Endophytic Guignardia sp. fungal strain HKL13 of Taxus chinensis var. mairei and its application in promoting taxol synthesis

Abstract

The present invention provides a fungal strain HKL13 of the genus Guignardia endophytic in Taxus chinensis var. mairei and its application in promoting the synthesis of paclitaxel. The strain is named Guignardia sp. HKL13, which was deposited at the China Center for Type Culture Collection (CCTCC) on January 26, 2024, with the deposit number CCTCC NO: M2024233. By spraying the cultured spore liquid on the seedlings of Taxus chinensis var. mairei, the strain HKL13 provided by the present invention can effectively promote the biosynthesis of paclitaxel in Taxus chinensis var. mairei, increase the paclitaxel content, and has great production application value.

Description

Technical Field

[0001] The present invention belongs to the field of microbial and plant secondary metabolism regulation. Specifically, it relates to an endophytic Guignardia fungus strain HKL13 of Taxus wallichiana var. mairei and its application in promoting the accumulation of taxol content in Taxus wallichiana var. mairei. Background Art

[0002] Taxus wallichiana var. mairei, also known as the beautiful yew, is a unique tree species in China and belongs to the first-class protected plants in the country. It is a relic tree species of the Quaternary glaciation and is distributed in provinces such as Anhui, Zhejiang, Taiwan, Fujian, Jiangxi, Guangdong, Hubei, and Hunan. Taxus wallichiana var. mairei prefers a humid and shady environment and acidic soil, and has relatively low requirements for soil nutrients and water. According to the "Compendium of Materia Medica" records, the branches and leaves of yew have curative effects such as treating cholera, typhoid, and detoxification, and can be made into yew tea and oral liquid, which is an ancient medicinal material. After researchers discovered that Taxus plants contain the anti-cancer active ingredient taxol, the economic value of yew has increased significantly, resulting in a sharp decline in the population of natural Taxus wallichiana var. mairei. The protection and sustainable development and utilization of yew resources are the key issues affecting the industrialization of taxol.

[0003] Taxol is a highly effective, low-toxic, and broad-spectrum natural anti-cancer drug derived from Taxus plants, with the molecular formula C 47 H 51 NO 14 and has been widely used in the treatment of breast cancer, ovarian cancer, and some head and neck cancers and lung cancers in clinical practice. As a diterpenoid compound with a unique structure, taxol has a special physiological and biochemical mechanism. Taxol can cause the imbalance between human tubulin and tubulin dimers that make up microtubules, promote tubulin polymerization, microtubule assembly, prevent depolymerization, thereby making microtubules super-stable, disrupting the cell cycle, inhibiting the mitosis of cancer cells, and triggering apoptosis, and has a good inhibitory effect on the proliferation of cancer cells.

[0004] Plant endophytic fungi refer to symbiotic fungi existing in disease-free tissues. Since their entire life cycle is symbiotic with host plants, they can often produce a variety of secondary metabolites with novel structures and significant activities. The endophytic fungus Taxomyces andreana isolated from the bark of Taxus brevifolia can produce taxol analogs, which has greatly attracted people's attention. The active ingredients produced by plant endophytic fungi are both the precursors of drugs and important partners in the growth and development of plants. Some endophytic fungi can promote the growth of host plants, enhance the stress resistance of the host, promote the synthesis and accumulation of active ingredients of host plants, and can play a positive role in improving the yield and quality of plants.

[0005] At present, there are many research reports on the diversity, growth-promoting ability of endophytic fungi in Taxus wallichiana var. mairei, and the production of paclitaxel by endophytic fungi. However, there are few related studies on whether endophytic fungi can induce the accumulation of pharmacodynamic components such as paclitaxel in Taxus wallichiana var. mairei. Summary of the Invention

[0006] The first object of the present invention is to provide an endophytic fungus isolated and purified from the Taxus wallichiana var. mairei, a plant of the genus Taxus, in view of the deficiencies of the prior art.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] An endophytic Guignardia fungus strain of Taxus wallichiana var. mairei, taxonomically named Guignardia, Guignardia sp. HKL13, the preservation number of this strain is CCTCC NO: M2024233, the preservation date is January 26, 2024, and the preservation unit: China Center for Type Culture Collection (CCTCC), preservation address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0009] Preferably, its ITS base sequence is as shown in SEQ ID NO.1.

[0010] The second object of the present invention is to provide the use of the above-mentioned endophytic Guignardia fungus strain of Taxus wallichiana var. mairei in promoting the biosynthesis of paclitaxel in Taxus wallichiana var. mairei.

[0011] The third object of the present invention is to provide the use of the above-mentioned endophytic Guignardia fungus strain of Taxus wallichiana var. mairei in promoting the expression of genes related to paclitaxel synthesis in Taxus wallichiana var. mairei.

[0012] The above-mentioned endophytic Guignardia fungus strain of Taxus wallichiana var. mairei has the function of promoting the biosynthesis of paclitaxel in Taxus wallichiana var. mairei plants.

[0013] The fourth object of the present invention is to provide a microbial inoculant containing the above-mentioned endophytic Guignardia fungus strain of Taxus wallichiana var. mairei.

[0014] Preferably, the microbial inoculant is a spore solution.

[0015] Preferably, the spore solution is prepared by the following steps: inoculating the endophytic Guignardia fungus strain HKL13 of Taxus wallichiana var. mairei into a V8 medium at a temperature of 25-30 °C. Wait for the spores to form, and filter with a gauze to obtain a spore-containing solution, which is the spore solution.

[0016] The fifth object of the present invention is to provide a method for increasing the content of paclitaxel in the needles of Taxus wallichiana var. mairei, specifically by spraying the above-mentioned microbial inoculant on the seedlings of Taxus wallichiana var. mairei.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] The present invention provides an endophytic fungal strain HKL13 of Taxus chinensis var. mairei, which is isolated and purified from the plant Taxus chinensis var. mairei. After being prepared into a spore solution, by spraying the filtered spore solution on the twigs of Taxus chinensis var. mairei seedlings, it can effectively promote the biosynthesis of taxol components and the expression of synthesis-related genes, and has high application value. Brief Description of the Drawings

[0019] Figure 1 : Fungi of the genus Guignardia Guignardia sp. Colony morphology of HKL13 on solid medium.

[0020] Figure 2 : Fungi of the genus Guignardia Guignardia sp. Hyphal and spore morphology of HKL13 under an optical microscope.

[0021] Figure 3 : Fungi of the genus Guignardia Guignardia sp. Agarose gel electrophoresis pattern of the ITS sequence of HKL13.

[0022] Figure 4 : Fungi of the genus Guignardia Guignardia sp. Phylogenetic tree of HKL13.

[0023] Figure 5 : Fungi of the genus Guignardia Guignardia sp. Histogram of the increase in taxol content in the leaves of Taxus chinensis var. mairei infected by HKL13.

[0024] Figure 6 : Fungi of the genus Guignardia Guignardia sp. Result diagram of the increase in the expression level of key genes in the taxol pathway in the leaves of Taxus chinensis var. mairei infected by HKL13. Detailed Embodiments

[0025] The following detailed description of the specific embodiments provided by the present invention is given in conjunction with the examples.

[0026] Example 1: Guignardia sp. Isolation, identification and preservation of HKL13:

[0027] The endophytic fungus is obtained according to the following steps:

[0028] (1) Rinse the freshly picked healthy two-year-old stem segments of Taxus chinensis var. mairei under tap water for 30 minutes to remove visible surface sludge. Blot the surface moisture dry with filter paper and place them in a clean workbench. Immerse and disinfect them with 75% alcohol for 1 min. During this process, continuously shake the beaker to ensure full contact between the Taxus tissue and the alcohol. Then wash three times with sterile water to remove the residual alcohol on the tissue surface. Next, wash the stem segments of Taxus chinensis var. mairei with 0.1% HgCl2 for 5 min, and place the plant material in a clean beaker and wash 4 to 5 times to remove the residual HgCl2 on the tissue surface. To verify whether the disinfection is thorough, take 100 μL of the sterile water from the last wash and spread it as a control. If no contaminants grow after culturing for 3 - 5 d at 26°C, the disinfection is considered effective.

[0029] (2) Use a scalpel to peel the disinfected stem nodes, and cut the stem bark into 5-mm small segments; lay the treated plant material flat on the PDA medium, and place five pieces of material in each petri dish. Incubate at a constant temperature of 26°C in the dark. Mycelia will grow from the tissue blocks after culturing for three to seven days. Every 12 hours after inoculation, transfer the mycelia from the edge of the stem bark wound to a new PDA plate with an inoculation needle. Observe the phenotypic characteristics of the transferred fungal colonies, pick the mycelia at the edge of a single colony, and streak-culture on a new PDA plate. After continuous purification 3 times, pick a small amount of mycelia and observe under a microscope. If there are no contaminants, it can be considered a single strain. After obtaining a single strain, inoculate it on a PDA slant and store it at 4°C. As Figure 1 shown, the solid culture characteristics of HKL13 are a dark gray colony with wrinkles at the colony edge. The morphological characteristics under the microscope are dark gray mycelia that cross each other and have dark spores, as Figure 2 shown.

[0030] The formula of the PDA medium described in the present invention is: 200.0 g / L of potato, 50.0 g / L of glucose, 6.0 g / L of NH4NO3, 0.3 g / L of anhydrous MgSO4, 0.5 g / L of KH2PO4, and 0.05 g / L of vitamin B1.

[0031] (3) Extract the DNA of the endophytic fungal strain of Taxus chinensis var. mairei using the TIANGEN Plant Genomic DNA Extraction Kit. Using this as a template, amplify the ITS sequence with primers ITS4 (SEQ ID NO.2: 5’-TCCTCCGCTTTATTGATATGC-3’) and ITS5 (SEQ ID NO.3: 5’-GGAAGTAAAGTCGTAACAAGG-3’). The PCR reaction system is 2×Taq MasterMix (Dye), 25 μL; ITS5 (10 μM), 2 μL; ITS4 (10 μM), 2 μL; Template DNA, 3 μL; ddH2O, 18 μL. The PCR reaction program is pre-denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, with 30 cycles of denaturation-annealing-extension, and final extension at 72°C for 2 min. Detect whether the amplification is successful by 1% agarose gel electrophoresis. Send the successful PCR product to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The ITS sequence of this endophytic fungus HKL13 was amplified by PCR, and the gel electrophoresis diagram of its product is as Figure 3 shown, and its ITS base sequence is as shown in SEQ ID NO.1.

[0032] (4) Submit the sequencing results returned by the company to the NCBI website for comparison. The similarity between the target sequence and Guignardiamusicola NR_137716 is 99.49%. Therefore, the endophytic fungus of the present invention is named Guignardia sp. HKL13. This fungus has been deposited, and the deposit number is CCTCC NO: M2024233. The depository unit is the China Center for Type Culture Collection (CCTCC), and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0033] Example 2: Construction and analysis of the homologous phylogenetic tree of the endophytic fungus HKL13

[0034] Using the ITS sequence of the endophytic fungus HKL13 as the target sequence, search for homologous sequences in the GenBank database of NCBI. Download the sequence most similar to the ITS sequence of the endophytic fungus HKL13 as the reference sequence. Construct a phylogenetic tree using the neighbor-joining (NJ) method. Randomly select 1 sequence and repeat the alignment 1000 times to determine the phylogenetic status of the endophytic fungus HKL13 strain. The phylogenetic tree is as Figure 4 shown.

[0035] Example 3: Preparation and application of the spore liquid of the endophytic fungus HKL13 of Taxus chinensis var. mairei

[0036] (1) Use an inoculation needle to pick up an endophytic fungus block of Taxus chinensis var. mairei with a size of about 5 mm×5 mm preserved on a slant, invert it on a V8 medium, and culture it in the dark at a constant temperature of 26°C for 5 - 7 days until the fungus produces spores. Add 2 mL of sterile water to the solid plate, scrape the mycelium and spores with a spreader to obtain a mixed solution. Fold three layers of gauze into a funnel shape, and filter the mixed solution at the ninth layer to obtain a spore solution (all the above steps are completed in a laminar flow hood). Count the spores under an optical microscope, and adjust the concentration of the obtained fungal spore solution to 1×10 6 cells / mL for standby.

[0037] (2) Lay a wet sterile filter paper in a tray, cut about 20 cm long Taxus chinensis var. mairei stems and leaves of similar age, wash them 2 - 3 times with sterile water, and place the lower epidermis of the leaves upward on the filter paper. Evenly spray 20 mL of the fungal spore solution onto the leaf surface, and spray an equal amount of sterile water on the control group (CK). Wrap the tray with plastic wrap and let it stand for 48 h, then cut the leaves, wash them with sterile water, quickly freeze them in liquid nitrogen, and store them in a -80°C refrigerator for standby.

[0038] Example 4: Effect of Endophytic Fungus HKL13 on the Taxol Content in Taxus chinensis var. mairei Leaves

[0039] (1) Pre-cool all extraction reagents at -20°C before use. Weigh 60 mg of leaves into a 1.5 mL centrifuge tube, add appropriate small steel beads and 600 μL of methanol-water (V:V = 7:3, containing a mixed internal standard, 4 μg / mL); pre-cool in a -40°C refrigerator for 2 min, then put it into a grinder and grind at 60 Hz for 2 min; ultrasonically extract in an ice-water bath for 30 min, and let it stand overnight at -40°C; centrifuge at 12000 rpm at low temperature for 10 min, suck 150 μL of the supernatant with a syringe, filter it through a 0.22 μm organic phase syringe filter, transfer it to an LC injection vial, and store it at -80°C for standby; mix the extraction solutions of all samples in equal volume to prepare a quality control sample (QC).

[0040] (2)The samples were detected using a Waters ACQUITY UPLC I-Class plus ultra-high performance liquid chromatography tandem high-resolution mass spectrometer. Chromatographic conditions: Chromatographic column: ACQUITY UPLC HSS T3 (100 mm×2.1 mm, 1.8 μm); Column temperature: 45 °C; Mobile phase: water (containing 0.1% formic acid), acetonitrile; Flow rate: 0.35 mL / min; Injection volume: 3 μL; Elution gradient: At 0 min, the volume ratio of water to acetonitrile was 95:5, at 4 min it was 70:30, at 8 min it was 50:50, at 10 min it was 20:80, at 14 min it was 0:100, and at 15.1 min it was 95:5. The separated samples were subjected to mass spectrometry analysis. Mass spectrometry conditions: The sample mass spectrometry signals were collected by separate scanning of positive and negative ions, and the specific acquisition mode was the DDA (data dependent acquisition) data-dependent scanning mode.

[0041] (3)The transition between the mass-to-charge ratio (m / z) of 876.4→308.1 was used for the quantitative analysis of paclitaxel, and the transitions between the mass-to-charge ratio (m / z) of 876.4→531.2 and 876.4→591.4 were used for the verification analysis of paclitaxel. The paclitaxel (≥99%; CAS: 33069-62-4) standard was purchased from Aladdin Biochemical Technology (Shanghai, China) Co., Ltd. The differences in the paclitaxel content of Taxus chinensis var. mairei under the treatment of endophytic fungus HKL13 are as Figure 5 shown, where CK is the control group and HKL13 is the experimental group.

[0042] Example 5: Effects of endophytic fungus HKL13 on the expression levels of genes related to paclitaxel synthesis in Taxus chinensis var. mairei leaves

[0043] (1)The total RNA of the HKL13 experimental group and the control group was extracted using the TIANGEN RNAprep Pure Plant Kit. After passing the quality inspection, transcriptome library construction and sequencing were carried out. The integrity of the total RNA of the samples was detected using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and a transcriptome library was constructed using the VAHTS Universal V5 RNA-seq Library Prep kit. The library was sequenced using the Illumina Novaseq 6000 sequencing platform to generate 150 bp paired-end reads; the fastp software was used for processing to obtain clean reads for subsequent data analysis.

[0044] (2)Perform genome alignment of *Taxus chinensis* var. *mairei* using HISAT2 software, calculate gene expression levels (FPKM), and obtain read counts for each gene through HTSeq-count; use R (v 3.2.0) to perform PCA analysis and plotting of samples to evaluate sample biological replicates. Use DESeq2 software for differential expression gene analysis, and define differentially expressed genes (DEGs) as genes that meet the thresholds of P value < 0.05 and fold change > 2 or fold change < 0.5.

[0045] (3)The genes related to taxol synthesis in *Taxus chinensis* var. *mairei* to be detected and their IDs are: TS (ctg5306_gene.4), TS (ctg7747_gene.1), T13OH (ctg593_gene.12), TBT (ctg4165_gene.7), T5OH (ctg11276_gene.1), DBTNBT (ctg195_gene.25), and T7OH (ctg12564_gene.1). The differences in the expression levels of genes related to taxol synthesis in *Taxus chinensis* var. *mairei* under the treatment of endophytic fungus HKL13 are as Figure 6 shown.

[0046] SEQ ID NO.1: HKL13

[0047] gcttgtactgcggaggacattactgaatgtaataacttctattgaaaggttccagagtaggcgctacaacgccgaaatgaccttctcacccttgtgtactcactatgttgctttggcgggtcgacctggttccgacccaggcggccggcgcccccagccttaactggccaggacgcccggctaagtgcccgccagtatacaaaactcaagaattcattttgtgaagtcctgatatatcatttaattgattaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccctctggtattccggagggcatgcctgttcgagcgtcatttcaaccctcaagctctgcttggtattgggcaacgtccgctgccggacgtgccttgaagacctcggcgacggcgtcctagcctcgagcgtagtagtaaaatatctcgctttggagtgctgggcgacggccgccggacaatcgaccttcggtctatttttccaaggttgacctcggatcaggtagggatacccgctgaacttaagcataca

Claims

1. A fungal strain of the genus genus endophytic sphaerocephala of Taxus chinensis, characterized in that: The strain is Guignardia sp. HKL13, the deposit number is CCTCC NO: M2024233, the deposit date is January 26, 2024, the depository is China Center for Type Culture Collection, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. Use of the endophytic Glomerella fungus strain of Taxus chinensis as claimed in claim 1 in promoting the biosynthesis of paclitaxel in Taxus chinensis.

3. A microbial agent, characterized in that: The microbial agent contains the endophytic Glomerella fungus strain of Taxus chinensis as claimed in claim 1.

4. The microbial agent according to claim 3, characterized in that: The microbial agent is spore liquid.

5. The microbial agent according to claim 4, characterized in that: The spore liquid is prepared by the following steps: inoculating the endophytic Glomerella fungus strain HKL13 of Taxus chinensis into a PDB solid culture medium, culturing in an incubator at a temperature of 28° C. for 5 to 7 days, and filtering under reduced pressure to obtain a spore-containing solution after spores are generated, namely the spore liquid.

6. A method for increasing the content of paclitaxel in the needles of Taxus chinensis var. mairei, characterized in that: The method comprises: spraying the microbial agent described in claim 3 on the seedlings of Taxus chinensis var. mairei.

Images