An anti-jo-1 antibody or antigen-binding fragment thereof, detection reagent, kit and use

Abstract

The application discloses an anti-Jo-1 antibody or antigen binding fragment thereof, detection reagent, kit and application, and relates to the technical field of in vitro detection.The anti-Jo-1 antibody and antigen binding fragment thereof disclosed by the application comprise a heavy chain variable region and a light chain variable region sequence, the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.2.The application solves the problems of positive tracing and large-scale supply of the anti-Jo-1 antibody.The Jo-1 antibody or antigen binding fragment thereof disclosed by the application has the characteristics of high affinity, high specificity and good stability, and provides a raw material source with excellent performance for the preparation of a standard / positive control / quality control of a Jo-1 antibody detection kit.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of in vitro detection technology, and particularly relates to an anti-Jo-1 antibody or antigen binding fragment thereof, a detection reagent, a kit and application. BACKGROUND

[0002] Autoimmune diseases (referred to as "self-immune diseases" for short) are diseases caused by the immune system reacting to the body's own components, causing damage. Under normal circumstances, the immune system only reacts to foreign objects invading the body, such as bacteria, viruses, parasites, and transplants, and eliminates or rejects these foreign objects. Under the influence of certain factors, the body's tissue components or the immune system itself have some abnormalities, causing the immune system to mistakenly attack the body's own components as foreign objects. At this time, the immune system produces antibodies and active lymphocytes against some components of the body, damaging and destroying the body's own tissues and organs, leading to disease.

[0003] Due to the large number of autoimmune diseases, autoimmune diseases are usually divided into two categories. One is systemic autoimmune disease, which is mainly characterized by multiple organ or tissue involvement, such as rheumatoid arthritis, systemic lupus erythematosus, Sjogren's syndrome, systemic vasculitis, etc. The other is organ-specific autoimmune disease, which only involves one tissue or organ, such as autoimmune liver disease, type I diabetes, etc.

[0004] Systemic sclerosis (SSc) is a connective tissue disease characterized by collagen fiber hardening of the skin and various systems. Systemic scleroderma involving internal organs is also known as systemic sclerosis. This disease is second only to lupus erythematosus in connective tissue disease and belongs to "self-immune diseases".

[0005] Anti-Jo-1 antibody is a myositis-specific autoantibody that plays an important role in the diagnosis, differential diagnosis, and classification of inflammatory myopathy. This antibody is commonly used for the diagnosis of polymyositis (PM) and dermatomyositis (DM), with a positive rate of about 25% in polymyositis and 7.1% in dermatomyositis. In PM / DM patients with interstitial lung disease, the positive rate is as high as 60%.

[0006] Jo-1 antigen is a histidyl tRNA synthetase that appears in the form of a small ribonucleoprotein in the cytoplasm. Anti-Jo-1 antibody is closely related to the occurrence and development of polymyositis and dermatomyositis. The clinical manifestations of these diseases are diverse and complex, often involving proximal limb muscles, neck muscles, and pharyngeal muscles, and may also affect the skin, heart, gastrointestinal tract, and lungs.

[0007] Typical symptoms of anti-Jo-1 antibody syndrome patients include polymyositis, polyarticular synovitis, arthralgia, non-aggressive degenerative arthritis, tendon sheath inflammation, pulmonary alveolar fibrosis or pulmonary fibrosis. In addition, scleroderma-related symptoms can also be associated with it. This syndrome is called Jo-1 syndrome or anti-synthetase syndrome. Common methods for diagnosing anti-Jo-1 antibodies include enzyme-linked immunosorbent assay and immunoblotting. In addition, the diagnosis process can also include detection of serum muscle enzyme spectrum, myogenic damage shown by electromyography, and symptoms such as muscle fiber degeneration or necrosis found by muscle biopsy.

[0008] Stable indoor quality control products can effectively monitor the precision and accuracy of test results. However, the current market commercialized anti-Jo-1 antibody quality control products are mostly positive serum of patients, but the serum source is difficult, and the batch difference is large, the batch is small, and the source is imported, which is expensive, limiting the clinical application of detection products. Therefore, it is urgent to independently develop anti-Jo-1 antibody with high affinity and specificity, which can be mass-produced, and realize the daily quality control detection of clinical laboratory. SUMMARY

[0009] The technical problem to be solved by the present application is to provide an anti-Jo-1 antibody or antigen binding fragment thereof, detection reagent and application, to solve the problem of difficult source of current commercialized anti-Jo-1 antibody.

[0010] In order to solve the above problems, the present application proposes the following technical solutions:

[0011] In a first aspect, the present application provides an anti-Jo-1 antibody or antigen binding fragment thereof, comprising a heavy chain variable region and a light chain variable region.

[0012] The amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 2.

[0013] The antibody or antigen binding fragment thereof is a monoclonal antibody or a polyclonal antibody. The monoclonal antibody can be developed by various methods and technologies, including hybridoma technology, phage display technology, single lymphocyte gene cloning technology, etc.

[0014] Further, the antibody or antigen binding fragment thereof further comprises a heavy chain constant region, and the heavy chain constant region comprises:

[0015] CH1 with an amino acid sequence shown as SEQ ID NO. 3;

[0016] Hinge with an amino acid sequence shown as SEQ ID NO. 4;

[0017] CH2 with an amino acid sequence shown as SEQ ID NO. 5; and

[0018] CH3 with the amino acid sequence as shown in SEQ ID NO. 6.

[0019] Further, the heavy chain constant region is selected from the conservative amino acid sequence of human IgGl heavy chain constant region.

[0020] Further, the antibody or antigen-binding fragment thereof further comprises a light chain constant region CL with the amino acid sequence as shown in SEQ ID NO. 7.

[0021] Further, the light chain constant region CL is selected from the conservative amino acid sequence of human IgGl light chain constant region.

[0022] Further, the antibody or antigen-binding fragment thereof has a heavy chain amino acid sequence as shown in SEQ ID NO. 8 and a light chain amino acid sequence as shown in SEQ ID NO. 9.

[0023] The preparation method of the antibody or antigen-binding fragment thereof is a conventional preparation method in the art. Preferably, the preparation method is: isolation from a host cell expressing the antibody or antigen-binding fragment thereof or by artificially synthesizing a protein sequence. The isolation from a host cell expressing the antibody or antigen-binding fragment thereof is preferably as follows: cloning a nucleic acid molecule encoding the antibody or antigen-binding fragment thereof and carrying a point mutation into a vector, transforming the obtained vector into a host cell, and then isolating and purifying the antibody or antigen-binding fragment thereof by culturing the obtained host cell.

[0024] In a second aspect, the present application provides a nucleic acid molecule encoding the anti-Jo-1 antibody or antigen-binding fragment thereof of the first aspect.

[0025] Further, the heavy chain variable region nucleotide sequence of the anti-Jo-1 antibody or antigen-binding fragment thereof is as shown in SEQ ID NO. 10, and the light chain variable region nucleotide sequence is as shown in SEQ ID NO. 11.

[0026] Further, the anti-Jo-1 antibody or antigen-binding fragment thereof has a heavy chain constant region CH1 region nucleotide sequence as shown in SEQ ID NO. 12, a Hinge region nucleotide sequence as shown in SEQ ID NO. 13, a CH2 region nucleotide sequence as shown in SEQ ID NO. 14, and a CH3 region nucleotide sequence as shown in SEQ ID NO. 15.

[0027] Further, the light chain constant region CL nucleotide sequence of the anti-Jo-1 antibody or antigen-binding fragment thereof is as shown in SEQ ID NO. 16.

[0028] Further, the heavy chain nucleotide sequence of the anti-Jo-1 antibody or antigen binding fragment thereof is shown as SEQ ID NO. 17, and the light chain nucleotide sequence is shown as SEQ ID NO. 18.

[0029] The method for preparing the nucleic acid molecule is a conventional method in the art, and preferably includes the following steps: obtaining the nucleic acid molecule encoding the antibody or antigen binding fragment thereof by gene cloning technology, or obtaining the nucleic acid molecule encoding the antibody or antigen binding fragment thereof by artificial full sequence synthesis method.

[0030] As known by those skilled in the art, the base sequence encoding the amino acid sequence of the antibody or antigen binding fragment thereof can be appropriately introduced with substitutions, deletions, modifications, insertions or additions to provide a homolog of a polynucleotide. The homolog of the polynucleotide in the present application can be prepared by substituting, deleting or adding one or more bases of the sequence gene encoding the antibody or antigen binding fragment thereof within the range of maintaining the activity of the antibody, which is also included in the present application.

[0031] In a third aspect, the present application provides a vector comprising the nucleic acid molecule of the second aspect.

[0032] The vector can be obtained by a conventional method in the art, i.e. by connecting the nucleic acid molecule of the present application to various expression vectors to construct. The expression vector is a conventional vector in the art, as long as it can accommodate the aforementioned nucleic acid molecule. The vector preferably includes various plasmids, cosmids, bacteriophages or viral vectors, etc.

[0033] In a fourth aspect, the present application provides a host cell comprising the nucleic acid molecule or the vector.

[0034] The method for preparing the host cell is a conventional method in the art, and preferably is by transforming the aforementioned vector into a host cell to obtain. The host cell is a conventional host cell in the art, as long as it can meet the requirements of stably replicating the aforementioned vector by itself, and the nucleic acid carried by the vector can be effectively expressed. Preferably, the host cell is E. coli TG1 or BL21 cell (expressing single-chain antibody or Fab antibody), or CHO-K1 cell (expressing full-length IgG antibody). The aforementioned recombinant expression plasmid is transformed into the host cell to obtain the preferred host cell of the present application. The transformation method is a conventional transformation method in the art, and preferably is chemical transformation method, heat shock method or electroporation method.

[0035] The present application also provides the anti-Jo-1 antibody or antigen binding fragment thereof for detecting the presence or level of Jo-1 in a sample, or the use thereof in preparing a kit for detecting the presence or level of Jo-1 in a sample.

[0036] In a fifth aspect, the present application provides a detection reagent comprising the anti-Jo-1 antibody or antigen-binding fragment thereof of the first aspect.

[0037] Further, the detection reagent is a quality control, positive control or standard.

[0038] In a sixth aspect, the present application provides a kit comprising the anti-Jo-1 antibody or antigen-binding fragment thereof of the first aspect, or comprising the detection reagent of the fifth aspect.

[0039] The present application also provides use of the anti-Jo-1 antibody or antigen-binding fragment thereof in detecting the presence or level of Jo-1 antibody in a sample, or in the preparation of a kit for detecting the presence or level of Jo-1 antibody in a sample; or use of the detection reagent, the kit in detecting the presence or level of Jo-1 antibody in a sample.

[0040] It should be noted that a kit typically comprises one or more detection reagents containing the specific antibody to be measured, which can serve as a quality control, positive control or standard. A standard is used to establish a standard curve for assigning values to antibody concentrations, or a single positive control can be used near the positive / negative cut-off. Preferably, the standard or positive control is prepared with the specific antibody to be measured or a material chemically similar thereto. Ideally, the standard or control is manufactured to interact with other assay components in a manner similar to the test analyte (specific antibody). Multiple standards comprising different concentrations of the specific antibody spanning the concentration range of the analyte to be measured are typically included. When the detection reagent is used as a standard, positive control or quality control for Jo-1 antibody detection, the concentration of the Jo-1 antibody in the detection reagent is designated, i.e. explicitly stated, and can be adjusted as needed for detection.

[0041] Of course, the kit also comprises other necessary detection reagent components for detecting Jo-1 antibody, such as chemiluminescent immunoassay-related reagent components, specifically Jo-1 antigen-coated solid phase carrier components and labeled antibody reagent components, etc.

[0042] Compared with the prior art, the present application can achieve the following technical effects:

[0043] The anti-Jo-1 antibody or antigen-binding fragment thereof provided by the present application solves the problems of positive blood tracing and large-scale supply. The application of the scheme of the present application can prepare Jo-1 antibody or antigen-binding fragment thereof with high titer, high accuracy and good stability, providing a good raw material source for the preparation of standard / positive control / quality control of Jo-1 antibody detection kit. Attached Figure Description

[0044] Figure 1 The above are the agarose gel electrophoresis results of RNA extracted from positive whole blood in this invention;

[0045] Figure 2 The results of agarose gel electrophoresis of the heavy chain variable region amplified in this invention;

[0046] Figure 3 The results of agarose gel electrophoresis of the light chain variable region amplified in this invention;

[0047] Figure 4 This is the amplification result of the ScFv fragment of this invention;

[0048] Figure 5 The SDS-PAGE detection results show the high affinity and specificity antibody obtained by screening in this invention.

[0049] Figure 6 The results are obtained by immunoblotting membrane strip detection of the Jo-1 antibody of this invention. Detailed Implementation

[0050] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the embodiments described below are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0051] It should be noted that, unless otherwise specified, the reagents and consumables used in the following examples are all commercially available products, such as DNA extraction kits. The specific steps for preliminary DNA extraction can be performed according to the instructions of the kit.

[0052] Example 1: Construction of protein display library and screening of anti-Jo-1 antibodies

[0053] 1.1 Positive blood collection

[0054] Collect 2 ml of positive whole blood from 30 Jo-1 autoimmune patients aged 20-50 years.

[0055] 1.2 Lymphocyte isolation and total RNA extraction

[0056] Lymphocytes were isolated from the collected positive whole blood using the QIAamp RNABlood Mini kit (50) instructions. Total RNA was extracted according to the Trizol kit instructions. The results are as follows: Figure 1The RNA was dissolved with RNase-free water according to the need and stored. Note that all materials used need to be RNase-free, and a mask should be worn during the operation to prevent the operator from bringing in RNase and causing RNA degradation.

[0057] 1.3 Amplification of antibody heavy chain variable region and light chain variable region

[0058] According to the Takara reverse transcription kit instruction PrimeScriptTMII 1st strand cDNA synthesis kit, the RNA obtained by 1.2 was used as a template for reverse transcription to synthesize cDNA. Then the obtained cDNA was used as a template for PCR reaction to amplify the heavy chain variable region and light chain variable region sequence, and the PCR reaction conditions and program were as follows: 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 60 seconds, 68°C for 60 seconds, 30 cycles; 68°C for 5 minutes. The PCR product was identified by 1.2% agarose gel electrophoresis, and the length of the heavy chain variable region gene was about 375 bp; the length of the light chain variable region gene was about 330 bp. The primer sequences are shown in Table 1; the heavy chain variable region and light chain variable region gel electrophoresis is shown in Figures 2-3 .

[0059] Table 1 Amplification primers of heavy chain variable region and light chain variable region

[0060]

[0061]

[0062] 1.4 Amplification of ScFv fragment

[0063] The heavy chain variable region and light chain variable region genes amplified were used as templates, and specific primers were used for PCR reaction, and the PCR reaction conditions and program were as follows: 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 60 seconds, 68°C for 60 seconds, 30 cycles; 68°C for 5 minutes. The PCR product was identified by 1.2% agarose gel electrophoresis, and the length of the ScFv fragment gene was about 750 bp. The primer sequences are shown in Table 2; the ScFv gel electrophoresis result is shown in Figure 4 .

[0064] Table 2 Amplification primer sequences of ScFv fragment

[0065] Primer Name Primer Sequence MH-VH-scFv-F gtcctcgcaccatggcc MHkappaCLscFv-NotI raccgcctccgcggccgcgaagacagatggtgcagccacagt MH-VH-scFv-F gtcctcgcaccatggcc MHLambdaCLscFv-NotI raccgcctccgcggccgcagaggasggygggaacagagtgac

[0066] 1.5 Construction of antibody gene library

[0067] The vector pCANTAB-5E and the second round of amplification product were double digested with Not I and Nco I respectively, the digested products were recovered by gel recovery kit, and the ligation was performed by T4 DNA ligase. The ligation product was purified by PCR product purification kit. The purified ligation product was added to 50 μL of TG1 electro-competent cells, and the electro-transformation was performed under the conditions of 1 mm electro-transformation cup and 1800 V voltage. After recovery culture in the medium, 10 μL of gradient dilution was plated to calculate the number of colonies, and the capacity of the antibody library was 2.4 x 1010. 8 .

[0068] 1.6 Amplification of phage library

[0069] 50 μL of the above bacterial library was inoculated into 50 mL of 2*YT medium containing 2% glucose and ampicillin, and cultured at 37°C and 220 rpm until OD600=0.5. Then 500 μL of helper phage M13KO7 was added, and the infection was allowed to stand at 37°C for 1 h. The culture was centrifuged, and the supernatant was replaced with 50 μg / mL kanamycin and 100 μg / mL ampicillin. The culture was incubated at 26°C and 220 rpm overnight. Then 40 mL of supernatant was taken, 10 mL of PEG / NaCl (20% / 2.5 M) solution was added, and the mixture was mixed thoroughly. The supernatant was discarded by centrifugation, and the precipitate was washed with 1 mL of pre-cooled PBS on ice. The insoluble substances were removed by high-speed centrifugation.

[0070] 1.7 Antibody screening

[0071] The streptavidin magnetic beads were blocked with 3% milk-PBS for 2 h, and the phage library was blocked for 1 h. An appropriate amount of biotinylated SCL70 antigen was added to the blocked phage library, and the mixture was mixed on a shaker at room temperature for 1 h. The blocked magnetic beads were added, washed with PBST for 10 times, and the phage bound to the antigen was eluted with 0.2 M glycine solution. The eluted phage was transfected into TG1 for the next round of screening. The screening was repeated, and after 3 rounds of screening, the positive clones were verified by ELISA, and a strain with high affinity was obtained and named Jo-1-T4. The sequencing analysis of Jo-1-T4 showed that the amino acid sequence of the heavy chain variable region of the antibody was represented by SEQ ID NO. 1, and the nucleotide sequence encoding the same was represented by SEQ ID NO. 10; the amino acid sequence of the light chain variable region was represented by SEQ ID NO. 2, and the nucleotide sequence encoding the same was represented by SEQ ID NO. 11.

[0072] Example 2 Recombinant preparation of Jo-1 antibody and performance verification

[0073] 2.1 Gene synthesis

[0074] 2.1.1 This embodiment provides an anti-Jo-1 antibody, comprising a light chain and a heavy chain. The amino acid composition of the light chain is: the sequence from N-terminus to C-terminus is VL-CL, and the sequence is SEQ ID NO. 2-SEQ ID NO. 7; the amino acid composition of the heavy chain is: the sequence from N-terminus to C-terminus is VH-CH1-Hinge-CH2-CH3, and the sequence is SEQ ID NO. 1-SEQ ID NO. 3-SEQ ID NO. 4-SEQ ID NO. 5-SEQ ID NO. 6.

[0075] 2.1.2 According to the sequence of the anti-Jo-1 antibody, the Kozak sequence: GCCGCCACC is introduced; the signal peptide, the nucleotide sequence is shown as SEQ ID NO 19; the stop codon: TAA. The expression sequence is designed and sent to a gene synthesis company (Beijing Genescript) for codon optimization and gene synthesis.

[0076] Signal peptide sequence SEQ ID N019:

[0077] atggactggacgtggcgcatcctgttcctggttgcagcagctacgggagcgcacagc.

[0078] 2.2 Antibody expression vector construction

[0079] 2.2.1 Amplification of antibody heavy chain and light chain fragments

[0080] The synthesized light chain and heavy chain genes are used as templates, and then the PCR reaction solution is prepared according to the following component allocation: DNA template 50 ng, 1 μL forward primer, 1 μL reverse primer, 5 μL 10×ExTaq buffer, 0.25 μL HS ExTaq, and then ddH2O is added to 50 μL. Reaction conditions: 98℃ for 3 minutes; 94℃ for 50 seconds, 55℃ for 30 seconds, 68℃ for 40 seconds, cycle 40 times; 72℃ extension for 10 minutes. 1% agarose gel electrophoresis, recovery of DNA and determination of concentration, short-term storage at -20℃. The heavy chain and light chain fragment amplification primers are shown in Table 3.

[0081] Table 3 Heavy chain and light chain fragment amplification primers

[0082]

[0083]

[0084] 2.2.2 pcDNA3.1 vector digestion, vector and antibody ligation

[0085] The vector enzyme digestion reaction system is as follows: take 5 μg of pcDNA3.1 empty, 2 μL of Hind III, 2 μL of EcoR I, 10 μL of 10x buffer, and use ddH2O to supplement to 100 μL, and react at 37°C for 1 h. 1% agarose gel electrophoresis, recover the DNA and determine the concentration, and store at -20°C for short-term storage.

[0086] The vector and antibody connection system is as follows: take 50 ng of vector fragment, 10 ng of antibody fragment, 5 μg of 2x buffer, 1 μL of seamless cloning ligase, and use ddH2O to supplement to 10 μL. React at 37°C for 30 min.

[0087] 2.2.3 Plate coating and sequencing

[0088] The transformation system is as follows: take 100 μL of Top10 competent cells, 10 μL of ligation reaction solution, mix well, ice bath for 30 min. 42°C heat shock for 90 s, ice bath for 5 min. Then spread on LB solid plate containing 100 μg / mL of ampicillin antibiotic, and incubate at 37°C overnight. Pick single colonies into LB liquid medium containing 100 μg / mL of ampicillin, and incubate at 37°C, 220 rpm on a shaker for 6 h, and send for sequencing.

[0089] 2.2.4 Plasmid extraction

[0090] Sequence alignment of the sequencing results, inoculate the correct sequence bacteria into 400 mL of LB liquid containing 100 μg / mL of ampicillin, and incubate at 37°C, 220 rpm on a shaker overnight. Use the plasmid extraction kit (OMEGA, D6924-04) to extract the plasmid, and detect the plasmid concentration by ultraviolet spectrophotometer, and store at -20°C for standby. The concentration detection results are shown in Table 4.

[0091] Table 4 Heavy chain and light chain concentration detection results

[0092] Heavy Chain Light Chain Concentration (ng / μL) 1342 1447 Volume (mL) 2.3 2.2

[0093] 2.3 Preparation of anti-Jo-1 antibody

[0094] 2.3.1 Resuscitate 293F cells with serum-free medium (Expi 293 medium), and when the density reaches 3-5 × 10 6 cells / mL, subculture at 0.5 × 10 6 cells / mL, subculture every 3-4 days, and subculture for 3 generations, and subculture at 3 × 10 6Cells were passaged at 500 mL per bottle, and 250 μg of the extracted heavy chain plasmid and 300 μg of the extracted light chain plasmid were mixed with 25 mL of serum-reduced medium (Opti-MEM™). 1.65 mL of PEI (1 mg / mL) was mixed with 25 mL of serum-free medium (Expi 293 medium), and then the PEI was added to the plasmid mixture, mixed, and allowed to stand for 15 min. The mixture was then added to the 500 mL of passaged cells, and the cells were cultured in a shaker (culture conditions: 37°C, 8% CO2, 120 rpm).

[0095] 2.3.2 After 24 h, the feed (0.5% enhancer 1 and 5% enhancer 2) was added, and the cells were then cultured for 4-6 days until the cell density was about 60%. The cells were centrifuged at 1000 rpm and room temperature for 10 min. The supernatant was centrifuged at 12000 rpm and room temperature for 30 min, and then filtered through a 0.22 μm filter. The quality control antibody was purified using Protein G (cytiva) packing, dialyzed with PBS, and ultrafiltered. The protein concentration was determined using a spectrophotometer, and the protein purity was determined using SDS-PAGE. The results are shown in Table 5 and Figure 5 .

[0096] Table 5 Protein concentration detection results

[0097] Jo-1-T4 Expression Volume (mL) 500 Detection Concentration (mg / mL) 4.72 Final Yield (mg / L) 141.6

[0098] 2.4 Verification of ELISA activity of the antibody

[0099] The expressed antibody was detected using the ELISA method. The Jo-1 antigen was coated on the enzyme-labeled strip, and the coating was performed at 4°C overnight. The plate was washed 3 times. The blocking solution was used to block the enzyme-labeled strip, and the blocking was performed at 37°C for 2 h. The plate was washed 3 times. The sample was added, and the incubation was performed at 37°C for 30 min. The plate was washed 3 times. The human secondary antibody HRP was added, and the incubation was performed at 37°C for 30 min. The plate was washed 3 times. The color was developed for 10 min, and the reaction was stopped. The results are shown in Table 6.

[0100] Table 6 Antibody activity verification results

[0101]

[0102] Example 3 Verification of antibody stability

[0103] In this example, the anti-Jo-1 antibody was prepared into a quality control product using negative blood for stability evaluation.

[0104] 3.1 Heat stability: The prepared Jo-1 quality control was equally divided into four parts, 1 mL per part. One part was placed at -20°C as a control, and the other three parts were placed at 37°C. At the 7th day, 14th day, and 1 month time points, one part was taken out and then placed at -20°C. After 1 month, the four quality controls were detected, and the samples taken out at each time point were compared with the sample stored at -20°C for ELISA detection.

[0105] 3.2 Freeze-thaw stability: The prepared Jo-1 quality control was equally divided into four parts, 1 mL per part. One part was placed at -20°C as a control, and the other three parts were placed at -20°C and then subjected to freezing and thawing for 3 times, 5 times, and 10 times, respectively. After the samples were collected, their activities were analyzed by ELISA. The results are shown in Table 7.

[0106] Table 7 Antibody stability detection results

[0107]

[0108] From the ELISA detection results, the anti-Jo-1 antibody of the application has good stability after 1 month of accelerated stability investigation at 37°C, and its performance is comparable to that of the control group (-20°C storage). After 3 freeze-thaw cycles, its activity is comparable to that before freeze-thawing. After 5 freeze-thaw cycles, its activity decreases by no more than 10%. After 10 freeze-thaw cycles, its activity decreases significantly, close to 50%. The antibody of the application has good heat stability, and storage cannot exceed 5 freeze-thaw cycles.

[0109] Example 4 Application of Jo-1 antibody to immunoblotting

[0110] 4.1 Preparation of the kit (antinuclear antibody spectrum IgG detection kit, DL1590-6401-3G), according to the kit operation manual.

[0111] 4.1.1 All reagents must be equilibrated at room temperature (18-25°C) for 30 minutes before use.

[0112] 4.1.2 Coated antigen detection film strip: direct use. To prevent condensation of the film strip, the packaging can only be opened after the film strip is equilibrated to room temperature. After the film strip is removed, the original packaging should be sealed immediately and stored at 2-8°C.

[0113] 4.1.3 Wash buffer: 10-fold concentrated. When used, the required amount is taken from the bottle with a clean pipette, and diluted 1:10 with distilled water. If incubation of a detection film strip is required, 9 mL of distilled water is used to dilute 1 mL of concentrated buffer. The diluted buffer should be used up on the same day.

[0114] 4.1.4 Sample buffer: direct use.

[0115] 4.1.5 Substrate solution: Use directly, light sensitive, cover bottle immediately after use.

[0116] 4.1.6 Enzyme conjugate: 10X concentrate. When using, pipette the required enzyme conjugate from the bottle using a clean pipette and dilute 1:10 with sample buffer. If incubating one test strip, dilute 0.15 mL of enzyme conjugate with 1.35 mL of sample buffer. Diluted enzyme conjugate should be used on the same day.

[0117] 4.1.7 Jo-1 antibody dilution: Dilute Jo-1 antibody 1:101 with sample buffer. For example: 15 μL of Jo-1 antibody is diluted with 1.5 mL of sample buffer and mixed well. Diluted Jo-1 antibody should be used on the same day.

[0118] 4.2 Western Blotting

[0119] 4.2.1 Pre-treatment:

[0120] Remove the required membrane strip and place it in the incubation slot. The numbered side of the membrane strip should face upwards. Add 1.5 mL of sample buffer to the incubation slot and incubate at room temperature for 5 minutes on a rocking platform. Remove the liquid from the incubation slot.

[0121] 4.2.2 Jo-1 antibody incubation

[0122] Add 1.5 mL of diluted Jo-1 antibody to the incubation slot and incubate at room temperature (18°C to 25°C) for 30 minutes on a rocking platform.

[0123] 4.2.3 Washing:

[0124] Remove the liquid from the slot and wash the membrane strip 3 times with 1.5 mL of wash buffer for 5 minutes on a rocking platform.

[0125] 4.2.4 Enzyme conjugate incubation:

[0126] Add 1.5 mL of diluted enzyme conjugate (anti-human IgG alkaline phosphatase labelled) to the incubation slot and incubate at room temperature for 30 minutes on a rocking platform.

[0127] 4.2.5 Washing:

[0128] Remove the liquid from the slot and wash the membrane strip 3 times with 1.5 mL of wash buffer for 5 minutes on a rocking platform.

[0129] 4.2.6 Substrate incubation:

[0130] Add 1.5 mL of substrate solution to the incubation slot and incubate at room temperature (18°C to 25°C) for 10 minutes on a rocking platform protected from light.

[0131] 4.2.8 Result judgment:

[0132] Place the test strip in the result judgment template, and judge the result after air drying.

[0133] The results are shown in Table 1 Figure 6 From the results of the membrane strip, the screened Jo-1 antibody can specifically bind to the Jo-1 antigen and can be used for Jo-1 autoimmune detection.

[0134] In the above embodiments, the description of each embodiment has its own emphasis, and the parts not described in detail in a certain embodiment can be referred to the related description of other embodiments.

[0135] The above is a specific embodiment of the present application, but the protection scope of the present application is not limited thereto, and any person skilled in the art can easily think of various equivalent modifications or replacements within the technical scope disclosed by the present application, which should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. An anti-Jo-1 antibody or its antigen-binding fragment, characterized in that, Includes variable regions of heavy chains and variable regions of light chains; The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

2.

2. The anti-Jo-1 antibody or its antigen-binding fragment as described in claim 1, characterized in that, It also includes a heavy chain constant region, which includes: The amino acid sequence is CH1 as shown in SEQ ID NO.3; The amino acid sequence is Hinge as shown in SEQ ID NO.4; The amino acid sequence CH2 is as shown in SEQ ID NO.5; and The amino acid sequence is CH3 as shown in SEQ ID NO.

6.

3. The anti-Jo-1 antibody or its antigen-binding fragment as described in claim 1, characterized in that, The antibody or its antigen-binding fragment further includes a light chain constant region CL, the amino acid sequence of which is shown in SEQ ID NO.

7.

4. The anti-Jo-1 antibody or its antigen-binding fragment as described in any one of claims 1-3, characterized in that, The heavy chain amino acid sequence of the antibody or its antigen-binding fragment is shown in SEQ ID NO.8, and the light chain amino acid sequence is shown in SEQ ID NO.

9.

5. A nucleic acid molecule, characterized in that, Encodes the anti-Jo-1 antibody or its antigen-binding fragment as described in any one of claims 1-4.

6. A carrier, characterized in that, It includes the nucleic acid molecule as described in claim 5.

7. A host cell, characterized in that, It comprises the nucleic acid molecule of claim 5 or the vector of claim 6.

8. A detection reagent, characterized in that, The detection reagent comprises the anti-Jo-1 antibody or its antigen-binding fragment as described in any one of claims 1-4.

9. A reagent kit, characterized in that, It includes the anti-Jo-1 antibody or its antigen-binding fragment as described in any one of claims 1-4, or the detection reagent as described in claim 8.

10. Use of the anti-Jo-1 antibody or its antigen-binding fragment according to any one of claims 1-4 in the preparation of a kit for detecting the presence or level of Jo-1 antibody in a sample; or use of the detection reagent according to claim 8 or the kit according to claim 9 in the preparation of a product for detecting the presence or level of Jo-1 antibody in a sample.

Images