Outer membrane vesicle composition for protection against group b meningococcal infection, method of manufacture and use

Abstract

The present application provides a kind of protecting group B meningococcal infection outer membrane vesicle composition, the outer membrane vesicle composition is by lipopolysaccharide modified group B meningococcal outer membrane vesicle and the outer membrane vesicle of group B meningococcal bacterium expressing recombinant protein is composed.The outer membrane vesicle composition provided by the present application has better protective effect on group B meningococcal infection relative to single strain outer membrane vesicle, and is more suitable for use as vaccine.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a composition of outer membrane vesicles for protecting against infection by group B meningococcus and a method of preparation and use thereof. BACKGROUND

[0002] Neisseria meningitidis is a gram-negative diplococcus, and humans are the only natural host, which is usually colonized in the nasopharynx. Epidemic cerebrospinal meningitis is a global serious respiratory infectious disease caused by infection with Neisseria meningitidis (or meningococcus). In the past more than one hundred years, it has caused periodic epidemics or sporadic outbreaks of epidemic cerebrospinal meningitis worldwide, with a high incidence and mortality rate. According to the structure and antigenic difference of the bacterial surface capsular polysaccharide, it is divided into 13 different serogroups, and most cases are caused by A, B, C, W135 and Y group strains.

[0003] The outer membrane of meningococcus is a high molecular complex composed of outer membrane protein (OMP), lipoprotein and lipooligosaccharide (LOS), which forms a vesicular structure in the natural state, also known as outer membrane vesicle (OMV), and the main immunogenicity is outer membrane protein. Group B meningococcal strains have diverse phenotypic and genotypic characteristics, but the strains that often cause outbreaks or epidemics of group B meningococcus may belong to a dominant clonal group. Therefore, monovalent OMV vaccine is difficult to protect and resist diseases caused by different group B meningococcal strains.

[0004] At present, people have not yet studied how to develop mutant strains with protection against group B meningococcal infection through genetic engineering, which has slowed down the development of mutant outer membrane vesicles with high efficiency in protecting against group B meningococcal infection. Therefore, it is more difficult to develop the corresponding outer membrane vesicle composition on this basis. SUMMARY

[0005] In view of the shortcomings of the prior art, the purpose of the present application is to provide a composition of outer membrane vesicles for protecting against infection by group B meningococcus, and the components of the composition have a synergistic effect in protecting against infection by group B meningococcus.

[0006] In order to achieve the above-mentioned purpose, the present application provides the following technical scheme:

[0007] A composition of outer membrane vesicles for protecting against infection by group B meningococcus, the outer membrane vesicle composition is composed of lipopolysaccharide modified outer membrane vesicles of group B meningococcus and outer membrane vesicles of group B meningococcus expressing recombinant protein;

[0008] The lipopolysaccharide-modified group B meningococcus is classified as Neisseria sp., with accession number CGMCC No. 36402, deposited at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, on July 19, 2024.

[0009] The group B meningococcus expressing the recombinant protein is classified as Neisseria meningitidis, with accession number CGMCC No. 31404, deposited at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, on July 30, 2024.

[0010] The lipopolysaccharide-modified group B meningococci are a knockout of group B meningococci. lptA Gene overexpression at this gene site lpxE Obtained after gene editing;

[0011] The group B meningococci expressing recombinant proteins express recombinant proteins Neisserial Heparin Binding Antigen (NHBA), fHbp, and Neisseria adhesin A (NadA) via the self-transport system Hbp.

[0012] The group B meningococcus expressing the recombinant protein was prepared by the following method:

[0013] (1) Gene expression fragments of NHBA, fHbp and NadA antigens were constructed in plasmids using the Hbp protein self-transport system;

[0014] (2) The plasmid was transferred into a group B meningococcal background strain by electroporation;

[0015] The method for constructing the plasmid includes the following steps:

[0016] 1) The Hbp self-transport system expression cassette derived from group B meningococcus was cloned into the vector pYA3332 in one step using the Gibson assembly kit;

[0017] 2) The coding gene sequences of the recombinant proteins NHBA, fHbp and NadA of group B meningococcal antigens were cloned into the Hbp self-transport system expression cassette using the Gibson assembly kit to express the three antigens onto the outer membrane surface of group B meningococci.

[0018] The method for constructing expression plasmid vectors for the Hbp self-transport system includes the following steps:

[0019] 1) Primer design:

[0020] Hbp-F: 5'CTGACCTTGGACGCGCCACCGGTTTAAG3'

[0021] Hbp-R: 5'AACCTTGCGCGATGAGCATAAGCGTACAGCCTG 3'

[0022] 2) Genomic DNA of group B meningococcus in the logarithmic growth phase was extracted as a template, and the corresponding primers were used to amplify the corresponding fragments using the linearized plasmid pYA3332 as a template. The amplification products were obtained by one-step cloning using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp.

[0023] The method for constructing expression plasmids for NHBA, fHbp, and NadA antigens includes the following steps:

[0024] 1) Primer design:

[0025] NHBA-F: 5'TGCTGACAAAGAACTGGGATGTTTGAACGCAGTGTGATTG3'

[0026] NHBA-R: 5'GAAACAGTTCCTGAGTCTCAATCCTGCTCTTTTTT3'

[0027] fHbp-F: 5'TGCCACCCTGAGTCTGAACAGGTGAACCGAACTGCCTTCTGCTGC3'

[0028] fHbp-R: 5'CGCTGTTACGACGCATTGAGATTATTGCTTGGCTTCAAGACC3'

[0029] NadA-F: ​​5'TGCCACCCTGAGTCTGAACAGCATGCAAACCGCCCGCCGCCGCTC3'NadA-R: 5'CGCTGTTACGACGCATTGAGACTCAGGCGGGTCCCATGCC3'

[0030] pYA3332-Hbp-NHBA-F: 5'CAATCACACTGCGTTTGACGTAACTGACGATTGC3'

[0031] pYA3332-Hbp-NHBA-R:5'AAAAAGAGCAGGATTGCAGTAAACCTTGGCGACGTG3'

[0032] pYA3332-Hbp-fHbp-F: 5'GCAGCAGAAGGCAGAGCGCCGGCCTGAAGGTAATC3'

[0033] pYA3332-Hbp-fHbp-R: 5'GGTCTTGAAGCCAAGCTGCGCCGAGAGCGATTGA3'

[0034] pYA3332-Hbp-NadA-F:5'GAGCGGCGGCGGCGGTTAAGCGCCGGCCTGAAGGTA

[0035] ATC3'

[0036] pYA3332-Hbp-NadA-R: 5'GGCATGGGACCCGCCTGAGCGCCGAGAGCGATTGA3'

[0037] 2) The sequence corresponding to NHBA was amplified using primers NHBA-F and NHBA-R with Neisseria meningitidis group B as a template. The vector fragment was amplified using primers pYA3332-Hbp-NHBA-F and pYA3332-Hbp-NHBA-R with pYA3332-Hbp as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The product was transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA.

[0038] 3) Using primers fHbp-F and fHbp-R, the sequence corresponding to fHbp was amplified using Neisseria meningitidis group B as a template. Using primers pYA3332-Hbp-fHbp-F and pYA3332-Hbp-fHbp-R, the vector fragment was amplified using pYA3332-Hbp-NHBA as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp.

[0039] 4) Using primers NadA-F and NadA-R, the sequence corresponding to NadA was amplified using Neisseria meningitidis group B as a template. Using primers pYA3332-Hbp-NadA-F and pYA3332-Hbp-NadA-R, the vector fragment was amplified using pYA3332-Hbp-NHBA-fHbp as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp-NadA.

[0040] Specifically, the lipopolysaccharide-modified group B meningococcus is obtained by constructing the gene lpxE, which forcibly expresses phosphate synthase LpxE, into the upstream and downstream homologous arms of the knockout lptA gene through homologous recombination, forming a genotype that knocks out lptA while expressing lpxE, and obtaining a group B meningococcus mutant strain with the optimal lipid A structure that can efficiently activate the TLR4 receptor.

[0041] The plasmid pRE112-lptA / Ptrc-lpxE used in the homologous recombination process is constructed as follows:

[0042] Based on the gene sequence NZ_LR134326.1 in GenBank, primers were designed to insert the lpxE sequence into the middle of the lptA homologous arm. The primers are as follows:

[0043] lptA-3F:5'TGAGACGCTGACGATAATTGC3'

[0044] lptA-3R: 5'CGATGAAATTTGCGCGATGACG3'

[0045] lpxE-1F: 5'CCGAGACTTTGACGTAGACGTGACGTGACGATGACG3'

[0046] lpxE-1R: 5'CGACGATAGCGATGACGATTGACGATTAACCGT3';

[0047] Genomic DNA was extracted from the reference strain of Bordetella bronchiseptica in the logarithmic growth phase and used as a template. The full-length fragment of lpxE was amplified using lpxE-1F and lpxE-1R, respectively. Then, using pRE112-lptA plasmid as a template, the products were amplified using lptA-3F and lptA-3R. The two PCR products were then cloned using a one-step method. The reaction products were electroporated into the competent cells of engineered Escherichia coli χ7232 to obtain the recombinant plasmid pRE112-lptA / Ptrc-lpxE.

[0048] Preferably, the weight ratio of the lipopolysaccharide-modified outer membrane vesicles of group B meningococci to the outer membrane vesicles of group B meningococci expressing recombinant proteins is 2:1.

[0049] The present invention also provides a method for preparing the above-mentioned outer membrane vesicle composition, wherein the outer membrane vesicle composition is obtained by mixing the above-mentioned lipopolysaccharide-modified group B meningococcal outer membrane vesicles and group B meningococcal outer membrane vesicles expressing recombinant proteins.

[0050] The present invention also provides the use of the above composition in the preparation of a drug for protecting against group B meningococcal infection. Specifically, the composition is used as a vaccine for protecting against group B meningococcal infection.

[0051] As shown in the embodiments of the present invention, when preparing lipopolysaccharide-modified serogroup B meningococci, the immunoprotective level produced by the outer membrane vesicles obtained from mutant strains that knock out only the lipid A synthesis-related gene lptA or knock out lptA while simultaneously expressing pagL is significantly worse than that of the outer membrane vesicles obtained from the strains of the present invention. Based on the obtained lipopolysaccharide-modified serogroup B meningococci, the present invention found that combining the outer membrane vesicles of serogroup B meningococci expressing recombinant proteins of the present invention with the outer membrane vesicles of lipopolysaccharide-modified serogroup B meningococci can significantly enhance the protective effect against serogroup B meningococcal infection. Therefore, the present invention greatly improves the application value of lipopolysaccharide-modified serogroup B meningococci.

[0052] The beneficial effects of this invention are:

[0053] The outer membrane vesicle composition provided by this invention has a better protective effect against group B meningococcal infection compared to single-strain outer membrane vesicles, and is more suitable for use as a vaccine. Attached Figure Description

[0054] Figure 1 Figure 1 shows the results of the assay of the ability of different lipopolysaccharide-modified group B meningococcal outer membrane vesicles to stimulate TLR4 receptor activation.

[0055] Figure 2Figure 1 shows the results of serum IgG antibody levels in mice immunized with group B meningococcal outer membrane vesicles modified with different lipopolysaccharides.

[0056] Figure 3 Figure showing the results of evaluating the immunoprotective level of different lipopolysaccharide-modified group B meningococcal outer membrane vesicles in an adult mouse infection model;

[0057] Figure 4 Figure showing the results of evaluating the protective level of different lipopolysaccharide-modified group B meningococcal outer membrane vesicles in a neonatal rat bacteremia model;

[0058] Figure 5 Figure showing the results of serum IgG antibody levels in mice immunized with different outer membrane vesicles and their combinations;

[0059] Figure 6 The results of evaluating the protective level against group B meningococcal infection by different combinations of outer membrane vesicles in an adult mouse infection model are shown in the figure.

[0060] Figure 7 The figure shows the results of evaluating the protective level against group B meningococcal infection by different combinations of outer membrane vesicles in a neonatal rat bacteremia infection model. Detailed Implementation

[0061] The present invention will be specifically described below through embodiments. It should be noted that the following embodiments are only used to further illustrate the present invention and should not be construed as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above-described invention are still within the scope of protection of the present invention.

[0062] Example 1: Construction of lipopolysaccharide-modified group B meningococci

[0063] 1. Construction of the homologous recombination plasmid pRE112-lptA containing upstream and downstream homologous arms of the lptA gene:

[0064] Based on the complete genome sequence of the serogroup B Neisseria meningitidis reference strain published in GenBank (accession number GCF_008330805.1), the left and right homologous arms of the lptA gene were designed, and the following primers were used:

[0065] lptA-1F:5'CCGATTAGCGATGACGATCG3'

[0066] lptA-2R: 5'CTACGAGCGATGACGAAAATTTGCGATGCGCGTA3'

[0067] lptA-2F: 5'CTATATATTTTAAACGCGTAGATGCGTAGCTGACTGA3'

[0068] lptA-2R: 5'CTGTGTCGAAATTGACGATAGCTGA3'.

[0069] Genomic DNA was extracted from serogroup B Neisseria meningitidis in the logarithmic growth phase and used as a template. The corresponding upstream and downstream homologous arm fragments were amplified to obtain amplification products of the left and right homologous arms. The amplification products were then amplified by overlap PCR using primers 1F and 2R. The upstream and downstream arm fragments were ligated using overlap PCR. The suicide plasmid vector pYA4278 was then digested with Ahd I. The digestion product was ligated with the pre-PCR-amplified fusion fragment and transformed into Escherichia coli engineered competent cells χ7232 to obtain the recombinant plasmid pRE112-lptA.

[0070] The sequence of lptA is shown in SEQ ID No. 1, as follows:

[0071] .

[0072] 2. Construction of the homologous recombinant plasmid pRE112-lptA / Ptrc-lpxE containing upstream and downstream homologous arms of lptA and stably expressing lpxE derived from Bordetellabronchiseptica at the knockout gene site.

[0073] Based on the published gene sequence of the phosphatasePAP2 family protein (lpxE) of the Bordetella bronchiseptica reference strain (accession number NZ_LR134326.1) in GenBank, an insertion of the lpxE sequence into the middle of the lptA homologous arm was designed, and the following primers were used:

[0074] lptA-3F:5'TGAGACGCTGACGATAATTGC3'

[0075] lptA-3R: 5'CGATGAAATTTGCGCGATGACG3'

[0076] lpxE-1F: 5'CCGAGACTTTGACGTAGACGTGACGTGACGATGACG3'

[0077] lpxE-1R: 5'CGACGATAGCGATGACGATTGACGATTAACCGT3'.

[0078] Genomic DNA was extracted from the reference strain of Bordetella bronchiseptica in the logarithmic growth phase and used as a template. The full-length fragment of lpxE was amplified using lpxE-1F / lpxE-1R. Then, using pRE112-lptA plasmid as a template, the product was amplified using lptA-3F / lptA-3R. The two PCR products were then cloned using a one-step cloning method (Gibson Assembly) and electroporated into the competent Escherichia coli χ7232 engineered cells to obtain the recombinant plasmid pRE112-lptA / Ptrc-lpxE.

[0079] The sequence of lpxE is shown in SEQ ID No. 2, as follows:

[0080] .

[0081] 3. Construction of the homologous recombinant plasmid pRE112-lptA / Ptrc-pagL, containing upstream and downstream homologous arms of lptA and stably expressing pagL from Bordetellabronchiseptica at the knockout gene site.

[0082] Based on the published gene sequence of acyloxyacylhydrolase (pagL) from the Bordetella bronchiseptica reference strain (NZ_LR134326.1) in GenBank, a pagL sequence was designed to be inserted into the middle of the lptA homologous arm, and the following primers were used:

[0083] lptA-4F: 5'TGAGCTGACGATGGAACCTGA3'

[0084] lptA-4R: 5'GGCTGACTGACGTAGAGATCG3'

[0085] pagL-1F: 5'CCGCGTAAATTTGCTATGATGCGATGAATGACGTAG3'

[0086] pagL-1R: 5'CCTATTTAAAGGGTTATGACTAGATGA3'.

[0087] Genomic DNA was extracted from the reference strain NCTC10543_03471 of Bordetella bronchiseptica in logarithmic growth phase and used as a template. The full-length pagL fragment was amplified using pagL-1F / pagL-1R. Then, using pRE112-lptA plasmid as a template, the product was amplified using lptA-3F / lptA-3R. The two PCR products were then cloned using a one-step Gibson assembly method. The reaction products were electroporated into competent Escherichia coli χ7232 cells to obtain the recombinant plasmid pRE112-lptA / Ptrc-pagL.

[0088] The sequence of pagL is shown in SEQ ID No. 3, as follows:

[0089] .

[0090] 4. Preparation of lipopolysaccharide-modified group B meningococci:

[0091] (1) Prepare serogroup B meningococcal meningitidis QL00020 electrocompetent cells; (2) Transform pRE112-lptA, pRE112-lptA / Ptrc-lpxE, and pRE112-lptA / Ptrc-pagL into serogroup B meningococcal meningitidis QL00020 electrocompetent cells by electroporation (2500V shock for 4ms); (3) Add 100μL of preheated [unclear - possibly a specific ingredient or substance] to the liquid in the electroporation vessel. In the enrichment broth, gently blow out the mixture and spread it on a chocolate agar plate containing chloramphenicol resistance (CmR). Incubate overnight at 37°C. The resulting single clone is the successfully electroporated bacteria. (4) Mutant strains that do not contain lptA and express the corresponding gene were obtained by PCR screening, namely QL00021 (△lptA), QL00022 (△lptA / Ptrc-lpxE) and QL00023 (△lptA / Ptrc-pagL).

[0092] Example 2: Preparation of lipopolysaccharide-modified outer membrane vesicles of group B meningococci.

[0093] The mutant strains QL00021 (△lptA), QL00022 (△lptA / Ptrc-lpxE), and QL00023 (△lptA / Ptrc-pagL) obtained in Example 1 were used. First, single colonies were cultured. Overnight, the bacteria were inoculated into 2 L of liquid enrichment broth at a ratio of 1:100 and cultured at 37°C for 24-32 hours until the OD value reached 1. The bacteria were then centrifuged at 4°C and 10,000 × g to remove the bacterial cells. The collected supernatant was filtered through a 0.45 μm filter to remove residual bacterial cells. The outer membrane vesicles in the supernatant were then collected by ultracentrifugation (2 h, 40,000 × g, 4°C). The collected outer membrane vesicles were resuspended in DPBS and filtered again through a 0.45 μm filter. The initially obtained outer membrane vesicles still needed to be purified by density gradient centrifugation. Using 10 mM HEPES buffer containing 0.85% NaCl as a diluent, a discontinuous density gradient centrifugation apparatus was prepared by mixing 2 ml of the buffer solution per layer, for a total of 8 layers, with concentrations ranging from 20% to 45%. The outer membrane vesicles collected in the previous step were added to the top layer of the density gradient centrifugation apparatus and centrifuged overnight at 200,000 × g at 4°C. The large density gradient layers containing outer membrane vesicles were collected by ultracentrifugation (40,000 × g, 4°C, 1 h), washed once with DPBS to remove impurities, and stored at -80°C for later use.

[0094] Example 3 Construction of Group B meningococci expressing recombinant proteins

[0095] Group B meningococci expressing recombinant proteins were prepared by the following method:

[0096] (1) Gene expression fragments of NHBA, fHbp and NadA antigens were constructed in plasmids using the Hbp protein self-transport system;

[0097] (2) The plasmid was transferred into a background strain of group B meningococcus (purchased from Beina Biotechnology (https: / / www.bncc.com / ), catalog number: BNCC359481) by electroporation;

[0098] The method for constructing the plasmid includes the following steps:

[0099] 1) The Hbp self-transport system expression cassette derived from group B meningococcus was cloned into the vector pYA3332 in one step using the Gibson assembly kit;

[0100] 2) The coding gene sequences of the recombinant proteins NHBA, fHbp and NadA of group B meningococcal antigens were cloned into the Hbp self-transport system expression cassette using the Gibson assembly kit to express the three antigens onto the outer membrane surface of group B meningococci.

[0101] The method for constructing expression plasmid vectors for the Hbp self-transport system includes the following steps:

[0102] 1) Primer design:

[0103] Hbp-F: 5'CTGACCTTGGACGCGCCACCGGTTTAAG3'

[0104] Hbp-R: 5'AACCTTGCGCGATGAGCATAAGCGTACAGCCTG 3'

[0105] 2) Genomic DNA of group B meningococcus in the logarithmic growth phase was extracted as a template, and the corresponding primers were used to amplify the corresponding fragments using the linearized plasmid pYA3332 as a template. The amplification products were obtained by one-step cloning using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp.

[0106] The method for constructing expression plasmids for NHBA, fHbp, and NadA antigens includes the following steps:

[0107] 1) Primer design:

[0108] NHBA-F: 5'TGCTGACAAAGAACTGGGATGTTTGAACGCAGTGTGATTG3'

[0109] NHBA-R: 5'GAAACAGTTCCTGAGTCTCAATCCTGCTCTTTTTT3'

[0110] fHbp-F: 5'TGCCACCCTGAGTCTGAACAGGTGAACCGAACTGCCTTCTGCTGC3'

[0111] fHbp-R: 5'CGCTGTTACGACGCATTGAGATTATTGCTTGGCTTCAAGACC3'

[0112] NadA-F: ​​5'TGCCACCCTGAGTCTGAACAGCATGCAAACCGCCGCCGCCGCTC3'

[0113] NadA-R: 5'CGCTGTTACGACGCATTGAGACTCAGGCGGGTCCCATGCC3'

[0114] pYA3332-Hbp-NHBA-F: 5'CAATCACACTGCGTTTGACGTAACTGACGATTGC3'

[0115] pYA3332-Hbp-NHBA-R:5'AAAAAGAGCAGGATTGCAGTAAACCTTGGCGACGTG3'

[0116] pYA3332-Hbp-fHbp-F: 5'GCAGCAGAAGGCAGAGCGCCGGCCTGAAGGTAATC3'

[0117] pYA3332-Hbp-fHbp-R: 5'GGTCTTGAAGCCAAGCTGCGCCGAGAGCGATTGA3'

[0118] pYA3332-Hbp-NadA-F: ​​5'GAGCGGCGGCGGCGGTTAAGCGCCGGCCTGAAGG

[0119] TAATC3'

[0120] pYA3332-Hbp-NadA-R: 5'GGCATGGGACCCGCCTGAGCGCCGAGAGCGATTGA3'

[0121] 2) The sequence corresponding to NHBA was amplified using primers NHBA-F and NHBA-R with Neisseria meningitidis group B as a template. The vector fragment was amplified using primers pYA3332-Hbp-NHBA-F and pYA3332-Hbp-NHBA-R with pYA3332-Hbp as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The product was transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA.

[0122] 3) Using primers fHbp-F and fHbp-R, the sequence corresponding to fHbp was amplified using Neisseria meningitidis group B as a template. Using primers pYA3332-Hbp-fHbp-F and pYA3332-Hbp-fHbp-R, the vector fragment was amplified using pYA3332-Hbp-NHBA as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp.

[0123] 4) Using primers NadA-F and NadA-R, the sequence corresponding to NadA was amplified using Neisseria meningitidis group B as a template. Using primers pYA3332-Hbp-NadA-F and pYA3332-Hbp-NadA-R, the vector fragment was amplified using pYA3332-Hbp-NHBA-fHbp as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp-NadA.

[0124] Example 4: Preparation of Group B meningococcal outer membrane vesicles expressing recombinant protein

[0125] The bacterial strain obtained in Example 3 was used. First, single colonies were cultured. Overnight, the bacteria were inoculated into 2 L of liquid enrichment broth at a ratio of 1:100 and cultured at 37°C under a microaerophilic environment for 24-32 hours until the OD value reached 1. The bacteria were then centrifuged at 4°C and 10,000 × g to remove the bacterial cells. The collected supernatant was filtered through a 0.45 μm filter to remove residual bacterial cells. The outer membrane vesicles in the supernatant were then collected by ultracentrifugation (2 h, 40,000 × g, 4°C). The collected outer membrane vesicles were resuspended in DPBS and filtered again through a 0.45 μm filter. The initially obtained outer membrane vesicles still needed to be purified by density gradient centrifugation. Using 10 mM HEPES buffer containing 0.85% NaCl as a diluent, a discontinuous density gradient centrifugation apparatus was prepared by mixing 2 ml of the buffer solution per layer, for a total of 8 layers, with concentrations ranging from 20% to 45%. The outer membrane vesicles collected in the previous step were added to the top layer of the density gradient centrifugation apparatus and centrifuged overnight at 200,000 × g at 4°C. The large density gradient layers containing outer membrane vesicles were collected by ultracentrifugation (40,000 × g, 4°C, 1 h), washed once with DPBS to remove impurities, and stored at -80°C for later use.

[0126] In the above preparation process, Neisserial Heparin Binding Antigen (NHBA) is derived from group B Neisseria meningitidis, and its sequence is shown in SEQ ID No. 4:

[0127]

[0128] fHbp is derived from Neisseria meningitidis serogroup B, and the sequence is as shown in SEQ ID No.5, which is:

[0129] gtgaaccgaactgccttctgctgcttttctctgaccgccgccctgattctgaccgcctgcagcagcggaggcggcggtgtcgccgccgacatcggcgcggggcttgccgatgcactaaccgcaccgctcgaccataaagacaaaagtttgcagtctttgacgctggatcagtccgtcaggaaaaacgagaaactgaagctggcggcacaaggtgcggaaaaaacttatggaaacggcgacagccttaatacgggcaaattgaagaacgacaaggtcagccgtttcgactttatccgtcaaatcgaagtggacgggcagctcattaccttggagagcggagagttccaagtgtacaaacaaagccattccgccttaaccgcccttcagaccgagcaagaacaagatccagagcattccgggaagatggttgcgaaacgccggttcaaaatcggcgacatagcgggcgaacatacatcttttgacaagcttcccaaagacgtcatggcgacatatcgcgggacggcgttcggttcagacgatgccggcggaaaactgacctatactatagattttgctgccaaacagggacacggcaaaatcgaacatttgaaatcgcccgaactcaatgtcgagcttgccaccgcctatatcaagccggatgaaaaacaccatgccgtcatcagcggttccgtcctttacaatcaagacgagaaaggcagttactccctcggtatctttggcgggcaagcccaggaagttgccggcagcgcggaagtggaaaccgcaaacggcatacaccatatcggtcttgccgccaagcaataa。

[0130] Neisseria adhesin A (NadA) is derived from Neisseria meningitidis serogroup B, and the sequence is as shown in SEQ ID No.6, which is:

[0131]

[0132] Experiment Example 1: Experiment on the TLR4 responsiveness of outer membrane vesicles of different group B meningococcal mutant strains

[0133] HEK-293 cell lines stably expressing human-derived TLR4 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured at 37 °C, 5% CO2, in DMEM (Gibco BRL, USA) medium supplemented with 10% FBS (HycloneLogan, UT, USA). After culture, cells were aliquoted into 96-well plates at 10⁵ cells / well. After 18 hours, different concentrations of outer membrane vesicles were added to the plates for stimulation (10⁻¹, 10⁻¹² ... 2 , 10 3 and 10 4 After 24 hours, cell culture supernatant was collected, cell debris was removed by centrifugation, and the expression levels of cytokines were detected. TLR4 levels were measured using an ELISA kit purchased from R&D Systems, Inc., and the procedures were strictly followed according to the instructions. The detected TLR4 levels were as follows: Figure 1 As shown, cellular-level verification confirmed that knocking out lptA and expressing lpxE or pagL on this basis can significantly enhance the ability of outer membrane vesicles to be recognized by TLR4.

[0134] Experiment Example 2: Evaluation of the immunoprotective efficacy of outer membrane vesicles from different group B meningococcal mutant strains

[0135] Using 6-8 week old BALB / c mice as a model, mice were immunized subcutaneously with 20 μg of different serogroup B meningococcal mutant strains. The first immunization was on day 1, followed by a booster immunization 4 weeks later. Serum antibody IgG levels were measured at 4 and 8 weeks after the first immunization. Nine weeks after the first immunization, mice were challenged with serogroup B meningococcus at a dose of 10 μg / L. 7 CFU was used for challenge via nasal drops. Three days post-challenge, the bacterial load in the nasal cavity was measured to assess the protective efficacy of different outer membrane vesicles against bacteria. For example... Figure 2 and Figure 3 As shown, QL00022 (△lptA / Ptrc-lxpE) can induce the optimal serum IgG antibody level; at the same time, it can significantly reduce the bacterial load in the nasal cavity 3 days after challenge.

[0136] Experiment Example 3: Evaluation of the protective efficacy of outer membrane vesicles of different group B meningococcal mutant strains using a neonatal rat model.

[0137] This study evaluated the ability of antibodies produced by immunizing mice with different group B meningococcal mutants via peritoneal vesicles to provide protection against Neisseria meningitidis bacteremia using juvenile rats. Three- to four-day-old pups from a litter of male Sprague-Dawley rats were randomly reassigned to their lactating mothers. Ten pups were intraperitoneally injected with a 1:10 dilution of mouse immunization serum against different peritoneal vesicle strains 18 to 24 hours prior to challenge. Then, 10... 5 CFU-treated patients were challenged intraperitoneally with group B Neisseria meningitidis strain H44 / 76. Three hours post-challenge, patients were sacrificed and bled. Aliquots of blood were spread onto chocolate agar plates and incubated overnight at 37°C with 5% CO2. Bacteremia levels were determined by counting colonies on the plates after culturing. Figure 4 As shown, the antibody levels produced by immunization with QL00022 (△lptA / Ptrc-lxpE) are most effective in combating bacteremia caused by group B Neisseria meningitidis.

[0138] Experiment Example 4: Evaluation of the immunoprotective efficacy of combinations of outer membrane vesicles from different group B meningococcal mutant strains

[0139] Using 6-8 week old BALB / c mice as a model, different combinations of meningococcal mutant strains were used to immunize mice with perivascular vesicles, including (1) wild-type meningococcal perivascular vesicles, (2) meningococcal perivascular vesicles expressing three recombinant proteins, (3) lipopolysaccharide-modified meningococcal perivascular vesicles, and (4) 10 μg of protein-expressing perivascular vesicles and lipopolysaccharide-modified perivascular vesicles to form 20 μg. The total amount of each group was controlled, and mice were immunized by subcutaneous injection at a dose of 20 μg. The first immunization was on day 1, and a booster immunization was performed 4 weeks later. The serum antibody IgG level of mice was measured at 4 weeks and 8 weeks after the first immunization. Meningococcal challenge was performed 9 weeks after the first immunization. The challenge dose of meningococcal perivascular vesicles was 107 CFU, and the challenge method was nasal instillation. The bacterial load in the nasal cavity was measured 3 days after the challenge to evaluate the protective efficacy of different perivascular vesicles against bacteria. The results showed that the group containing both expressed protein-containing outer membrane vesicles and lipopolysaccharide-modified outer membrane vesicles induced the optimal serum IgG antibody levels. Figure 5 ), and can significantly reduce the bacterial load in the nasal cavity 3 days after infection. Figure 6 ).

[0140] Experiment 5: Using a newborn rat model, the protective efficacy of combinations of outer membrane vesicles from different group B meningococcal mutant strains was evaluated.

[0141] This study aimed to evaluate the protective effect of antibodies produced by combined immunization of mice with different group B meningococcal mutant outer membrane vesicles against Neisseria meningitidis bacteremia using juvenile rats. Three- to four-day-old pups from a litter of male Sprague-Dawley rats were randomly reassigned to their lactating mothers. Ten pups were intraperitoneally injected with a 1:10 dilution of mouse serum immunized against different outer membrane vesicle species 18 to 24 hours prior to challenge. Then, 10... 5 CFU-treated Neisseria meningitidis strain H44 / 76 was used to challenge them intraperitoneally. Three hours post-challenge, the bacteria were sacrificed and bled. Aliquots of blood were spread onto chocolate agar plates and incubated overnight at 37°C with 5% CO2. Bacteremia levels were determined by counting colonies on the plates after culturing. Results showed that antibody levels produced by immunization of groups containing both protein-expressing outer membrane vesicles and lipopolysaccharide-modified outer membrane vesicles were most effective against bacteremia caused by Neisseria meningitidis serogroup B. Figure 7 ).

Claims

1. A composition of outer membrane vesicles for resisting group B meningococcal infection, characterized in that, The outer membrane vesicle composition consists of lipopolysaccharide-modified outer membrane vesicles of group B meningococci and outer membrane vesicles of group B meningococci expressing recombinant proteins. The lipopolysaccharide-modified group B meningococcus is classified as Neisseria sp., with accession number CGMCC No. 36402, and is deposited at the China General Microbiological Culture Collection Center on July 19, 2024. The group B meningococcus expressing the recombinant protein is classified as Neisseria meningitidis, with accession number CGMCC No. 31404, deposited at the China General Microbiological Culture Collection Center on July 30, 2024. The lipopolysaccharide-modified group B meningococcus was obtained by constructing the lpxE gene, which expresses phosphate synthase LpxE, into the upstream and downstream homologous arms of the knockout lptA gene through homologous recombination, forming a genotype that knocks out lptA while expressing lpxE, and obtaining a group B meningococcus mutant strain with the optimal lipid A structure that can efficiently activate the TLR4 receptor. The group B meningococci expressing recombinant proteins express recombinant proteins NHBA, fHbp, and NadA via the self-transport system Hbp.

2. The outer membrane vesicle composition for resisting group B meningococcal infection according to claim 1, characterized in that, The group B meningococcus expressing the recombinant protein was prepared by the following method: (1) Gene expression fragments of NHBA, fHbp and NadA antigens were constructed in plasmids using the Hbp protein self-transport system; (2) The plasmid was transferred into a group B meningococcal background strain by electroporation; The method for constructing the plasmid includes the following steps: 1) The Hbp self-transport system expression cassette derived from group B meningococcus was cloned into the vector pYA3332 in one step using the Gibson assembly kit; 2) The coding gene sequences of recombinant proteins NHBA, fHbp and NadA of group B meningococcal antigens were cloned into the Hbp self-transport system expression cassette using the Gibson assembly kit to express the three antigens onto the outer membrane surface of group B meningococci. The method for constructing expression plasmid vectors for the Hbp self-transport system includes the following steps: 1) Primer design: Hbp-F: 5'CTGACCTTGGACGCGCCACCGGTTTAAG3' Hbp-R: 5'AACCTTGCGCGATGAGCATAAGCGTACAGCCTG 3' 2) Genomic DNA of group B meningococcus in the logarithmic growth phase was extracted as a template, and the corresponding primers were used to amplify the corresponding fragments using the linearized plasmid pYA3332 as a template. The amplification products were obtained by one-step cloning using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp. The method for constructing expression plasmids for NHBA, fHbp, and NadA antigens includes the following steps: 1) Primer design: NHBA-F: 5'TGCTGACAAAGAACTGGGATGTTTGAACGCAGTGTGATTG3' NHBA-R: 5'GAAACAGTTCCTGAGTCTCAATCCTGCTCTTTTTT3' fHbp-F: 5'TGCCACCCTGAGTCTGAACAGGTGAACCGAACTGCCTTCTGCTGC3' fHbp-R: 5'CGCTGTTACGACGCATTGAGATTATTGCTTGGCTTCAAGACC3' NadA-F: ​​5'TGCCACCCTGAGTCTGAACAGCATGCAAACCGCCGCCGCCGCTC3' NadA-R: 5'CGCTGTTACGACGCATTGAGACTCAGGCGGGTCCCATGCC3' pYA3332-Hbp-NHBA-F: 5'CAATCACACTGCGTTTGACGTAACTGACGATTGC3' pYA3332-Hbp-NHBA-R:5'AAAAAGAGCAGGATTGCAGTAAACCTTGGCGACGTG3' pYA3332-Hbp-fHbp-F: 5'GCAGCAGAAGGCAGAGCGCCGGCCTGAAGGTAATC3' pYA3332-Hbp-fHbp-R: 5'GGTCTTGAAGCCAAGCTGCGCCGAGAGCGATTGA3' pYA3332-Hbp-NadA-F: ​​5'GAGCGGCGGCGGCGGTTAAGCGCCGGCCTGAAGG TAATC3' pYA3332-Hbp-NadA-R: 5'GGCATGGGACCCGCCTGAGCGCCGAGAGCGATTGA3' 2) The sequence corresponding to NHBA was amplified using primers NHBA-F and NHBA-R with Neisseria meningitidis group B as a template. The vector fragment was amplified using primers pYA3332-Hbp-NHBA-F and pYA3332-Hbp-NHBA-R with pYA3332-Hbp as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The product was transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA. 3) Using primers fHbp-F and fHbp-R, the sequence corresponding to fHbp was amplified using Neisseria meningitidis group B as a template. Using primers pYA3332-Hbp-fHbp-F and pYA3332-Hbp-fHbp-R, the vector fragment was amplified using pYA3332-Hbp-NHBA as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp. 4) Using primers NadA-F and NadA-R, the sequence corresponding to NadA was amplified using Neisseria meningitidis group B as a template. Using primers pYA3332-Hbp-NadA-F and pYA3332-Hbp-NadA-R, the vector fragment was amplified using pYA3332-Hbp-NHBA-fHbp as a template. The amplification products of the corresponding fragments were obtained. One-step cloning was performed using the Gibson assembly kit. The products were transformed into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp-NadA.

3. The outer membrane vesicle composition for resisting group B meningococcal infection according to claim 2, characterized in that, The plasmid pRE112-lptA / Ptrc-lpxE used in the homologous recombination process is constructed as follows: Based on the gene sequence NZ_LR134326.1 in GenBank, primers were designed to insert the lpxE sequence into the middle of the lptA homologous arm. The primers are as follows: lptA-3F:5'TGAGACGCTGACGATAATTGC3' lptA-3R: 5'CGATGAAATTTGCGCGATGACG3' lpxE-1F: 5'CCGAGACTTTGACGTAGACGTGACGTGACGATGACG3' lpxE-1R: 5'CGACGATAGCGATGACGATTGACGATTAACCGT3'; Genomic DNA was extracted from the reference strain of Bordetella bronchiseptica in the logarithmic growth phase and used as a template. The full-length fragment of lpxE was amplified using lpxE-1F and lpxE-1R, respectively. Then, using pRE112-lptA plasmid as a template, the products were amplified using lptA-3F and lptA-3R. The two PCR products were then cloned using a one-step method. The reaction products were electroporated into the competent cells of engineered Escherichia coli χ7232 to obtain the recombinant plasmid pRE112-lptA / Ptrc-lpxE.

4. The outer membrane vesicle composition for resisting group B meningococcal infection according to claim 1, characterized in that, The weight ratio of the lipopolysaccharide-modified outer membrane vesicles of group B meningococci to the outer membrane vesicles of group B meningococci expressing recombinant proteins is 2:

1.

5. The use of the composition according to any one of claims 1 to 4 in the preparation of a vaccine against bacteremia caused by group B meningococcus.

Images