed in excel by calculating the ΔCt value using TBP as a reference gene. Data are expressed as expression levels relative to TBP (2 -ΔCt ).

[0094] Example 5: Brain organoid slice culture and drug treatment

[0095] Slice cultures were generated by cutting organoid fusions into slices using a vibratome. Organoid fusion tissues were embedded in 4% low melting point agarose (Biozym, catalog number 850080) and incubated in ice-cold PBS (without Ca2+). 2+ / Mg 2+ ) to form 200-250 μm slices. The slices were transferred to Millicell organic inserts (Millipore, catalog number PICM01250) in 6-well cell culture plates. For time-lapse imaging, the slices were cultured for 1-2 days and then mounted for imaging using a rotating disk confocal microscope (VisiScope). The slices were cut from the culture insert membrane and inverted onto a glass bottom dish. The slices were fixed by placing the cell culture insert on top of the slice and attaching it to the dish using vacuum grease. For drug treatment, long-term slice cultures were first cultured overnight in differentiation medium (+5% FBS). The culture medium was then replaced with fresh culture medium (control) or a culture medium containing the CXCR4 inhibitor AMD3100 (Sigma, #A5602), and cultured for another 3 weeks, followed by tissue fixation and further immunofluorescence processing.

[0096] Example 6: Histology / Frozen Sections / Immunofluorescence

[0097] Organoid tissues were collected at the desired age, rinsed 3 times in PBS, and fixed overnight at 4°C in 4% PFA. The next day, the tissue was rinsed 3 times in PBS and cryoprotected overnight at 4°C in 30% sucrose in PBS. The tissue was then incubated for 2-4 hours in a 1:1 mixture of 30% sucrose / PBS and OCT cryoembedding medium (Sakura, catalog number 4583). Next, the group of 2-4 organoids was transferred from the sucrose / OCT mixture to a freezing mold (cryomold) and filled with OCT. The embedded tissue was frozen on dry ice and then placed in -80°C for long-term storage until cryostat sectioning was performed. The frozen organoid tissue was cut into 20 μm slices using a cryostat (Leica) and collected on superfrost Ultra Plus slides. Tissue sections were arranged so that every 10th section was collected sequentially until each slide contained 8-10 sections per tissue block. Sections were dried overnight before use for immunofluorescence labeling or stored at -20 °C until ready for staining.

[0098] Immunofluorescence was performed directly on the slides to the tissue sections. OCT was removed by washing in PBS for 10 minutes using a slide holder (Sigma, Wash-N-Dry). The sections were fixed directly on the slides using 4% PFA for 10 minutes at RT, and then washed in PBS for 3x10 minutes. The outline of the tissue area was outlined using a hydrophobic PAP pen. Permeabilization / blocking was performed using 5% BSA / 0.3% TX100 in PBS with 0.05% sodium azide, and incubated for 30 minutes at room temperature (RT) in a dark humidified slide box. Primary antibodies (a table of used primary and secondary antibodies can be found at the end of the method section) were added to an antibody solution (5% BSA, 0.1% TX100 in PBS with 0.05% sodium azide) at the desired dilution and incubated overnight at 4°C. The slides were rinsed 3 times in PBS, and then washed 3x10 minutes in PBST at RT on an orbital shaker. The secondary antibody was added to the antibody solution at 1:500 and incubated at room temperature for 2 hours. DAPI solution (2 μg / mL) was added for 5 minutes, and then the slides were washed as completed after the primary antibody application, with a final wash using PBS. The coverslips were mounted using DAKO mounting medium (Agilent Pathology Solutions, catalog number S3023) and allowed to harden overnight. The slides were then stored at 4°C until imaging, or at -20°C for long-term storage.

[0099] For long-term slice culture, slices cultured on cell culture inserts were rinsed with PBS and then fixed in 4% PFA at 4°C for 2 days. Slices were washed 3×10 minutes in PBS and then permeabilized / blocked as for frozen sections on slides. Primary and secondary antibody incubations were performed overnight at 4°C, followed by 3×10 minute washes in PBS after each step. Slices were mounted in Vectashield (Vector Labs) containing DAPI.

[0100] Example 7: Imaging / Microscopy

[0101] Fluorescent cell culture imaging was performed using a Zeiss Plan-Neofluar 2.5x 0.085 and a Zeiss LD A-Plan 10x 0.25Ph1 objective, a Zeiss Axio Vert.A1 widefield microscope and an AxiocamERc 5s camera (Zeiss, Zeiss GmbH). Both tdtomato and GFP channels were recorded separately and subsequently pseudo-colored and merged using the Fiji package of ImageJ.

[0102] Widefield imaging of IHC staining and long-term slice cultures was performed using an Axio Imager Z2 (Zeiss, Zeiss GmbH) using a Sola SM2 illumination source, (5x 0.15 plan-neofluar, 10x 0.3 plan-neofluar, 20x0.5 plan-neofluar) objective and a Hamamatsu Orca Flash 4 camera. The filters used were Ex360 / 40nmEm 445 / 50nm, Ex480 / 40nmEm 535 / 50nm and Ex560 / 55nmEm645 / 75nm.

[0103] Confocal imaging was performed using a Zeiss LSM700 AxioImager with a 20x 0.8 plan-apochromat dry objective. Lasers at 405 nm (5 mW), 488 nm (10 mW), 555 nm (10 mW), and 639 nm (5 mW) were used for recording along with wavelength-corresponding filters SP490, SP555, SP640 and LP490, LP560, LP640. For whole organoid tile scans, an XY scanning stage and the stitching algorithm implemented by Zeiss Zen were used. For colocalization of markers, Z scans were performed at 20x.

[0104] Imaging of GFP-stained slides for cell density counting and time-lapse migration was obtained using a Yokogawa W1 spinning disk confocal microscope (VisiScope, Visitron Systems GmbH, Puchheim, Germany) controlled by VisitronVisiView software and mounted on an Eclipse Ti-E microscope (Nikon, Nikon Instruments BV) using an ex 488 laser and em filter 525 / 50. Measurements were recorded using a 10x 0.45 CFI plan Apo lambda (Nikon, NikonInstruments BV) objective with a sCMOS camera PCO edge 4.2m. Imaging of the entire IHC section for cell counting was performed using the tiled scan acquisition function. The Grid / Collection stitching plugin in Fiji was then used 51 Stitching tile scans. For time-lapse movies, Z stacks of tile scans were recorded. After stitching as for cell counting, maximum Z projections were created and the Z-projected time stacks were used for global visualization of cell migration. Cropped regions were created using Fiji and saved as uncompressed AVI files. AVI files were converted to mp4 format using Handbrake software to generate supplementary movies.

[0105] To generate the plots and present the images, the “crop” function was used, and the maximum / minimum levels were changed using the “brightness / contrast” function of Fiji.

[0106] Example 8: Cell density quantification

[0107] Manual counting of GFP migrating into brain organoid fusions using the Fiji “Cell Counter” plugin - GFP in target site + Number of cells. Use the ROI tool to outline GFP in organoid fusions - The area of ​​the cells was calculated using the "measure" function. The cell count was divided by the area to determine the number of GFP cells that had migrated. + The density of cells. For the migration time course ( Figure 2 E) and organoid fusion mixture ( Figure 3 B, C) experiments, quantification was performed using confocal tile scans of tissue cryosections. For long-term slice culture experiments ( Figure 6 D, E), using GFP - Wide field 5x images of sites were counted.

[0108] Example 9: Statistics

[0109] All graphs and statistical analyses were generated using Prism 7 (GraphPad). Figure 1 C, 6E), unpaired two-tailed Student's t test was performed, and for the remaining data comparing multiple groups, one-way ANOVA with Tukey post hoc test was used ( Figure 2 F, 3C). Samples were tested for normality before testing for statistical significance. No statistical methods were used to predetermine sample size. The sample size for the experiment was estimated based on experience with similar settings that had previously shown significance. The experiment was not randomized, and the investigators were not blinded.

[0110] Primary Antibody

[0111]

[0112]

[0113] Secondary Antibodies

[0114]

[0115]

[0116] qPCR primers

[0117]

[0118] Example 10: Enhanced generation of ventral forebrain identity through pharmacologically patterned differentiation of brain organoid tissue.

[0119] The brain organoid method (WO2014 / 090993, Lancaster et al., both Lancaster & Knoblich, both supra) is able to generate many different brain sites, including the dorsal and ventral forebrain. However, due to its reliance on intrinsic patterning, the generation of some sites is variable and infrequent, especially the more ventral (NKX2-1+) interneuron progenitor sites. To increase the consistency and yield of ventral forebrain interneuron progenitor sites, we included ventral drug treatment ( Figure 1 A). We utilized a combination of WNT inhibition and enhanced SHH signaling to promote rostral-ventral forebrain identity. qPCR analysis of ventral organoids revealed a significant increase in the expression of the forebrain marker FOXG1 ( Figure 1 B, C). The dorsal forebrain marker TBR1 became undetectable in ventral organoids compared to control organoids, whereas the ventral forebrain marker DLX2 was significantly increased ( Figure 1To further confirm successful ventralization of brain organoid organization, we examined the expression of markers specific to subregions of the ventral forebrain ganglionic eminence (GE) that give rise to distinct subtypes of interneurons. GSX2 is expressed in the dorso-lateral GE (LGE) and caudal GE (CGE), NKX2-1 is expressed in the ventro-medial GE (MGE), and LHX6 is expressed in a subregion of the MGE that gives rise to the more ventrally derived MGE (vMGE) interneurons ( Figure 1 B). GSX2 expression is observed in control organoids but is further increased in ventral organoids ( Figure 1 C). Expression of NKX2-1 and LHX6 was undetectable in control organoids but greatly increased in ventral organoids ( Figure 1 C). Finally, immunostaining confirmed the qPCR results, showing that FOXG1 was ubiquitously expressed in both control and ventral organoids, but only ventral organoids expressed the ventral forebrain marker NKX2-1 ( Figure 1 D). Interestingly, control organoids broadly expressed dorsal forebrain markers for both progenitor neurons (PAX6) and early-generation neurons (TBR1). Figure 1 E) In contrast, ventral organoids only contain PAX6 + or TBR1 + Small parts of tissue ( Figure 1 E). Thus, these results confirm that ventral drug treatment successfully generates ventral brain organoids at the expense of dorsal tissue.

[0120] Example 11: Fusion of brain organoid tissue recapitulates the continuous dorsal-ventral forebrain axis and long-distance cell migration.

[0121] To reconstruct a complete dorsal-ventral identity axis in a single tissue, we developed an organoid-tissue co-culture method that we refer to as organoid “fusion.” Control organoids primarily produced dorsal forebrain tissue ( Figure 1 C, E). However, inhibition of SHH activity with the smoothened receptor inhibitor cyclopamine A (CycA) can enhance dorsal forebrain identity in 2D neuronal differentiation from hPSCs. Therefore, to support dorsal identity, organoids were treated with CycA during the neural induction step of the brain organoid protocol ( Figure 2 A). In this method, embryoid bodies (EBs) are individually differentiated and patterned into dorsal (CycA) or ventral (IWP2+SAG) forebrain organoids ( Figure 2 A, B). After differentiation treatment, ventral and dorsal EBs were embedded together in a single Matrigel droplet ( Figure 2 A), and over time, the organoids grew together and fused ( Figure 2B). Immunostaining of fused ventral::dorsal organoids shows the generation of a continuous organization where one side is highly positive for the ventral marker NKX2-1, while the other side is positive for the dorsal marker TBR1 ( Figure 2 C) Thus, the organoid fusion approach allows for the juxtaposition of dorsal and ventral forebrain sites in an arrangement similar to that which occurs during brain development.

[0122] To test whether cells can migrate between confluent organoids, we used a cell line containing a ubiquitous GFP reporter to create the ventral / GFP + ::Dorsal organoid fusion. Immunofluorescence analysis showed GFP - Many GFPs from ventral organoids are present in dorsal organoids + cell( Figure 2 D). A small number of migrating cells were observed around day 30 ( Figure 2 D, E). Their density increased dramatically from day 30 to day 46, but no significant increase was observed from day 46 to day 80 ( Figure 2 E). Because organoid size increases with age, the absolute number of migrating cells must increase over time to maintain similar densities. Furthermore, in 80-day-old organoids, cells appear to be more dispersed throughout the dorsal region ( Figure 2 D). Therefore, based on these results, we will focus future analyses on organoids older than 60 days.

[0123] Example 12: Tissue components of mixed brain organoid bi-differentiation fusions demonstrate directed ventral to dorsal cortical cell migration.

[0124] During brain development in vivo, GABAergic interneurons originate in ventral forebrain progenitor sites, after which they migrate to their dorsal forebrain targets. To test whether this directional orientation is recapitulated in fused organoids, we varied the identities of their individual tissue components ( Figure 3 ). We consistently labeled one organoid with GFP and the other with tdTomato and profiled the fusions in an origin::target (GFP::tdTomato) arrangement. Using this paradigm, we analyzed the number of migrating cells when differentially controlling the dorsal / ventral identity of the origin and target sites of brain organoid fusions. Whole mount imaging of ventral::control and ventral::dorsal fusions showed that the expression of tdTomato + GFP in tissues + spot( Figure 3 A). In contrast, few spots were observed in control:control or dorsal:dorsal fusions ( Figure 3A). This difference was even more pronounced when analyzing immunostained cryosections of organoid fusion tissue. The greatest amount of migrating cells occurred in the ventral::control and ventral::dorsal fusions, while the least migration occurred in the dorsal::dorsal fusions ( Figure 3 B, C). Although the average density of migrating cells in ventral::control fusions was not significantly different from that in ventral::dorsal fusions, ventral::dorsal fusions more consistently contained a greater number of migrating cells ( Figure 3 C). These data confirm our initial observations of directionally biased migration from ventral to dorsal organoid tissues and strongly suggest that migration between fused organoids is analogous to interneuron migration. Finally, this experiment demonstrates that ventral::dorsal fused organoids produce the most robust migration between organoid tissues.

[0125] Example 13: GABAergic interneurons migrate between fused brain organoid tissues.

[0126] Since Example 12 suggested that migration in ventral::dorsal organoid fusions resembles interneuron migration, we first examined migrating GFP + Whether the cells express GAD1 (one of the key enzymes for synthesizing GABA) is used to test whether the migrating cells are GABAergic. Immunostaining shows that GFP that has migrated into the target organoid + Cells widely express GAD1 ( Figure 4 AC). Notably, when whole organoids were visualized, GAD1 was expressed in a manner similar to that of migrating GFP. + Cells express similar patterns ( Figure 4 A). In addition, GAD1 expression appears to be stronger near the edge of the organoids ( Figure 4 B) and away from the origin of the migrating cell. Thus, interneurons can migrate from ventral to dorsal sites within organoid fusions.

[0127] Another major population of tangentially migrating cells in the developing human brain are the non-GABAergic Cajal-Retzius cells. These cells are identified by their expression of Reelin (RELN). Therefore, we tested the migratory GFP expression in organoid fusions. + Surprisingly, despite the abundant presence of GFP in the dorsal target site of the organoid fusion, - 、RELN + cells, but we still observed GFP + The cells clearly lacked RELN expression ( Figure 4 D) Therefore, our data suggest that migratory GFP in organoid fusions +cells are not Cajal-Retzius cells and this, combined with our previous findings, strengthens their identity as GABAergic interneurons.

[0128] Finally, we tested whether migrating cells could give rise to mature neurons by analyzing the expression of the immature migrating neuron marker DCX and / or the mature neuron marker NeuN. We observed that GFP + Cells expressing DCX ( Figure 4 E), confirming their neuronal identity, and a subset also expressed NeuN ( Figure 4 E) This finding indicates that the migrating GFP + The cells are migratory neurons (DCX + ), and migratory neurons can also become mature neurons (DCX + / NeuN + ). Together, our results show that interneurons can migrate between fused ventral-dorsal organoids and can become mature neurons.

[0129] Example 14: Migrating interneurons in fused brain organoid tissues give rise to various LGE / CGE- and MGE-derived cortical interneuron subtypes.

[0130] Since the migrating GFP + Cells can become mature neurons ( Figure 4 E) and appear to be primarily GABAergic interneurons ( Figure 4 A, B), so we next tested which interneuron subtypes are produced. Interneurons are particularly heterogeneous, and a variety of molecular markers can be used to identify the various subtypes that arise from unique progenitor subpopulations within the ventral forebrain. In humans, most interneurons are derived from the NKX2-1 of the MGE. + We tested the migrating GFP + Do cells give rise to MGE-derived interneuron subtypes? In humans, SOX6 is expressed in the MGE and in both immature and mature interneurons that emerge from this site. In organoid fusions, we expressed GFP in + Migrating GFP + Cells (also GAD1 + GFP + Multiple SOX6 + MGE interneurons ( Figure 5A). Thus, MGE-derived interneurons can be generated in brain organoid fusions. To confirm this finding, we also examined the expression of markers for MGE-derived interneurons. We observed somatostatin (SOM) ( Figure 5 B) Neuropeptide Y (NPY) Figure 5 C), calcium binding protein D-28k (CB) ( Figure 5 D) and parvalbumin (PV) ( Figure 5 E). Thus, multiple MGE-derived interneuron subtypes can be generated in organoid fusion tissues.

[0131] The remaining interneurons in the human brain are derived from the LGE / CGE. Similar to SOX6 targeting the MGE, the transcription factors COUP-TFII / NR2F2 and SP8 can be used as LGE / CGE fate-localizing markers for cortical interneurons. SP8 ( Figure 5 F) and COUP-TFII( Figure 5 G) Both are from migrating GFP in organoid fusions + Interneurons (GAD1 + ) expression. As confirmation of this result, we also analyzed the expression of markers of LGE / CGE-derived subtypes. Our previous data have shown that migrating GFP + Cells lacking RELN expression ( Figure 4 ), in addition to non-interneuronal Cajal-Retzius cells, subsets of GABAergic MGE- and CGE-derived interneurons also express RELN. We also did not observe any GFP expressing vasoactive intestinal peptide (VIP) + However, we did observe calretinin (CR)-expressing GFP in organoid fusions. + VGAT interneuron + )( Figure 5 H). Together, these results demonstrate that organoid fusions contain a large and diverse number of interneuron subtypes that arise from major ventral forebrain subsites (MGE and LGE / CGE).

[0132] Example 15: Neuronal migration in fused brain organoid tissue resembles the tangential migration of cortical interneurons.

[0133] The migratory dynamics of tangentially migrating cortical interneurons have been extensively documented using time-lapse imaging experiments. This behavior is distinct from that of radially migrating cortical cells that move along radial glial fibers, or from that of linearly migrating cells, such as the chain migration observed in LGE-derived olfactory bulb interneurons. + To determine whether the cells behaved similarly to cortical interneurons, we examined migrating GFP in ventral-dorsal organoid fusion slice cultures. + Time-lapse recording of cells ( Figure 6 A) GFP can be easily expressed in organoid fusions + Ventral origin site and GFP - Dorsal target sites are distinguished ( Figure 6 A) Thus, we can easily visualize sparsely labeled GFP that has migrated into the dorsal organoid fusion site. + Cell morphology. Over the 3 days, we observed both quiescent cells and motile cells ( Figure 6 B), and surprisingly, we also observed dynamic neuronal processes resembling axons that extend long distances ( Figure 6 C). Remarkably, migratory cells exhibit dynamics that are exactly similar to those of migrating interneurons in the marginal zone (MZ) and intermediate zone (IZ) of embryonic mouse cortex. Migrating cells contain leading and trailing processes. Leading processes are often branched, and the direction of migration is determined by branch dynamics. For example, we observed multiple instances of cells that extended branches in the direction of future travel and retracted branches that were extended in the alternating direction ( Figure 6 B) In addition, cells migrated in multiple directions with frequent abrupt changes in direction, similar to the multidirectional wandering behavior exhibited by cortical interneurons migrating tangentially within the cortex.

[0134] The chemoattractant SDF-1 (CXCL12) and its receptor CXCR4 regulate tangential migration of interneurons. To test whether the migration we observed in brain organoid fusions was dependent on CXCR4, we created long-term slice cultures of organoid fusions treated with the CXCR4 antagonist AMD3100. Compared to untreated control slices prepared from the same organoid fusions, AMD3100 treatment increased the migration of GFP to GFP. - GFP migrating in the dorsal region + The density of cells was significantly reduced. Therefore, cell migration in brain organoid fusions is dependent on CXCR4 activity. Combined with our previous data, this result confirms that the cell migration observed in brain organoids is consistent with cell migration of interneurons that are migrating tangentially.

[0135] Observations:

[0136] Migrating GFP was observed in the dorsal part of the ventral / GFP::dorsal organoid fusion. + Cells. The observed cells migrated in a single direction. The leading process was branched, with different branches appearing to dynamically extend and retract independently of each other. As the cell body moved forward, the trailing process followed, and the leading process became the trailing process multiple times. As the cell moved forward, one leading process extended while the remaining process retracted. The entire dynamic cycle of migration then repeated itself as the cell progressed forward.

[0137] Cells that exhibit many changes in direction (dynamic extension and retraction involving several processes) were observed. When the cell body remains static, branches extend in multiple directions, and then each main branch extends additional higher-order branches. Finally, a branch is extended in a specific direction, and then another main branch is retracted. The cell body then moves in the direction of the extended branch. When the cell decides the direction of migration, the cycle is repeated.

[0138] Multiple migrating cells were observed. 1) Initially, the cell was migrating upward. The upward process retracted as the new leading process extended downward and became a branch. The cell migration direction then changed to downward. The bifurcated leading process is dynamic, so that one process extends as the other process retracts. The cell body then moves toward the extended leading process. Prior to nucleokinesis, a swelling was observed, moving from the cell body into the proximal portion of the leading process. The cell body then moved parallel to the swelling, and finally the cell body moved into the swelling. 2) The second cell migrated and changed direction several times. With each change in direction, the trailing process became the leading process. As the trailing process retracted, the new leading process extended toward the direction of travel.

[0139] Multiple cells were observed migrating in different directions with extension and retraction processes. Starting at about 45 hours of observation, one cell migrated in a constant direction and advanced rapidly, but at about 70 hours, progress slowed as the guidance process branched.

[0140] Multiple migrating cells were observed. About 6 hours after the start of observation, the cells migrated with a branched leading process. Three branches were observed multiple times. As the cell progressed forward, branches extended in the direction of travel while other branches retracted. About 23 hours, the cell suddenly changed direction. This involved the extension of a new process while the previous leading process retracted. At about 39 hours, the leading process began to turn, then made a 180-degree turn and then extended. The cell body then followed the leading process.

[0141] Neurites were observed and they appeared to have axons with enlarged clusters at the end of the process, similar to those of growth cones. The processes were highly dynamic and exhibited extension in a single direction, but also abrupt changes in direction.

[0142] Example 16: Cell migration assay

[0143] We developed a cell migration assay using fused brain organoids. Ventral-dorsal organoid fusions exhibited robust long-distance cell migration, similar to that of ventral forebrain-derived cortical inhibitory interneurons. We observed substantially more migration from ventral to dorsal forebrain sites in brain organoid fusions. Migrating cells within organoid fusions expressed GABAergic markers (GAD1 / VGAT). Migrated GFP + Cells can generate multiple interneuron subtypes. In addition, migrating GFP + The lack of RELN expression in cells supports the ventral forebrain-derived interneuron identity. + The migration dynamics of the cells are similar to the characteristic migration behavior exhibited by tangentially migrating interneurons in the cortex. Finally, CXCR4 inhibition inhibits cell migration in organoid fusions, as observed for tangentially migrating interneurons in the developing mouse cortex. In summary, we have recapitulated the migration of ventral human cortical interneurons in the dorsal forebrain site. In addition, the observation that these cells exhibit both immature and mature neuronal markers indicates that they undergo the ability to mature once they reach their dorsal cortical forebrain target site. This represents an exciting opportunity to recreate developing human cortical circuits containing an enhanced full set of cell diversity compared to what was possible in previous single organoid approaches.

[0144] An exciting application of this technology is to study human developmental biology and its relationship to neurological diseases. With this in mind, when characterizing this assay, we proposed different experimental paradigms, each of which can be used to study various aspects and scientific questions related to neuronal cell migration. For example, labeling cells within one of the fused organoids with a fluorescent reporter allows visualization of long-distance neuronal migration. This can even be continuously monitored over time by whole-mount imaging of intact organoid fusions. In addition, the identity of the cells can be easily checked using immunostaining to identify neuronal subtypes. This is useful because many psychiatric diseases (such as schizophrenia) are believed to involve selective defects in specific interneuron subpopulations (Lewis Current Opinion in Neurobiology 26, 22–26 (2014)). The second type of analysis is to dissect the role of specific molecules in neuronal migration to determine whether they act in a cell-autonomous or cell-non-autonomous manner. For example, using the bi-differentiated tissues of the present invention, organoids from the origin or target of migration can be genetically manipulated independently by deriving the origin and target organoids from unique cell lines containing mutant or wild-type alleles of the gene of interest.

[0145] We also propose an organoid fusion slice culture paradigm, in which confocal time-lapse imaging can be used to analyze the short-term dynamics of neuronal cell migration. This is an important tool because some molecules (such as GABA) affect the movement of migrating interneurons, which can produce subtle phenotypes in long-term migration assays, and therefore require higher time resolution analysis of the dynamics of migrating cells instead. In addition, long-term slice cultures can be used to test how different drug treatments can affect cell migration. This allows drug screening to determine the effects of many different molecules on cell migration.

[0146] Finally, the fused organoid tissue also presents unique applications beyond cell migration. As a further example, we observed a large number of neurite dynamics with the appearance of axonal projection. In addition, although we are particularly focused on ventral-dorsal forebrain fusions, the organoid fusion paradigm allows the flexibility of brain site identity that can be cultured together. Combined with other brain site-specific organoid schemes (Jo et al. Stem Cell 19, 248–257 (2016); Hockemeyere et al. Nat. Biotechnol. 27, 851–857 (2009); Preibisch et al. Bioinformatics 25, 1463–1465 (2009)), the possible brain circuits that can be modeled using organoid fusions are huge. Therefore, organoid fusion technology greatly enhances the possible phenotypic analysis in brain organoids, and the flexibility of the method greatly expands the future development of in vitro models of human nervous system diseases.

Claims

1. An in vitro method for producing a bi-differentiated or multi-differentiated tissue having at least two tissue types, comprising the following steps: providing a first tissue developed to a differentiation stage of interest; providing a second tissue developed to a differentiation stage of interest different from the differentiation stage of interest of the first tissue; placing the first and second tissues in sufficient proximity to fuse by growth; allowing the first and second tissues to grow and fuse with each other; Thereby a bi-differentiated or multi-differentiated tissue is produced comprising said first and second tissues having different differentiation stages; preferably, wherein said first and / or second tissue, in particular both, are derived from an in vitro culture of pluripotent stem cells, in particular induced pluripotent stem cells.

2. The method of claim 1, comprising developing the first tissue to a differentiation stage of interest separately from developing the second tissue to a different differentiation stage of interest.

3. The method of claim 1 or 2, wherein at least the first and / or second tissue comprises neuronal tissue, preferably neural progenitor cells and neurons.

4. The method of claim 3, wherein the differentiation stage of the first tissue comprises ventral forebrain progenitor tissue or rostro-ventral forebrain tissue.

5. The method of claim 3 or 4, wherein the differentiation stage of the second tissue comprises dorsal forebrain tissue or neuroectoderm that has not differentiated into ventral or dorsal forebrain.

6. The method of any one of claims 1 to 5, wherein the steps of placing the first and second tissues in sufficient proximity to fuse by growth and allowing the first and second tissues to grow and fuse with each other are performed in suspension culture.

7. The method of any one of claims 1 to 6, wherein the bi-differentiated or multi-differentiated tissue is differentiated to form a neural plate.

8. The method according to any one of claims 1 to 7, wherein the first and second tissues are cultured to a size of at least 100 μm, preferably at least 150 μm, particularly preferably at least 200 μm.

9. The method of any one of claims 1 to 8, wherein the first and / or second tissue expresses a detectable marker that is not expressed by the other one from the group of the first and second tissues.

10. Bi- or multi-differentiated tissue obtainable by the method of any one of claims 1 to 9.

11. A bi- or multi-differentiated tissue having at least two tissue types at different stages of differentiation, wherein at least one of the tissue types comprises ventral neuronal tissue and at least another tissue type is substantially non-ventral but contains migratory cells from the ventral neuronal tissue, which migratory cells account for no more than 5% of the cells of the substantially non-ventral tissue, and the bi- or multi-differentiated tissue has a size of 100 μm to 10 mm in its longest dimension.

12. The bi- or multi-differentiated tissue of claim 11, wherein at least one of said tissue types expresses a detectable marker, preferably a fluorescent marker, which is not expressed by another tissue type of said bi- or multi-differentiated tissue.

13. The bi-differentiated or multi-differentiated tissue of any one of claims 10 to 12, in the form of a spheroid or in the form of a tissue section.

14. A method for testing or screening candidate compounds that affect the differentiation of bi-differentiated or multi-differentiated tissues, comprising contacting the cell or tissue of any one of the methods of claims 1 to 9 with the candidate compound or contacting the tissue of any one of claims 10 to 13 with the candidate compound, and maintaining the contacted tissue in culture, and observing any differentiation changes in the tissue compared to the tissue not contacted with the candidate compound.

15. A kit for providing a tissue culture according to any one of claims 1 to 9, comprising a ventral differentiation inducer and a dorsal differentiation inducer, preferably a WNT inhibitor and / or a SSH enhancer as the ventral differentiation inducer and preferably a SSH inhibitor as the dorsal differentiation inducer.

Images