GmMBR1 protein as well as coding gene and application thereof

Abstract

The invention discloses a GmMBR1 protein as well as a coding gene and application thereof. The invention belongs to the technical field of biology, and relates to a GmMBR1 protein as well as a coding gene and application thereof. The protein provided by the invention is any one of the following proteins: A1) a protein with an amino acid sequence as shown in SEQ ID No.3; a2) a protein which is obtained by substitution and / or deletion and / or addition of amino acid residues on the protein of A1), has 80% or more of identity with the protein of A1) and has the same function as the protein of A1); and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). Experiments prove that the protein GmMBR1 can regulate and control the plant type and yield of plants, and has important theoretical significance on soybean breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to GmMBR1 protein and its encoding gene and application. Background Art

[0002] As an important crop for both food, oil and feed, soybean plays a pivotal role in ensuring my country's food security and agricultural product trade. With the continuous improvement of people's living standards, the demand for vegetable oil and feed protein has increased dramatically. Under the current conditions of limited soybean planting area in my country, how to quickly and effectively improve soybean varieties and increase soybean yields through modern biological breeding technology is an important production problem that needs to be solved and a breeding technology bottleneck that needs to be broken through.

[0003] Plant type plays a decisive role in the morphological construction of individual and group crops, and is an important factor affecting plant yield, crop production level and economic benefits. Crop plant type includes plant height, branching (tillering), leaf shape and panicle type (pod-setting habit), etc. Crop plant type domestication or improvement plays a vital role in achieving major breakthroughs in crop yields. However, the research on the regulation mechanism of soybean plant type and the key genes regulating soybean plant type is still in the exploratory stage, and there are few related research reports; the molecular mechanism, key genes and action network affecting soybean plant type regulation are not clear. In particular, due to the limitation of research materials, there is a lack of relevant research on which plant type is more conducive to improving the soybean yield level under field production conditions. Therefore, further exploring more plant type regulatory genes is not only of great theoretical value for discovering excellent soybean plant type regulatory genes and cultivating high-yield ideal plant types; but also through the creation of specific materials, the ideal soybean plant type can be systematically evaluated and optimized under production conditions, which has important practical application value for the ultimate realization of breeding applications and the increase of soybean yield. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to regulate the plant shape and increase the yield.

[0005] In order to solve the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by the present invention may be any of the following proteins:

[0007] A1) a protein with an amino acid sequence as shown in SEQ ID No. 3;

[0008] A2) a protein having more than 75% identity with the protein shown in A1) and having the function of regulating plant type and increasing yield obtained by replacing and / or deleting and / or adding amino acid residues of the protein shown in A1); for example, a person skilled in the art can obtain a protein mutant having the same function as the amino acid sequence shown in SEQ ID No. 3 by replacing, deleting and / or adding one or more amino acids without affecting its activity according to the amino acid sequence shown in SEQ ID No. 3 and conventional technical means in the art such as conservative substitution of amino acids;

[0009] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein described in A1) above is named MBR1.

[0011] In order to facilitate purification or detection of the protein in A1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 3 in the sequence listing.

[0012] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0014] A person skilled in the art can easily mutate the nucleotide sequence encoding the protein MBR1 of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the protein MBR1 isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein MBR1 and have the function of the protein MBR1.

[0015] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0016] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence or a nucleotide sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching for a pair of amino acid sequences or nucleotide sequences to calculate the identity, then the value (%) of the identity can be obtained.

[0017] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0018] Herein, the 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0019] In the above, the protein is derived from soybean (Glycine max (L.) Merr.).

[0020] The present invention also provides a biological material related to the above protein, and the biological material may be any one of the following:

[0021] B1) a nucleic acid molecule encoding the protein described above;

[0022] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0023] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0024] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0025] B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2);

[0026] B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0027] B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2);

[0028] C1) a nucleic acid molecule that inhibits, reduces or silences the expression of a gene encoding the protein described above;

[0029] C2) expressing the gene encoding the nucleic acid molecule described in C1);

[0030] C3) an expression cassette containing the coding gene described in C2);

[0031] C4) a recombinant vector containing the coding gene described in C2) or a recombinant vector containing the expression cassette described in C3);

[0032] C5) a recombinant microorganism containing the coding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0033] C6) a transgenic plant cell line containing the coding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0034] C7) transgenic plant tissue containing the coding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0035] C8) A transgenic plant organ containing the coding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0036] In the above biological material, the nucleic acid molecule described in B1) may be the gene shown in E1) or E2) below:

[0037] E1) the coding sequence is a cDNA molecule or a DNA molecule of SEQ ID No. 2;

[0038] E2) The nucleotide sequence of the coding strand is a cDNA molecule or a DNA molecule of SEQ ID No. 1.

[0039] The DNA molecule shown in SEQ ID No. 2 (MBR1 gene regulating plant architecture and yield traits) encodes the protein MBR1 with the amino acid sequence of SEQ ID No. 3.

[0040] The nucleotide sequence shown in SEQ ID No. 2 is the nucleotide sequence of the protein MBR1 encoding gene (CDS).

[0041] The MBR1 gene of the present invention can be any nucleotide sequence that can encode protein MBR1. Considering the degeneracy of codons and the preference of codons of different species, those skilled in the art can use codons suitable for expression of a specific species as needed.

[0042] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by modifying the codon preference based on the nucleotide sequence shown in SEQ ID No. 2.

[0043] B1) The nucleic acid molecule may also include a nucleic acid molecule having a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 2 and originating from the same species.

[0044] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0045] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmids, phages (such as lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), Ti plasmids or viral vectors. Specifically, it can be a vector cas9 / gRNA.

[0046] The recombinant expression vector containing the MBR1 gene can be constructed using an existing plant expression vector. The plant expression vector includes, but is not limited to, a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment. The plant expression vector may also include a 3' non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to be added to the 3' end of the mRNA precursor, such as, but not limited to, Agrobacterium crown gall induction (Ti) plasmid genes (such as rouge synthase Nos gene), plant genes (such as soybean storage protein genes) 3' end transcription non-translated regions have similar functions.

[0047] When using the MBR1 gene to construct a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to cauliflower mosaic virus (CAMV) 35S promoter, corn ubiquitin promoter (ubiquitin), which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0048] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0049] In a specific embodiment, the recombinant vector is GmMBR1-sgRNA, and the structure of the recombinant vector GmMBR1-sgRNA is described as follows: a DNA molecule whose nucleotide sequence is a target sequence of 5'-AATAGGGAAACTTCACAGTT-3' is inserted into a linear cas9 / gRNA vector (VK005-15, Beijing Weishanglide Biotechnology Co., Ltd.) by homologous recombination, and the other sequences of the cas9 / gRNA vector are kept unchanged to obtain a recombinant expression vector. The nucleotide sequence of the recombinant expression vector is sequence 4 in the sequence table.

[0050] The microorganism described herein may be yeast, bacteria, algae or fungi. Among them, the bacteria may be from Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, etc. Specifically, it may be Agrobacterium EHA105.

[0051] In a specific embodiment, the recombinant microorganism may be recombinant Agrobacterium EHA105-GmMBR1-sgRNA.

[0052] The recombinant Agrobacterium EHA105-GmMBR1-sgRNA is a recombinant bacterium obtained by introducing the recombinant vector GmMBR1-sgRNA into Agrobacterium tumefaciens EHA105.

[0053] The present invention also provides the use of the above-mentioned protein MBR1 or a substance regulating the expression of a gene or a substance regulating the activity or content of the protein in any of the following:

[0054] U1) Use of the protein or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in regulating plant type and yield;

[0055] U2) Use of the protein or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in the preparation of products for regulating plant type and yield;

[0056] U3) Use of the protein or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in cultivating plants with changed plant type and increased yield;

[0057] U4) Use of the protein or the substance regulating the expression of the gene or the substance regulating the activity or content of the protein in the preparation of products for cultivating plants with changed plant type and increased yield;

[0058] U5) Use of the protein or the substance regulating gene expression or the substance regulating the activity or content of the protein in plant breeding.

[0059] Herein, the substance that regulates the activity and / or content of the protein may be a substance that regulates the expression of a gene encoding the protein MBR1.

[0060] In the above application, the substance that regulates the expression of the gene or the substance that regulates the activity or content of the protein may be a biological material related to the protein, and the biological material may be the biological material described above.

[0061] In the above, the substance regulating gene expression may be a substance that performs at least one of the following six types of regulation:

[0062] 1) Regulation at the transcriptional level of the gene;

[0063] 2) regulation after the transcription of the gene (i.e., regulation of the splicing or processing of the primary transcript of the gene);

[0064] 3) Regulation of RNA transport of the gene (i.e., regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);

[0065] 4) Regulation of the translation of the gene;

[0066] 5) Regulation of mRNA degradation of the gene;

[0067] 6) Post-translational regulation of the gene (that is, regulating the activity of the protein translated from the gene).

[0068] The present invention also provides a method for regulating plant type and increasing yield, comprising regulating the activity and / or content of the protein described above in the target plant, or / and the expression level of the gene encoding the protein, to regulate the plant type and increase yield.

[0069] In the above method, regulating the activity and / or content of the protein MBR1 in the target plant, or / and the expression level of the gene encoding the protein includes introducing into the recipient plant a gene encoding the protein MBR1 that inhibits, reduces or silences the protein, thereby obtaining a target plant with a changed plant shape and increased yield; the MBR1 encoding gene encodes the protein MBR1.

[0070] The introduction refers to introduction by recombinant means, including but not limited to Agrobacterium-mediated transformation, biolistic methods, electroporation, in planta technology, and the like.

[0071] In the above-mentioned applications and methods, the regulation may be increasing, enhancing or up-regulating.

[0072] In the above-mentioned uses and methods, the regulation may be inhibition, reduction or silencing.

[0073] Herein, the regulation of the expression of the coding gene of the protein may be inhibition, reduction or down-regulation of the coding gene expression. Inhibition, reduction or down-regulation of the coding gene expression may be achieved by gene knockout or gene silencing.

[0074] The gene knockout refers to the phenomenon of inactivating a specific target gene through gene editing technology. Gene knockout is the inactivation of a specific target gene by changing the DNA sequence.

[0075] The gene silencing refers to the phenomenon that the gene is not expressed or is underexpressed without damaging the original DNA. Gene silencing is based on the premise that the DNA sequence is not changed, so that the gene is not expressed or is underexpressed. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, gene repression, RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0076] In order to facilitate the identification and screening of transgenic cells or plants, the recombinant expression vector used can be processed, such as adding genes encoding enzymes or luminescent compounds that can be expressed in plants and can produce color reactions, antibiotic markers with resistance, or chemical agent resistance marker genes, etc. It is also possible to directly screen transformed plants by adversity without adding any selective marker genes.

[0077] The plant obtained by the above method can be a transgenic plant, or a plant obtained by conventional breeding techniques such as hybridization. In the above method, the transgenic plant is understood to include not only first-generation to second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species using conventional breeding techniques, especially including commercial varieties. The transgenic plant includes seeds, callus, complete plants and cells.

[0078] The present invention also provides a method for cultivating plants with altered plant type and improved yield, comprising: 1) inhibiting, reducing or silencing the expression level of the gene encoding the protein mentioned above in the target plant, or / and inhibiting, reducing or silencing the activity and / or content of the gene encoding the protein mentioned above, to obtain plants with altered plant type and improved yield;

[0079] 2) Increasing, enhancing or up-regulating the expression level of the gene encoding the protein mentioned above in the target plant, or / and increasing, enhancing or up-regulating the activity and / or content of the gene encoding the protein mentioned above, to obtain a plant with altered plant shape and reduced yield.

[0080] In a specific embodiment, a method for cultivating plants with improved plant type and yield comprises the following steps: inhibiting the expression of a nucleic acid molecule encoding an MBR1 protein in a target plant to obtain a transgenic plant with improved plant type and yield. The inhibition of the expression of a nucleic acid molecule encoding an MBR1 protein in a target plant can be achieved by introducing an interference vector targeting a nucleic acid molecule encoding an MBR1 protein into the target plant.

[0081] The interference vector may be a gene editing vector.

[0082] As an embodiment of the present invention, the method for cultivating plants with altered plant type and increased yield comprises the following steps:

[0083] (1) constructing a gene editing vector containing SEQ ID No. 4 for inhibiting the expression of the MBR1 gene;

[0084] (2) introducing the gene editing vector constructed in step (1) into the plant;

[0085] (3) Plants with altered plant shape and increased yield are obtained through screening and identification.

[0086] Specifically, the gene editing vector is a vector based on Cas9 gene editing technology. Specifically, the gene editing vector expresses sgRNA and Cas9 protein. The sgRNA targets the nucleic acid molecule encoding the MBR1 protein. Specifically, the target of the sgRNA is: 5'-AATAGGGAAACTTCACAGTT-3'.

[0087] In the above method, the target of gene editing by the CRISPR / Cas9 system is positions 1775-1794 of SEQ ID No. 1, corresponding to positions 258-277 of SEQ ID No. 2 (coding sequence).

[0088] In the above method, the CRISPR / Cas9 system gene editing can be to perform the following mutation on the gene encoding the protein shown in sequence 1 in the soybean genome: replacing "5'-AATAGGGAAACTTCACAGTTTGG-3' (SEQ ID No. 1 positions 1775-1797, corresponding to positions 258-280 of SEQ ID No. 2 (coding sequence CDS))" with 5'-AATAGGGAAACTTCAC-3', that is, deleting 7 bases at positions 274-280 in sequence 2, causing a frameshift mutation and a nucleotide sequence deletion; thereby knocking out the gene encoding the GmMBR1 protein.

[0089] In the present invention, the purpose of plant breeding includes cultivating plants with altered plant type and increased / reduced yield.

[0090] Herein, the plant type traits may include plant height, number of nodes, number of branches, number of pods per plant, and number of grains per plant.

[0091] In the above application or method, the plant is any one of the following:

[0092] N1) Dicotyledonous plants:

[0093] N2) Leguminosae;

[0094] N3) Leguminosae;

[0095] N4) soybean plants;

[0096] N5)Soybean.

[0097] The present invention obtains a gene knockout strain encoding the GmMBR1 protein by knocking out the soybean GmMBR1 protein, which can effectively regulate the soybean plant type and yield, and has important theoretical significance for soybean breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0098] Figure 1 This is the mutation type of the gmmbr1 mutant.

[0099] Figure 2 The plant types of gmmbr1 homozygous mutant 1 (mutant) and soybean variety Jack (control). DETAILED DESCRIPTION

[0100] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0101] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0102] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0103] The cultivated soybean Jack in the following embodiment is recorded in: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. The public can obtain the biological material from the applicant. The biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0104] The Agrobacterium tumefaciens EHA105 in the following examples is recorded in: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutagenesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J 16, 176-185. The public can obtain the biological material from the applicant. The biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0105] MS salts: PhytoTech, catalog number: M524.

[0106] MS Organic: PhytoTech, catalog number: M533.

[0107] B5 Organic: Phytotech, catalog number: G219.

[0108] B5 salt: Phytotech, catalog number: G768.

[0109] Linear cas9 / gRNA vector: Beijing Weishanglide Biotechnology Co., Ltd., catalog number: VK005-15.

[0110] YEP solid medium is composed of solvent and solvent; each solute and its concentration in YEP solid medium are: NaCl 5g / L, yeast extract 5g / L, tryptone 10g / L, agar 15g / L; the solvent is water. The pH of YEP solid medium is 7.0.

[0111] Germination medium (pH 5.8): 3.12 g / L B5 salts, 1 ml / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, the balance is water.

[0112] Liquid culture medium (pH 5.4): 0.43 g / L MS salts, 1 ml / L B5 organic, 40 mg / L acetosyringone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholineethanesulfonic acid, and the balance is water.

[0113] Co-culture medium (pH 5.4): 0.43 g / L MS salts, 1 ml / L B5 organic, 40 mg / L acetosyringone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholineethanesulfonic acid, and the balance is water.

[0114] Recovery medium (pH 5.4): 3.1 g / L B5 salts, 1 ml / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L timentin, 1 mg / L 6-BA, 0.98 g / L 2-morpholineethanesulfonic acid, 7.5 g / L agar, 4 ml / L Fe salts (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, and the balance is water.

[0115] Screening medium (pH 5.4): 3.1 g / L B5 salts, 1 ml / L B5 organic, 0.98 g / L 2-morpholineethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L timentin, 1 mg / L 6-BA, 6 mg / L phosphinothricin, 7.5 g / L agar, 4 ml / L Fe salts (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, and the balance is water.

[0116] Elongation medium (pH 5.6): 4.0 g / L MS salts, 1 ml / L B5 organic, 0.6 g / L 2-morpholineethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L timentin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L phosphinothricin, 7.5 g / L agar, 4 ml / L Fe salts (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, and the balance is water.

[0117] Rooting medium (pH 5.7): 2.165 g / L MS salts, 1 ml / L B5 organic, 0.6 g / L 2-morpholineethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, and the balance is water.

[0118] The following examples were processed using SPSS11.5 statistical software, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference.

[0119] Example 1. Obtaining GmMBR1 protein and its encoding gene

[0120] The gene encoding GmMBR1 was isolated and cloned from soybean variety Jack, and GmMBR1 was located on chromosome 14, and was named as GmMBR1 gene (the protein it encoded was named GmMBR1). The GmMBR1 gene in the genomic DNA of soybean variety Jack is shown as SEQ ID No. 1 in the sequence listing, the coding sequence of the GmMBR1 gene is shown as SEQ ID No. 2 in the sequence listing, and the encoded amino acid sequence is shown as the protein GmMBR1 in SEQ ID No. 3 in the sequence listing.

[0121] Example 2: Obtaining GmMBR1 gene-edited plants

[0122] 1. Obtaining sgRNA

[0123] The GmMBR1 sgRNA target site sequence was selected using the CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) online web tool. The target site was located in the third exon region of GmMBR1, and the target sequence was 5'-AATAGGGAAACTTCACAGTT-3' (SEQ ID No. 1, 1775-1794, corresponding to SEQ ID No. 2 (coding sequence), 258-277).

[0124] After the target is designed, it needs to be integrated into the vector. First, synthesize the target primer of sgRNA, the primer sequence is:

[0125] GmMBR1-F: 5'-TTG AATAGGGAAACTTCACAGTT -3';

[0126] GmMBR1-R:5'-AAC AACTGTGAAGTTTCCCTATT -3';

[0127] (The underlined sequence is 20 bp sgRNA)

[0128] Add 5ul of GmMBR1-F and GmMBR1-R primers and 15ul of water to the 25ul system, anneal at 95°C for 3min, 0.1°C / s to 16°C, and maintain at 16°C for 10min to complete annealing and obtain gRNA annealing products with sticky ends.

[0129] 2. Preparation of GmMBR1 gene editing expression vector GmMBR1-sgRNA

[0130] Take 1ul of the gRNA annealing product with sticky ends obtained in step 1 above and connect it with the cas9 / gRNA vector (Beijing Weishanglide Biotechnology Co., Ltd., catalog number: VK005-15, which contains the Cas9 protein expression unit) for homologous recombination to obtain the recombinant vector Cas9-sgRNA, which expresses sgRNA. The coding sequence of the target sequence binding region in sgRNA is 1775-1794 of sequence 1.

[0131] 3. Preparation of recombinant bacteria

[0132] The recombinant vector Cas9-sgRNA prepared in step 2 was transferred into E. coli DH5α and spread on LB+Kan solid medium. Single clones were picked to extract plasmids and sent for sequencing.

[0133] Sequencing primer SQ: 5'-GATGAAGTGGACGGAAGGAAGGAG-3', and the plasmid with the correct fragment inserted was named the recombinant vector GmMBR1-sgRNA.

[0134] The structure of the recombinant vector GmMBR1-sgRNA is described as follows: a recombinant expression vector is obtained by inserting a linear cas9 / gRNA vector into a DNA molecule with a target sequence of 5'-AATAGGGAAACTTCACAGTT-3' through homologous recombination, and keeping other sequences of the cas9 / gRNA vector unchanged. The nucleotide sequence of the recombinant expression vector is sequence 4 in the sequence table.

[0135] The recombinant vector GmMBR1-sgRNA contains an sgRNA gene expression cassette whose nucleotide sequence is nucleotides 35-582 of SEQ ID No.4, the sgRNA gene is shown in nucleotides 480-499 of SEQ ID No.4 in the sequence table, nucleotides 35-479 are promoters for initiating transcription of the sgRNA gene, and nucleotides 576-582 are terminators for terminating transcription of the sgRNA gene. Cas9-sgRNA also contains a Cas9 protein gene expression cassette whose nucleotide sequence is nucleotides 584-5568 of SEQ ID No.4, which can express Cas9 protein.

[0136] 4. Obtaining and identifying the phenotype of gmmbr1 mutants

[0137] The recombinant vector GmMBR1-sgRNA was transformed into Agrobacterium EHA105 by electroporation, the plasmid was extracted for sequencing verification, and the recombinant strain verified correctly by sequencing was named EHA-GmMBR1-sgRNA.

[0138] 5. Agrobacterium-mediated transformation

[0139] The EHA-GmMBR1-sgRNA constructed in step 4 was transformed into soybean variety Jack (hereinafter referred to as wild-type soybean) using the Agrobacterium-mediated method. The specific method is as follows:

[0140] A. Seed sterilization

[0141] 1) Take soybean seeds of the variety Jack that are free of pests and spots, plump, uniform, and dry, spread them completely flat in a culture dish, and then place the culture dish in a desiccator.

[0142] 2) After completing step 1), a 100 ml beaker was placed in the desiccator, 80 ml of 12 M sodium hypochlorite aqueous solution was poured into the beaker, and 4 ml of concentrated hydrochloric acid was slowly added. The desiccator was then quickly covered and sealed with vaseline, and left for 16 hours for chlorine sterilization.

[0143] B. Preparation of infection solution

[0144] 1) Cultivate the EHA-GmMBR1-sgRNA bacterial solution obtained in step 4 above at 28°C, resuspend it in liquid culture medium, and obtain OD 600nm =0.6 of the infecting bacterial solution.

[0145] 2) Place the seeds treated in step A in a clean bench, peel off the seed coat under a microscope, separate the two cotyledons along the long axis, retain the cotyledon with the complete hypocotyl, and scratch the connection between the hypocotyl and the cotyledon. Generally, one cotyledon is scratched 3-5 times, and then immersed in a 28°C incubator for 2 hours.

[0146] 3) Spread the cotyledons with the inner surface (smooth surface) facing upward on the co-cultivation medium covered with sterile filter paper at 22°C in the dark for 5 days.

[0147] 4) After 5 days of co-culture, the hypocotyl of the explants elongated to 2 cm, and part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were placed in recovery medium and cultured for 7 days at 28°C, 16h light / 8h dark.

[0148] 5) Remove the explants from the recovery medium, remove the new buds, cut off part of the hypocotyl, retain 0.5 cm of the hypocotyl, and then transfer the trimmed explants to the screening medium and culture them at 28°C, 16 h light / 8 h dark for 21 days.

[0149] 6) After 21 days of screening and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed and the remaining parts were transferred to elongation medium for culture at 28°C and 16 h light / 8 h dark conditions.

[0150] 7) In the elongation medium, when the clustered buds grow 5-8 cm young stems, cut them off from the base of the adventitious buds; dip the base of the stem in 1 mg / LIBA solution for 1 min, then transfer to the rooting medium for culture at 28°C, 16 h light / 8 h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The grown plants are T0 generation transformed soybeans.

[0151] 6. Molecular testing of edited plants

[0152] The DNA of the T0 generation transformed soybean leaves obtained in step 5 was extracted and used as a template for PCR molecular detection, with the wild-type soybean as a control.

[0153] PCR primers were designed near the target site of GmMBR1 gene, and PCR amplification and sequencing were performed. Among them, primers MBR1-F: 5'-GTGCCTGGAGAGGGATAGCA-3' and MBR1-R: 5'-CTGGAGAGCATTTTCCAGGAGT-3' amplified GmMBR1 gene. PCR reaction system: 2×Phanta Max Buffer 12.5ul, dNTP Mix (10mM) 0.5ul, DNA (200ng / ul) 1ul, F (10pmol / ul) 1ul, R (10pmol / ul) 1ul, Super-Fidelity DNA Polymerase 0.5ul, ddH2O8.5ul, total volume 25ul. Amplification reaction system: 95℃3min; 95℃30sec, 58℃30sec, 72℃1min, 35 cycles; 72℃5min. PCR products were sent to the company for sequencing verification.

[0154] The plants with overlapping peaks near the target site were heterozygous edited plants and were named T0 generation transgenic GmMBR1 soybeans.

[0155] After sowing T0 generation GmMBR1 soybeans, seeds of T1 generation GmMBR1 soybeans were harvested and cultivated to obtain T1 generation GmMBR1 soybeans.

[0156] The PCR detection method was used to detect the T1 generation GmMBR1 transgenic soybeans, and the sequencing results of the amplified products showed that in the T1 generation GmMBR1 transgenic soybeans, compared with the genomic DNA of the soybean variety Jack (wild type), the genes encoding the GmMBR1 protein in the two homologous chromosomes of the gmmbr1 homozygous mutant 1 had the following mutations: "5'-AATAGGGAAACTTCACAGTTTGG-3' (SEQ ID No.1 positions 1775-1797, corresponding to SEQ ID No.2 (coding sequence CDS) positions 258-280)" was replaced by 5'-AATAGGGAAACTTCAC-3', that is, 7 bases at positions 274-280 of sequence 2 were deleted, resulting in a frameshift mutation; and then the gene encoding the GmMBR1 protein was knocked out. The sequencing results of the mutation site and its surrounding nucleotides are shown in Figure 2. Figure 1 .

[0157] The T1 generation GmMBR1 soybean mutant plants with the GmMBR1 gene mutation type are further cultivated to screen out T2 generation soybean homozygous mutants without transgenic elements, and perform phenotypic identification.

[0158] Example 2: Phenotypic Identification of GmMBR1 Gene-Edited Soybean Mutants

[0159] Planting was carried out under natural light conditions in a net house in Beijing in summer, with a planting condition of 10 cm plant spacing and 50 cm row spacing. The plant type traits (plant height, number of nodes, number of branches, number of pods per plant, number of grains per plant) of the wild soybean variety Jack (referred to as the control plant) and the gmmbr1 homozygous mutant 1 (referred to as the mutant) were counted respectively. At least 6 individual plant data were counted for each material.

[0160] The results of the study showed (Table 1 and Figure 2 ), in terms of plant type, the average plant height of gmmbr1 homozygous mutant 1 was 123.8 cm, compared with the control plant height of 148.3 cm, and the plant height of gmmbr1 homozygous mutant 1 was significantly lower than that of the control; in terms of branching phenotype, the control plants had 1.5 branches, and the gmmbr1 homozygous mutant 1 plants had an average of 2.6 branches, and the number of branches of gmmbr1 homozygous mutant 1 increased significantly; in terms of the number of plant nodes, the control plants had 25.0 nodes, and the gmmbr1 homozygous mutant 1 plants had an average of 24.6 nodes, and the number of nodes of gmmbr1 homozygous mutant 1 plants did not change significantly compared with the control. In terms of single-plant yield, the average number of pods per plant of the control plants was 106.5, and the number of grains per plant was 257.8. The number of pods per plant of the gmmbr1 homozygous mutant 1 was 116.0, and the number of grains per plant was 289.0. The number of pods and grains per plant of the gmmbr1 homozygous mutant 1 was higher than that of the wild type.

[0161] Table 1. Statistics of soybean plant type data

[0162]

[0163]

[0164] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A protein, wherein the protein is any of the following: A1) a protein with an amino acid sequence as shown in SEQ ID No. 3; A2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein of A1) and having 80% or more identity with the protein of A1) and having the same function; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The protein according to claim 1, characterized in that: The protein is derived from soy beans.

3. A biological material related to the protein according to claim 1 or 2, wherein the biological material is any one of the following: B1) A nucleic acid molecule encoding the protein according to claim 1 or 2; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); C1) a nucleic acid molecule that inhibits, reduces or silences the expression of a gene encoding a protein according to claim 1 or 2; C2) expressing the gene encoding the nucleic acid molecule described in C1); C3) an expression cassette containing the coding gene described in C2); C4) a recombinant vector containing the coding gene described in C2) or a recombinant vector containing the expression cassette described in C3); C5) a recombinant microorganism containing the coding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4); C6) a transgenic plant cell line containing the coding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4); C7) transgenic plant tissue containing the coding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4); C8) A transgenic plant organ containing the coding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

4. The biomaterial according to claim 3, characterized in that B1) The nucleic acid molecule is the gene shown in E1) or E2) below: E1) the coding sequence is a cDNA molecule or a DNA molecule of SEQ ID No. 2; E2) The nucleotide sequence is a cDNA molecule or a DNA molecule of SEQ ID No.

1.

5. Application, characterized in that, The application is any of the following: U1) Use of the protein or gene expression regulating substance according to claim 1 or 2 or the substance regulating the activity or content of the protein in regulating plant type and yield; U2) Use of the protein or gene expression regulating substance according to claim 1 or 2 or the substance regulating the activity or content of the protein in the preparation of products for regulating plant type and yield; U3) Use of the protein or gene expression substance of claim 1 or 2 or the substance regulating the activity or content of the protein in cultivating plants with altered plant type and yield; U4) Use of the protein or gene expression regulating substance according to claim 1 or 2 or the substance regulating the activity or content of the protein in the preparation of products for cultivating plants with changed plant type and increased yield; U5) Use of the protein or gene expression regulating substance according to claim 1 or 2 or the substance regulating the activity or content of the protein in plant breeding.

6. The use according to claim 5, characterized in that: The substance regulating gene expression or the substance regulating the activity or content of the protein is a biological material related to the protein, and the biological material is any one of the following C1) to C8): C1) a nucleic acid molecule that inhibits, reduces or silences the expression of a gene encoding a protein according to claim 1 or 2; C2) expressing the gene encoding the nucleic acid molecule described in C1); C3) an expression cassette containing the coding gene described in C2); C4) a recombinant vector containing the coding gene described in C2) or a recombinant vector containing the expression cassette described in C3); C5) a recombinant microorganism containing the coding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4); C6) a transgenic plant cell line containing the coding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4); C7) transgenic plant tissue containing the coding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4); C8) A transgenic plant organ containing the coding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

7. A method for regulating plant type and yield, characterized in that: The method comprises regulating the activity and / or content of the protein described in claim 1 or 2, or / and the expression level of the gene encoding the protein described in claim 1 or 2 in the target plant to regulate the plant type and yield.

8. The method according to claim 7, characterized in that The regulating the activity and / or content of the protein described in claim 1 or 2 in the target plant, or / and the expression level of the gene encoding the protein described in claim 1 or 2, includes introducing a gene encoding the protein that inhibits, reduces or silences the protein into the recipient plant, thereby obtaining a target plant with a changed plant shape and a yield higher than that of the recipient plant; the encoding gene encodes the protein described in claim 1 or 2.

9. A method for cultivating plants with altered plant type and yield, comprising: 1) inhibiting, reducing or silencing the expression of the gene encoding the protein of claim 1 in the target plant, or / and inhibiting, reducing or silencing the activity and / or content of the gene encoding the protein of claim 1, to obtain a plant with a changed plant shape and increased yield; 2) Increasing, enhancing and / or up-regulating the expression level of the gene encoding the protein described in claim 1 in the target plant, or / and increasing, enhancing and / or up-regulating the activity and / or content of the gene encoding the protein described in claim 1, to obtain a plant with altered plant shape and reduced yield.

10. The method according to any one of claims 7 to 9, characterized in that: The plant is any one of the following: N1) dicotyledonous plant: N2) Leguminosae; N3) Leguminosae; N4) soybean plants; N5)Soybean.

Images