A set of wheat snp loci markers and application in identification of seedling root biomass
By designing and applying KASP markers for SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP, the challenges in seedling root biomass identification and breeding were solved, achieving efficient molecular marker-assisted selection and improving wheat breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-12
- Publication Date
- 2026-03-24
AI Technical Summary
Existing technologies struggle to effectively utilize molecular markers to assist in the selection of superior root wheat varieties, especially in the identification and breeding of root biomass during the seedling stage, where a lack of tightly linked markers leads to low breeding efficiency.
We designed and applied a set of KASP markers for SNP loci Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP. By detecting the haplotypes of these SNP loci, we identified and screened wheat with high root biomass at the seedling stage, thus assisting in wheat genetic breeding.
It improves the efficiency of wheat breeding and selection, enabling rapid and accurate identification and screening of wheat varieties with high root biomass, and has significant genetic effects and application prospects.
Smart Images

Figure BDA0005040104050000061 
Figure BDA0005040104050000071 
Figure BDA0005040104050000072
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of molecular detection technology and crop genetic breeding, and relates to a set of wheat SNP site markers and application in seedling stage root biomass identification. BACKGROUND
[0002] Roots are important organs for absorption, fixation and support of wheat, and excellent root architecture is the basis for high efficient utilization of water and nutrients (Atkinson et al. 2015). Root architecture is mainly determined by root length, diameter, branching and surface area, for example, root length affects water absorption, and root number, root diameter and root surface area affect nutrient absorption (Meister et al. 2014; Courtois et al. 2009), and root biomass affects the balance between aboveground and root biomass, and further affects yield (Bettembourg et al. 2017; Cormier et al. 2016). However, root phenotypes are not easy to obtain, and genetic and physiological researches are relatively less, which greatly hinders the genetic research of root architecture. Identification of root architecture at the adult stage causes great damage to roots, and the flux is low, which is not suitable for genetic analysis of populations. Identification of root architecture at the seedling stage has the characteristics of being fast, simple and highly related to the adult stage, and can well reflect the root architecture and root group distribution at the adult stage. Seedling root trait investigation has methods such as nutrient solution method (Ayalew et al. 2017), gel chamber method (Christopher et al. 2013), paper culture method (Bai et al. 2013), sand culture method (Hamada et al. 2012) and soil culture method (Cao et al. 2014). These methods have small errors and simple operation, and have high flux and small sampling damage, and can quickly determine the root architecture of wheat by combining with digital image analysis software.
[0003] Molecular markers controlling root traits are the prerequisite for assisted selection of excellent root wheat varieties. Using molecular markers closely linked to wheat seedling root-related genes or QTLs for assisted selection can greatly improve breeding selection efficiency, which is of great significance for improving and cultivating excellent root wheat varieties. Wheat root-related traits are complex quantitative traits controlled by multiple genes with small effects. Linkage analysis based on parent-offspring population and association analysis of natural population are common research methods for mining important genes. At present, with the in-depth application of molecular marker technology in wheat breeding, the positioning of root-related genes / QTLs has made some progress. Li et al(2020) identified 8 root traits of seedlings using RIL population, and obtained 18 related QTLs with a phenotypic contribution rate of 3.27% to 11.75%. Liu et al(2019) used a natural population of 165 wheat materials to obtain 32 stable seedling root-related QTLs located on chromosomes 1B, 2D and 4A, which can explain 8.80%-15.60% of the phenotypic variation. Although some QTLs related to wheat seedling root have been located, few closely linked markers have been reported in molecular breeding.
[0004] Molecular marker-assisted selection technology can track root genes for breeding and provide an effective technical means for cultivating wheat varieties with excellent root systems. Therefore, further mining of functional markers for wheat seedling root identification and using the markers to screen wheat varieties with excellent seedling root traits can provide molecular assisted selection means for breeding high-yield and stable-yield wheat varieties with excellent quality. SUMMARY
[0005] The technical problem solved by the present application is to use a set of SNP sites to design KASP markers to identify and assist in screening wheat varieties with high seedling root biomass.
[0006] To solve the above technical problems, in a first aspect, the present application provides a substance for detecting the haplotype of four SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome for use in any one of the following:
[0007] Alternatively, a substance for detecting the haplotype of any one of the four SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome for use in any one of the following:
[0008] A1) identifying or assisting in identifying wheat root biomass;
[0009] A2) screening or assisting in screening wheat with high root biomass;
[0010] A3) Breed wheat varieties with high root biomass;
[0011] A4) Wheat genetics and breeding;
[0012] The SNP site Ta-1B-SNP is the 83rd position of SEQ ID NO:1;
[0013] The SNP site Ta-2A-SNP is the 92nd position of SEQ ID NO:2;
[0014] The SNP site Ta-5D-SNP is the 59th position of SEQ ID NO:3;
[0015] The SNP site Ta-6A-SNP is the 41st position of SEQ ID NO:4.
[0016] In the above-described application, the root biomass can be the root biomass during the seedling stage.
[0017] In the above-described application, the root biomass is specifically reflected in the root dry weight.
[0018] In the application described above, the SNP site Ta-1B-SNP has a haplotype of AA or CC;
[0019] The SNP site Ta-2A-SNP has a haplotype of AA or GG;
[0020] The SNP site Ta-5D-SNP has a haplotype of GG or AA;
[0021] The SNP site Ta-6A-SNP has a TT or CC haplotype.
[0022] In the applications described above, the substance is B1) or B2):
[0023] B1) Primer set;
[0024] B2) PCR reagents or kits containing the complete set of primers described above;
[0025] The primer set includes primer F, primer H and primer C;
[0026] The nucleotide sequence of primer F includes the sequence shown in SEQ ID NO: 5, positions 22-43, or SEQ ID NO: 8, positions 22-42, or SEQ ID NO: 11, positions 22-41, or the sequence shown in SEQ ID NO: 14, positions 22-43.
[0027] The nucleotide sequence of primer H includes the sequence shown in positions 22-43 of SEQ ID NO: 6, positions 22-42 of SEQ ID NO: 9, positions 22-41 of SEQ ID NO: 12, or positions 22-43 of SEQ ID NO: 15;
[0028] The nucleotide sequence of primer C is SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 13, or SEQ ID NO: 16.
[0029] In the applications described above, the nucleotide sequence of primer F is the sequence shown in SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, or SEQ ID NO: 14;
[0030] The nucleotide sequence of primer H is the sequence shown in SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, or SEQ ID NO: 15.
[0031] The above application can be used to detect the following four SNP sites in the wheat genome: Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP haplotypes. The root biomass (specifically, root dry weight) of wheat carrying aggregated SNP sites is greater than or can be greater than the root biomass of wheat carrying non-aggregated SNP sites.
[0032] The wheat carrying aggregated SNP sites is wheat in which at least two of the four SNP sites, namely Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, are dominant haplotypes.
[0033] The wheat carrying non-aggregated SNP sites is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites are all non-dominant haplotypes, or wheat in which only one of the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites is a dominant haplotype, and the haplotypes of the other three SNP sites are all non-dominant haplotypes.
[0034] The dominant haplotype of the Ta-1B-SNP site is AA, and the non-dominant haplotype of the Ta-1B-SNP site is CC;
[0035] The dominant haplotype of the Ta-2A-SNP site is AA, and the non-dominant haplotype of the Ta-2A-SNP site is GG;
[0036] The dominant haplotype of the Ta-5D-SNP site is GG, and the non-dominant haplotype of the Ta-5D-SNP site is AA;
[0037] The dominant haplotype of the Ta-6A-SNP site is TT, and the non-dominant haplotype of the Ta-6A-SNP site is CC.
[0038] The above application can be used to detect the haplotype of any of the following four SNP sites in the wheat genome: Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP. The root biomass of wheat carrying the dominant haplotype of a certain SNP site is greater than or can be greater than that of wheat carrying the non-dominant haplotype of that SNP site.
[0039] In a second aspect, the present invention provides any of the following substances:
[0040] The primer set described in the first aspect;
[0041] Alternatively, PCR reagents or kits containing the primer set described in the first aspect.
[0042] The PCR reagents include primers F, H, and C, and KASP Master mix (LGC Biosearch, KBS-1050-122).
[0043] The molar ratio of primer F, primer H, and primer C is 1:1:2.5.
[0044] In the embodiments of this aspect, the concentration of primer F in the PCR reagent is 168 nM, the concentration of primer H in the PCR reagent is 168 nM, and the concentration of primer C in the PCR reagent is 420 nM.
[0045] Each SNP site detection corresponds to a PCR reagent, and the corresponding primers for detecting that SNP site are primer F, primer H, and primer C.
[0046] Thirdly, the present invention provides the use of the primer sets, PCR reagents, or kits described in the second aspect in any of the following:
[0047] A1) Identification or auxiliary identification of wheat root biomass;
[0048] A2) Screening or assisted screening of wheat with high root biomass;
[0049] A3) Breed wheat varieties with high root biomass;
[0050] A4) Wheat genetics and breeding.
[0051] Fourthly, the present invention provides the following method C1 or C2:
[0052] C1. A method for identifying or assisting in the identification of wheat root biomass, comprising the following steps: detecting the haplotypes of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome, wherein the root biomass of wheat carrying aggregated SNP sites is greater than or candidate greater than that of wheat carrying non-aggregated SNP sites.
[0053] The wheat carrying aggregated SNP sites is wheat in which at least two of the four SNP sites, namely Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, are dominant haplotypes.
[0054] The wheat carrying non-aggregated SNP sites is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites are all non-dominant haplotypes, or wheat in which only one of the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites is a dominant haplotype, and the haplotypes of the other three SNP sites are all non-dominant haplotypes.
[0055] The dominant haplotype of the Ta-1B-SNP site is AA, and the non-dominant haplotype of the Ta-1B-SNP site is CC;
[0056] The dominant haplotype of the Ta-2A-SNP site is AA, and the non-dominant haplotype of the Ta-2A-SNP site is GG;
[0057] The dominant haplotype of the Ta-5D-SNP site is GG, and the non-dominant haplotype of the Ta-5D-SNP site is AA;
[0058] The dominant haplotype of the Ta-6A-SNP site is TT, and the non-dominant haplotype of the Ta-6A-SNP site is CC.
[0059] C2. A method for identifying or assisting in the identification of wheat root biomass, comprising the following steps: detecting any haplotype among SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome, wherein the root biomass of wheat carrying the dominant haplotype of a certain SNP site is greater than or can be greater than that of wheat carrying the non-dominant haplotype of that SNP site.
[0060] The method described above, which detects the haplotype of each SNP site in the wheat genome, includes the following steps: using the wheat genome to be tested as a template, performing KASP reactions with the primers corresponding to each SNP site in the second aspect to obtain the haplotype of each SNP site.
[0061] Fifthly, the present invention provides a method for breeding wheat with high root biomass, comprising the following steps: breeding wheat carrying aggregated SNP sites as described in the fourth aspect.
[0062] The KASP reaction procedure described above is as follows:
[0063] Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s; annealing and extension at 61℃ for 60 s, 10 cycles, with a decrease of 0.6℃ per cycle; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, 32 cycles; 37℃ for 1 min, 37℃ for 1 s (scan fluorescence values for genotyping).
[0064] In the above text, the KASP reaction using PCR reagents was used to obtain the haplotype. The amplification products were detected using a Bio-RAD CFX96 real-time PCR instrument. The haplotype was obtained by the KASP reaction, and genotyping was performed based on the fluorescence data.
[0065] This invention, using marker / trait association analysis in 255 wheat germplasms from Shanxi Province, identified a set of SNP loci—Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP—that were significantly associated with wheat root traits. Corresponding KASP molecular markers were developed using these four SNP loci, and their application was further validated during breeding. Furthermore, the developed KASP markers exhibit good reproducibility and low cost, showing promising application prospects in marker-assisted selection and molecular design breeding of wheat root traits. Attached Figure Description
[0066] Figure 1 The relationship between the number of superior allelic variants and root dry weight under hydroponic conditions (A) and the relationship between different allelic variant aggregation types and root dry weight (B).
[0067] Figure 2 Comparison of wheat root systems of different aggregation grades (AC).
[0068] Figure 3 To illustrate the relationship between the number of superior allelic variations and root dry weight under soil culture conditions (A) and to compare root dry weight under hydroponic (B) and soil culture (C) conditions for different aggregation grades at different sites. Detailed Implementation
[0069] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0070] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0071] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0072] Root dry weight refers to the weight of the root system after water has been removed.
[0073] Example 1: Mining of root-stem weight-related SNP sites
[0074] I. Root system characteristics survey
[0075] Using 255 wheat varieties as materials, plump and uniformly sized seeds from each variety were selected, soaked in distilled water to absorb water and germinate. After the seeds showed signs of germination, they were cultured under two conditions: hydroponics: 20 seeds with consistent germination were placed in a petri dish for 6 days to promote germination, then placed in Hoagland nutrient solution (pH=6.0) for 14 days, with the nutrient solution changed every 3 days and continuous aeration by an oxygen pump (seedling stage). Soil culture: 20 seeds with consistent germination were sown in culture cups (7cm in diameter, 8cm in height) containing vermiculite and 100mL of water and cultured for 20 days (seedling stage). Both treatments were cultured in an artificial climate chamber with a light intensity of 500μmol m⁻²s⁻¹, humidity of 70%, and a photoperiod of 20℃ for 16h / 16℃ for 8h.
[0076] Three plants of each strain were selected and their phenotypic data, including taproot length, total root length, root surface area, root volume, root diameter, and number of root tips, were measured using a Microtek Scanmakeri 800plus root scanner and a Win-RHIZO system. The fresh weight of roots, stems and leaves, plants, roots, stems and leaves, and plants were also measured.
[0077] II. SNP Association Analysis and Mining of SNP Marker Sites Related to Root Weight
[0078] SNP genotyping was performed on 255 wheat varieties using a wheat 16K SNP chip, revealing 9793 SNP markers that differed among the 255 varieties. Genome-wide association analysis (GWAS) was conducted using a mixed linear model based on TASSEL 5.0, incorporating high-quality SNP markers, population structure, and phylogenetic relationships. At thresholds of P < 0.001 or log10(P) > 3, four SNP loci—Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP—were found to be significantly associated with root dry weight.
[0079] The Ta-1B-SNP site is located on chromosome 1B of the wheat genome and is the 83rd nucleotide of SEQ ID NO:1. This nucleotide is either A or C, and its haplotype is AA, CC, or AC.
[0080] The Ta-2A-SNP site is located on chromosome 2A of the wheat genome, and it is the 92nd nucleotide of SEQ ID NO:2. This nucleotide is either G or A, and its haplotype is GG, AA, or GA.
[0081] The Ta-5D-SNP site is located on chromosome 5D of the wheat genome and is the 59th nucleotide of SEQ ID NO:3. This nucleotide is either A or G, and its haplotype is AA, GG, or AG.
[0082] The Ta-6A-SNP site is located on chromosome 6A of the wheat genome, and it is the 41st nucleotide of SEQ ID NO:4. This nucleotide is either T or C, and its haplotype is TT, CC, or TC.
[0083] See Table 1 for detailed information on SNPs;
[0084] Table 1 shows the SNP locus information:
[0085]
[0086]
[0087] III. Genetic Effect Analysis of Root-Stem Weight-Related Loci
[0088] This invention utilizes significant SNP loci to analyze the genetic effects of markers on root traits, identifying four SNP markers with significant differences in different variant types: Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP. Analysis of the additive effects of these loci on root traits revealed that as the number of alleles at these four loci increases, the phenotypic value of the root trait also increases. Therefore, these SNP markers can be used to develop molecular markers for assisted selection to improve wheat root systems.
[0089] Example 2: Obtaining KASP marker-specific primers, establishing detection methods, and validating SNP sites in natural populations.
[0090] I. Development of KASP markers for sites associated with wheat root traits
[0091] Based on the design rules of KASP primers, KASP primers were designed for amplifying Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP sites. The KASP primers for each site consist of three primer sequences: primer F, primer H, and universal primer C (sequences are shown in Table 2).
[0092] Table 2 shows the KASP primer sequences.
[0093]
[0094] In the above text, GAAGGTGACCAAGTTCATGCT is the FAM fluorescent tag sequence carried at the 5' end of primer F, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent tag sequence carried at the 5' end of primer H.
[0095] Scatter plots based on KASP markers showed clustering of different germplasms along the X-(FAM) and Y-(HEX) axes. Genotypes were determined by detecting the fluorescence signal of the amplification products.
[0096] In the KASP primers for detecting the Ta-1B-SNP site:
[0097] If the amplification products of primers F and C only show the color of the FAM fluorescent tag and the strong FAM signal is concentrated in the lower right corner of the scatter plot, then the haplotype of the wheat Ta-1B-SNP site to be tested is AA homozygous.
[0098] If the amplification products of primers H and C only show the color of the HEX fluorescent tag, and the strong HEX signal is concentrated in the upper left corner of the scatter plot, then the haplotype of the wheat Ta-1B-SNP site to be tested is CC homozygous.
[0099] In the KASP primers for detecting the Ta-2A-SNP site:
[0100] If the amplification products of primers F and C only show the color of the FAM fluorescent tag and the strong FAM signal is concentrated in the lower right corner of the scatter plot, then the haplotype of the wheat Ta-2A-SNP site to be tested is AA homozygous.
[0101] If the amplification products of primers H and C only show the color of the HEX fluorescent tag and the strong HEX signal is concentrated in the upper left corner of the scatter plot, then the haplotype of the wheat Ta-2A-SNP site to be tested is GG homozygous.
[0102] In the KASP primers for detecting the Ta-5D-SNP site:
[0103] If the amplification products of primers F and C only show the color of the FAM fluorescent tag and the strong FAM signal is concentrated in the lower right corner of the scatter plot, then the haplotype of the wheat Ta-5D-SNP site to be tested is GG homozygous.
[0104] If the amplification products of primers H and C only show the color of the HEX fluorescent tag and the strong HEX signal is concentrated in the upper left corner of the scatter plot, then the haplotype of the wheat Ta-5D-SNP site to be tested is AA homozygous.
[0105] In the KASP primers for detecting the Ta-6A-SNP site:
[0106] If the amplification products of primers F and C only show the color of the FAM fluorescent tag and the strong FAM signal is concentrated in the lower right corner of the scatter plot, then the haplotype of the wheat Ta-6A-SNP site to be tested is TT homozygous.
[0107] If the amplification products of primers H and C only show the color of the HEX fluorescent tag, and the strong HEX signal is concentrated in the upper left corner of the scatter plot, then the haplotype of the wheat Ta-6A-SNP site to be tested is CC homozygous.
[0108] II. Establishment of a method for detecting the monogram of four SNP loci
[0109] 1. Extract the genomic DNA of wheat to be tested;
[0110] 2. Using the extracted DNA as a template, PCR amplification was performed using the KASP primers corresponding to each SNP site in Table 2;
[0111] The amplification process is as follows:
[0112] (1) Preparation of KASP primer working solution
[0113] The primers were diluted to 100 μM stock solutions, and then mixed with primer F (12 μL), primer H (12 μL), primer C (30 μL), and ddH2O (46 μL) to form the KASP-SNP Assay Mix working solution.
[0114] (2) KASP reaction system and procedure
[0115] The 10 μL reaction mixture for the 96-well plate consisted of: 5 μL KASP Master mix (LGC Biosearch, KBS-1050-122), 1.5 μL DNA template (approximately 60 ng), 0.14 μL KASP-SNP Assay Mix working solution, and 3.5 μL ddH₂O. The concentrations of F, H, and C in the reaction mixture were 168 nM and 420 nM, respectively.
[0116] The KASP reaction procedure is as follows:
[0117] Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s; annealing and extension at 61℃ for 60 s, 10 cycles, with a decrease of 0.6℃ per cycle; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, 32 cycles; 37℃ for 1 min, 37℃ for 1 s (scan fluorescence values for genotyping).
[0118] 3. Use the Bio-RAD CFX96 real-time PCR instrument to detect the amplification products and perform genotyping based on the fluorescence data.
[0119] The detection results of Ta-1B-SNP sites are as follows: If the fluorescence signal of the amplified product is a FAM fluorescent tag sequence on the X-axis, then the base of the wheat Ta-1B-SNP site to be tested is A, and the haplotype is AA; if the fluorescence signal of the amplified product is a HEX fluorescent tag sequence on the Y-axis, then the base of the wheat Ta-1B-SNP site to be tested is C, and the haplotype is CC.
[0120] The detection results of Ta-2A-SNP sites are as follows: If the fluorescence signal of the amplified product is a FAM fluorescent tag sequence on the X-axis, then the base of the wheat Ta-2A-SNP site to be tested is A, and the haplotype is AA; if the fluorescence signal of the amplified product is a HEX fluorescent tag sequence on the Y-axis, then the base of the wheat Ta-2A-SNP site to be tested is G, and the haplotype is GG.
[0121] The detection results of Ta-5D-SNP sites are as follows: If the fluorescence signal of the amplified product is a FAM fluorescent tag sequence on the X-axis, then the base of the wheat Ta-5D-SNP site to be tested is G, and the haplotype is GG; if the fluorescence signal of the amplified product is a HEX fluorescent tag sequence on the Y-axis, then the base of the wheat Ta-5D-SNP site to be tested is A, and the haplotype is AA.
[0122] The detection results of Ta-6A-SNP sites are as follows: If the fluorescence signal of the amplified product is a FAM fluorescent tag sequence on the X-axis, then the base of the wheat Ta-6A-SNP site to be tested is T, and the haplotype is TT; if the fluorescence signal of the amplified product is a HEX fluorescent tag sequence on the Y-axis, then the base of the wheat Ta-6A-SNP site to be tested is C, and the haplotype is CC.
[0123] Allele-specific marker KASP genotyping was performed on the wheat samples using forward primer F with FAM sequence tag, forward primer H with HEX sequence tag, and reverse primer C.
[0124] III. Application of SNP locus combinations in detecting wheat root traits
[0125] The SNP locus combination consists of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP loci.
[0126] Taking 255 natural populations as an example, the corresponding SNP site haplotypes were detected according to the method shown in section II above, and the KASP reaction and data analysis were performed using a Bio-RAD CFX96 real-time PCR instrument.
[0127] Table 3 shows the SNP haplotype statistics of 255 germplasm accessions and root biomass under hydroponic conditions.
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136] The results showed that wheat carrying the dominant haplotype AA at the Ta-1B-SNP site had 16.79% higher root biomass than wheat carrying the CC site; wheat carrying the dominant haplotype AA at the Ta-2A-SNP site had 16.75% higher root biomass than wheat carrying the GG site; wheat carrying the dominant haplotype GG at the Ta-5D-SNP site had 18.72% higher root biomass than wheat carrying the AA site; and wheat carrying the dominant haplotype TT at the Ta-6A-SNP site had 16.24% higher root biomass than wheat carrying the CC site. Wheat carrying a dominant haplotype at four sites had 63.94% higher root biomass than wheat without a dominant haplotype and 40.58% higher root biomass than wheat carrying a dominant haplotype at one site. This indicates that the root dry weight of wheat carrying aggregated SNP sites is greater than, or potentially greater than, the root dry weight of wheat carrying non-aggregated SNP sites.
[0137] Wheat carrying aggregated SNP sites is wheat in which at least two of the four SNP sites (Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP) have a dominant haplotype; specifically, wheat in which two of the four SNP sites (Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP) have a dominant haplotype, or wheat in which three of the four SNP sites (Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP) have a dominant haplotype, or wheat in which all four of the four SNP sites (Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP) have a dominant haplotype.
[0138] Wheat carrying non-aggregated SNP sites is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites are all non-dominant haplotypes, or wheat in which only one of the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites is a dominant haplotype, and the haplotypes of the other three SNP sites are all non-dominant haplotypes.
[0139] The dominant haplotype of the Ta-1B-SNP site is AA, and the non-dominant haplotype is CC.
[0140] The dominant haplotype of the Ta-2A-SNP site is AA, and the non-dominant haplotype is GG.
[0141] The dominant haplotype of the Ta-5D-SNP site is GG, and the non-dominant haplotype is AA.
[0142] The dominant haplotype of the Ta-6A-SNP site is TT, and the non-dominant haplotype is CC.
[0143] Based on the effect analysis of aggregation sites on root biomass, the aggregation types of the sites are divided into three levels (I-III). Level I: Non-polymerized type, including wheat materials that do not contain a dominant haplotype or contain only one dominant haplotype among Ta-1B-SNP-AA, Ta-2A-SNP-AA, Ta-5D-SNP-GG, or Ta-6A-SNP-TT, which can be used to screen wheat materials with low root biomass; Level II: Wheat materials that polymerize two dominant haplotypes among Ta-1B-SNP-AA, Ta-2A-SNP-AA, Ta-5D-SNP-GG, or Ta-6A-SNP-TT, such as Ta-1B-SNP-AA and Ta-2A-SNP-AA polymerization or Ta-1B-SNP-AA and Ta-6A-SNP-TT polymerization, which can be used to screen wheat materials with medium root biomass; Level III: Wheat materials that polymerize 3-4 dominant haplotypes, such as Ta-1B-SNP-AA, Ta-2A-SNP-AA, and Ta-6A-SNP-TT polymerization, which can be used to screen wheat materials with high root biomass.
[0144] Table 4 shows the SNP site aggregation types.
[0145] Rank Ta-1B-SNP Ta-2A-SNP Ta-5D-SNP Ta-6A-SNP Root biomass Ⅰ - - - - Lower Ⅰ + - - - Lower Ⅰ - + - - Lower Ⅰ - - + - Lower Ⅰ - - - + Lower Ⅱ + + - - Medium Ⅱ + - + - Medium Ⅱ + - - + Medium Ⅱ - + + - Medium Ⅱ - + - + Medium Ⅱ - - + + Medium Ⅲ + + + - Higher Ⅲ + + - + Higher Ⅲ + - + + Higher Ⅲ - + + + Higher Ⅲ + + + + Higher
[0146] The analysis of the aggregation types of the above four SNP sites and their corresponding root trunk weights showed that:
[0147] Under hydroponic conditions, among the 255 materials, 6 wheat samples exhibited dominant haplotypes (all 4 SNP sites were dominant haplotypes), with an average root dry weight of 5.82 mg; 17 wheat samples exhibited dominant haplotypes (all 3 SNP sites were dominant haplotypes, and the other 1 SNP site was a non-dominant haplotype), with an average root dry weight of 5.59 mg; 139 wheat samples exhibited dominant haplotypes (both 2 SNP sites were dominant haplotypes, and the other 2 SNP sites were non-dominant haplotypes), with an average root dry weight of 4.56 mg; 62 wheat samples exhibited dominant haplotypes (one SNP site was dominant haplotype, and the other 3 SNP sites were non-dominant haplotypes), with an average root dry weight of 4.14 mg; and 31 wheat samples did not exhibit any dominant haplotypes (all 4 SNP sites were non-dominant haplotypes), with an average root dry weight of 3.55 mg. Furthermore, the root dry weight of wheat with agglomerated dominant units differed significantly from that of wheat without agglomerated dominant units. Figure 1 ,in Figure 1A represents the relationship between the number of dominant haplotypes and root dry weight under hydroponic conditions in 255 materials. Figure 1 B represents the relationship between different SNP aggregation types and root dry weight under hydroponic conditions, with + indicating dominant cell type and - indicating non-dominant cell type.
[0148] Figure 2 Comparison of wheat root systems of different aggregation grades (AC).
[0149] Under soil cultivation conditions, the average root dry weight of wheat with dominant haplotypes of four marker types was 12.42 mg; the average root dry weight of wheat with dominant haplotypes of three marker types was 12.05 mg; the average root dry weight of wheat with dominant haplotypes of two marker types was 11.03 mg; the average root dry weight of wheat with dominant haplotypes of one marker type was 10.50 mg; and the average root dry weight of wheat without dominant haplotypes was 9.00 mg. Furthermore, there was a significant difference in root dry weight between wheat with dominant haplotypes and non-dominant wheat materials. Figure 3 A, 0 indicates wheat without a dominant agglomerative unit type.
[0150] The above results indicate that the root dry weight of the tested wheat with multiple dominant site morphologies (Ta-1B-SNP-AA, Ta-2A-SNP-AA, Ta-5D-SNP-GG, and Ta-6A-SNP-TT) was significantly higher than that of the non-polymerized tested wheat.
[0151] The 255 samples were graded. The results showed that Grade I materials comprised 93 samples, with an average root dry weight of 3.94 mg under hydroponic conditions and 9.97 mg under soil conditions; Grade II materials included 139 wheat samples, with an average root dry weight of 4.56 mg under hydroponic conditions and 11.03 mg under soil conditions; and Grade III materials comprised 23 samples, with an average root dry weight of 5.62 mg under hydroponic conditions and 12.14 mg under soil conditions. The average root dry weight of Grade I materials was significantly lower than that of Grade II and Grade III materials. Figure 3 B and Figure 3 C).
[0152] This indicates that wheat of type III or II has a higher root biomass (specifically reflected in root dry weight) compared to wheat of type I.
[0153] Therefore, the root biomass of the wheat being tested can be identified by detecting the haplotypes and aggregation levels of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP.
[0154] The specific method is as follows:
[0155] The haplotypes of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in wheat were detected.
[0156] The root dry weight of wheat carrying polymeric SNP sites (Grade III or II) is greater than or candidate greater than the root dry weight of wheat carrying non-polymeric SNP sites (Grade I).
[0157] Among them, wheat carrying aggregated SNP sites is wheat whose haplotype is the dominant haplotype among at least two of the four SNP sites: Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP; specifically, wheat whose haplotype is the dominant haplotype among two of the four SNP sites: Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP (i.e., aggregated type). Grade II), or wheat with three of the four SNP sites (Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP) being the dominant haplotype (i.e., Grade III aggregation type), or wheat with all four of the four SNP sites (Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP) being the dominant haplotype (i.e., Grade III aggregation type).
[0158] Wheat carrying non-aggregated SNP sites is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites are all non-dominant haplotypes (i.e., aggregation type I); or wheat in which only one of the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites is a dominant haplotype, and the haplotypes of the other three SNP sites are all non-dominant haplotypes (i.e., aggregation type I).
[0159] The dominant haplotype of the Ta-1B-SNP site is AA, and the non-dominant haplotype of the Ta-1B-SNP site is CC.
[0160] The dominant haplotype of the Ta-2A-SNP site is AA, and the non-dominant haplotype of the Ta-2A-SNP site is GG.
[0161] The dominant haplotype of the Ta-5D-SNP site is GG, and the non-dominant haplotype of the Ta-5D-SNP site is AA.
[0162] The dominant haplotype of the Ta-6A-SNP site is TT, and the non-dominant haplotype of the Ta-6A-SNP site is CC.
[0163] Example 3: Application of SNP locus markers in breeding populations
[0164] The F1 generation of the cross between Lin 5726 (ZH588 / / Jinmai 919 / Yunhan 1818) and ZH119 [F5(Jinmai 919 / Linfen 5064) / / F3(ZH211 / Yunhan 1818)] was then self-crossed to obtain the F3 generation, and the application of SNP markers in the breeding progeny population was tested.
[0165] The population was genotyped using markers according to the method in Example 2, and PCR reaction and data analysis were performed using a Bio-RAD CFX96 real-time PCR instrument. The population was then graded according to the method in Example 2.
[0166] The results showed that there were 70 samples of Level I materials, 121 samples of Level II materials, and 42 samples of Level III materials.
[0167] The root system characteristics of the population were investigated and the root weight was measured using the method described in Example 1.
[0168] The root dry weight of wheat carrying polymeric SNP sites (Grade II or III) is greater than or candidate to be greater than the root dry weight of wheat carrying non-polymeric SNP sites (Grade I).
[0169] Analysis of the above genotyping results and their corresponding average root-to-stem weights showed that the root-to-stem weight of Grade I materials was significantly lower than that of Grade II and Grade III materials.
[0170] The above results indicate that wheat samples with polymeric site haplotypes (Ta-1B-SNP-AA, Ta-2A-SNP-AA, Ta-5D-SNP-GG, and Ta-6A-SNP-TT) (Grade III) have higher root biomass than wheat samples without polymeric dominant haplotypes (Grade I).
[0171] It is evident that the SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP, along with their aggregation type levels, can be used to rapidly identify whether the wheat being tested has a high root biomass.
[0172] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The detection of haplotypes of four SNP sites in the wheat genome, namely Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP, and Ta-6A-SNP, can be applied in any of the following ways: A1) Identification or auxiliary identification of wheat root biomass; A2) Screening or assisted screening of wheat with high root biomass; A3) Breed wheat varieties with high root biomass; A4) Genetic breeding of wheat root biomass; The SNP site Ta-1B-SNP is the 83rd position of SEQ ID NO:1; The SNP site Ta-2A-SNP is the 92nd position of SEQ ID NO:2; The SNP site Ta-5D-SNP is the 59th position of SEQ ID NO:3; The SNP site Ta-6A-SNP is the 41st position of SEQ ID NO:4; The SNP site Ta-1B-SNP has a haplotype of AA or CC; The SNP site Ta-2A-SNP has a haplotype of AA or GG; The SNP site Ta-5D-SNP has a haplotype of GG or AA; The SNP site Ta-6A-SNP has a TT or CC haplotype.
2. The application according to claim 1, characterized in that: The substance is either B1 or B2. B1) Primer set; B2) PCR reagents or kits containing the complete set of primers described above; The primer set includes primer F, primer H and primer C; The nucleotide sequences of primer F, primer H and primer C are SEQ ID NO: 5-7 or SEQ ID NO: 8-10 or SEQ ID NO: 11-13 or SEQ ID NO: 14-16.
3. A method for identifying or assisting in the identification of wheat root biomass, comprising the following steps: detecting the haplotypes of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome as described in claim 1, wherein the root biomass of wheat carrying aggregated SNP sites is greater than or candidate greater than that of wheat carrying non-aggregated SNP sites. The wheat carrying aggregated SNP sites is wheat in which at least two of the four SNP sites, namely Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, are dominant haplotypes. The wheat carrying non-aggregated SNP sites is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites are all non-dominant haplotypes, or wheat in which only one of the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP sites is a dominant haplotype, and the haplotypes of the other three SNP sites are all non-dominant haplotypes. The dominant haplotype of the Ta-1B-SNP site is AA, and the non-dominant haplotype of the Ta-1B-SNP site is CC; The dominant haplotype of the Ta-2A-SNP site is AA, and the non-dominant haplotype of the Ta-2A-SNP site is GG; The dominant haplotype of the Ta-5D-SNP site is GG, and the non-dominant haplotype of the Ta-5D-SNP site is AA; The dominant haplotype of the Ta-6A-SNP site is TT, and the non-dominant haplotype of the Ta-6A-SNP site is CC.
4. The method according to claim 3, characterized in that: The method for detecting the haplotype of each SNP site in the wheat genome includes the following steps: using the wheat genome to be tested as a template, performing KASP reaction with the primers corresponding to each SNP site in claim 2 to obtain the haplotype of each SNP site.
5. A method for breeding wheat with high root biomass, comprising the following steps: breeding wheat carrying aggregated SNP sites as described in claim 3 or 4.
Citation Information
Patent Citations
SNP label relevant to root characteristics in wheat seedling stage and application
CN107805673A
KASP label related to root system architecture at seedling stage of wheat and application of KASP label
CN109468406A