A synthetic lethal combination preparation for treating liver cancer and its application

Abstract

The present invention provides a synthetic lethal combination preparation for treating liver cancer and its application, belonging to the field of cell biology and medical technology. The present invention finds that low-dose iron intervention preparations or miR-122 inhibitors do not affect the activity of liver cancer cells when used alone, but the combination of the two can cause significant death of liver cancer cells. In addition, the present invention also finds that low-dose iron intervention preparations do not cause the death of normal liver cells, but can cause the death of miR-122-deficient liver cells, and the greater the dose of iron intervention preparations, the more miR-122-deficient cells die. This phenomenon shows that iron intervention preparations and miR-122 deletion / inhibition have synthetic lethal effects and have significant application prospects in the treatment of liver cancer.

Description

Technical Field

[0001] The present invention belongs to the field of cell biology and medical technology, and in particular relates to a synthetic lethal combination preparation for treating liver cancer and application thereof. Background Art

[0002] Synthetic lethality is a cell death phenomenon caused by the simultaneous inactivation of two non-lethal genes. The synthetic lethal effect has become a promising strategy for the development of anti-cancer drugs. Synthetic lethality can be used to selectively combine mutated or inactivated genes in cancer cells, thereby killing cancer cells without affecting non-cancerous cells, thereby reducing treatment side effects. However, finding synthetic lethal gene and drug combinations is difficult. Although there are many algorithm-based methods for predicting synthetic lethal combinations, the success rate has been low in verification. Currently, there are still a shortage of effective synthetic lethal combinations, which seriously hinders the development of cancer therapeutics.

[0003] miR-122 is a 22-base microRNA (microRNA) with a variety of biological functions in the body. Studies have shown that compared with normal liver tissue, the expression of miR-122 in liver cancer tissue is significantly decreased, and restoring miR-122 has an inhibitory and therapeutic effect on liver cancer, which shows that miR-122 has the characteristics of a tumor suppressor gene in liver cancer. Iron is an essential trace element for cells. Iron deficiency leads to cell proliferation stagnation and even death, while excessive iron can also cause an increase in intracellular oxidative free radicals, leading to cell death. However, there are no relevant studies reporting whether iron and miR-122 have a synthetic lethal effect. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a synthetic lethal combination preparation for the treatment of liver cancer and its application. The present invention combines an iron intervention preparation with a miR-122 inhibitor to cause significant death of liver cancer cells, indicating that the iron intervention preparation and miR-122 have a synthetic lethal effect, providing a new direction for the development of liver cancer treatment drugs.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a synthetic lethal combination preparation for treating liver cancer, which comprises an independently packaged iron intervention preparation and a miR-122 inhibitor.

[0007] Preferably, the iron intervention preparation is Holo-Tf.

[0008] Preferably, the sequence of the miR-122 inhibitor is shown as SEQ ID NO.1.

[0009] The present invention also provides the use of the synthetic lethal combination preparation in preparing an agent for inhibiting the activity of liver cancer cells.

[0010] Preferably, the liver cancer cells are Huh7 cells.

[0011] The present invention also provides the use of an iron intervention preparation in the preparation of a drug for treating liver cancer with loss of miR-122 expression, wherein the iron intervention preparation is Holo-Tf.

[0012] Compared with the prior art, the present invention has the following beneficial effects: the present invention provides a synthetic lethal combination preparation for treating liver cancer and its application. The present invention found that low-dose iron intervention preparations or miR-122 inhibitors used alone do not affect the activity of liver cancer cells, but the combination of the two can cause significant death of liver cancer cells. In addition, the present invention also found that the loss of miR-122 expression alone does not affect the activity of liver cells, but when the iron intervention preparation is used, the iron intervention preparation dose that does not cause the death of normal liver cells can cause the death of miR-122-deficient liver cells, and the greater the dose of the iron intervention preparation, the more miR-122-deficient liver cells die. Further analysis found that the lipid peroxidation damage caused by the iron intervention preparation in cells with miR-122 deficiency / inhibition was significantly increased, that is, the cells underwent ferroptosis, while the degree of lipid peroxidation caused by the iron intervention preparation in normal cells was relatively mild. This phenomenon shows that miR-122 deficiency / inhibition cells are highly sensitive to ferroptosis caused by iron intervention preparations, and iron intervention preparations and miR-122 deficiency / inhibition have synthetic lethal effects and have significant application prospects in the treatment of liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 miR-122 normal cells (miR-122 + / + ) and miR-122 knockout cells (miR-122 - / - ) Effects of different iron intervention concentrations on cell activity, where *** indicates significant difference, p < 0.01;

[0014] Figure 2 miR-122 normal cells (miR-122 + / + ) and miR-122 knockout cells (miR-122 - / - ) The MDA content of intracellular lipid peroxidation index in the blank control group and the iron intervention preparation group, where *** indicates significant difference, p < 0.01;

[0015] Figure 3Figure 3. Effects of adding 0-100 μmol / L transferrin-bound iron (Holo-Tf) to human hepatoma cell lines Huh7 transfected with nonsense sequences in the negative control group (NC) and miR-122 inhibitor group (Inhibitor). *** indicates significant differences, p < 0.01.

[0016] Figure 4 The MDA content, an indicator of intracellular lipid peroxidation, in the negative control group (NC) and the miR-122 inhibition group (Inhibitor) of human liver cancer cell Huh7 cells transfected with nonsense sequences was compared. *** indicates significant difference, p < 0.01. DETAILED DESCRIPTION

[0017] The present invention provides a synthetic lethal combination preparation for treating liver cancer, which comprises an independently packaged iron intervention preparation and a miR-122 inhibitor.

[0018] In the present invention, the iron intervention preparation is Holo-Tf, and the final concentration of the iron intervention preparation is 20-100 μmol / L; the sequence of the miR-122 inhibitor is as shown in SEQ ID NO.1, specifically: CAAACACCAUUGUCACACUCCA; the final concentration of the miR-122 inhibitor is 150-220 nmol / L, preferably 180-210 nmol / L, and more preferably 200 nmol / L.

[0019] The present invention also provides the use of the synthetic lethal combination preparation in preparing an agent for inhibiting the activity of liver cancer cells.

[0020] In the present invention, the liver cancer cells are Huh7 cells.

[0021] The present invention also provides the use of an iron intervention preparation in the preparation of a drug for treating liver cancer with loss of miR-122 expression, wherein the iron intervention preparation is Holo-Tf.

[0022] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0023] Example 1

[0024] Iron intervention and miR-122 knockout induce synthetic lethality in hepatocytes

[0025] (1) Hepatocytes were isolated from miR-122 wild-type mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) and miR-122 knockout mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.).

[0026] (2) The hepatocytes were placed in a low-glucose DMEM culture medium containing 10% fetal bovine serum and cultured in a 37°C, 5% carbon dioxide incubator for 24 hours.

[0027] (3) The cultured hepatocytes were seeded into a 96-well plate at a density of 8,000 cells per well and cultured in a 37° C., 5% carbon dioxide incubator.

[0028] (4) After 24 hours, Holo-Tf (purchased from BioGems, catalog number 10-366A) was added to the culture medium at final concentrations of 0, 20, 40, 60, 80, and 100 μmol / L, respectively, and the culture was continued.

[0029] (5) After 24 hours, the culture medium was replaced with new culture medium containing 10% CCK8 solution, and the cells were cultured in a 37°C, 5% carbon dioxide incubator for 2 hours. The absorbance was read at a wavelength of 450 nm using a microplate reader.

[0030] (6) The cell activity inhibition rate of each group was calculated with the blank control group (0 μmol / L Holo-Tf group) as 100%. The results are as follows Figure 1 shown.

[0031] Cell activity inhibition rate % = (absorbance of experimental group - background absorbance) / (absorbance of blank control group - background absorbance) * 100.

[0032] (7) The intracellular lipid peroxidation index MDA content in the blank control group (0 μmol / L Holo-Tf group) and the 60 μmol / L Holo-Tf group (iron intervention preparation group) was detected. The results are as follows: Figure 2 shown.

[0033] Depend on Figure 1 It can be seen that iron intervention preparations have an effect on miR-122 knockout hepatocytes (miR-122 - / - ) can significantly inhibit cell activity, and the greater the dose of iron intervention preparation, the more liver cells that die after miR-122 knockout. Figure 2 It can be seen that the lipid peroxidation damage caused by iron intervention preparations in miR-122 knockout hepatocytes was significantly increased, indicating that iron intervention preparations and miR-122 deficiency can produce synthetic lethality by inducing lipid peroxidation.

[0034] Example 2

[0035] Iron intervention and miR-122 inhibition induce synthetic lethality in hepatocellular carcinoma cells

[0036] (1) Human hepatoma cell line Huh7 (purchased from the Cell Bank of the Chinese Academy of Sciences in Shanghai) was seeded into a 96-well plate at a density of 4,000 cells per well and cultured in a 37°C, 5% CO2 incubator.

[0037] (2) Use after 24 hours Transfection reagent (purchased from POLYPLUS CO., LTD, catalog number 101000046) was used to transfect miR-122 inhibitor (specific sequence: CAAACACCAUUGUCACACUCCA) and nonsense sequence NC (negative control group, specific sequence of SEQ ID NO.2: CAGUACUUUUGUGUAGUACAA) at a final concentration of 200 nmol / L, and cultured in a 37°C, 5% carbon dioxide incubator for 24 hours.

[0038] (3) Holo-Tf was added to the culture medium at final concentrations of 0, 20, 40, 60, 80, and 100 μmol / L, respectively, and the culture was continued.

[0039] (4) After 24 hours, the culture medium was replaced with new culture medium containing 10% CCK8 solution, and the cells were cultured in a 37°C, 5% carbon dioxide incubator for 2 hours. The absorbance was read at a wavelength of 450 nm using a microplate reader.

[0040] (5) The cell activity inhibition rate of each group was calculated with the blank control group (0 μmol / L Holo-Tf group) as 100%. The results are as follows Figure 3 shown.

[0041] (6) The intracellular lipid peroxidation index MDA content in the blank control group (0 μmol / L Holo-Tf group) and the 60 μmol / L Holo-Tf group (iron intervention preparation group) was detected. The results are as follows: Figure 4 shown.

[0042] Depend on Figure 3 It can be seen that iron intervention preparations can significantly inhibit cell activity in miR-122-inhibited liver cancer cells (Inhibitor), indicating that in liver cancer cells, iron intervention preparations combined with miR-122 inhibition can significantly promote liver cancer cell death. Figure 4 It can be seen that the lipid peroxidation damage caused by iron intervention preparations was significantly increased in miR-122-inhibited liver cancer cells, indicating that iron intervention preparations and miR-122 inhibition can produce synthetic lethality by inducing lipid peroxidation in liver cancer cells, providing a new method for the development of liver cancer therapeutic drugs, especially for the treatment of patients with liver cancer with missing miR-122 expression.

[0043] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A synthetic lethal combination preparation for treating liver cancer, characterized in that: The synthetic lethal combination preparation includes independently packaged iron intervention preparations and miR-122 inhibitors; The iron intervention preparation is Holo-Tf; The sequence of the miR-122 inhibitor is shown in SEQ ID NO.

1.

2. Use of the synthetic lethal combination preparation according to claim 1 in the preparation of an agent for inhibiting the activity of liver cancer cells.

3. The use according to claim 2, characterized in that The liver cancer cells are Huh7 cells.

Images