High-temperature-resistant and high-activity mutant reverse transcriptase as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biology, in particular to high-temperature-resistant and high-activity mutant reverse transcriptase as well as a preparation method and application thereof. Reverse transcriptase as shown in SEQ ID NO: 1 is used as a template for mutation to obtain the reverse transcriptase variant, the reverse transcriptase variant is used for reverse transcription of RAN, and test results show that compared with a wild type, the reverse transcription activity at 37 DEG C and 55 DEG C is remarkably improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a high-temperature-resistant and highly active mutant reverse transcriptase, a preparation method and application thereof. Background Art

[0002] The steps of nucleic acid analysis usually include sample collection, nucleic acid extraction, reverse transcription and qPCR. Reverse transcription is the process of synthesizing cDNA with RNA as template under the action of reverse transcriptase. Reverse transcriptase is also a common enzyme in molecular biology. Its wide applications include cDNA cloning, real-time RT-PCR, microarray analysis and RACE. Due to the secondary structure of RNA, truncated cDNA is often produced during synthesis. The influence of RNA secondary structure can be overcome by increasing the temperature of reverse transcription. Based on the above, improving the thermal stability of reverse transcriptase is of great significance in engineering.

[0003] Moloney murine leukemia virus reverse transcriptase is a commonly used reverse transcriptase, but it comes from mice and the optimal reaction temperature of the enzyme is 37°C. Also, during nucleic acid extraction, if some components remain, the activity of MLV RT may be inhibited; therefore, it is crucial to improve the thermal stability and stress resistance of reverse transcriptase.

[0004] MMLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) is a reverse transcriptase derived from Moloney Murine Leukemia Virus, belonging to the gammaretrovirus family. Due to its excellent reverse transcription activity, it has been developed into a variety of commercial enzymes. However, its thermal stability and stress resistance need to be further improved; and the reverse transcriptases that can be selected for different samples or sample conditions are very limited. Therefore, it is of great significance to broaden the library of reverse transcriptases and increase the number of different reverse transcriptases. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a high-temperature-resistant and highly active mutant reverse transcriptase, and a preparation method and application thereof.

[0006] The present invention provides a reverse transcriptase variant, which includes a reverse transcriptase with an amino acid sequence as described in SEQ ID NO: 1 having at least one of the following mutations:

[0007] Aspartic acid D at position 178 was mutated to cysteine ​​C;

[0008] The glutamic acid E at position 280 was mutated to arginine R;

[0009] Threonine T at position 284 was mutated to arginine R;

[0010] The tryptophan W at position 291 was mutated to phenylalanine F;

[0011] The glutamic acid E at position 540 was mutated to lysine K;

[0012] The leucine L at position 581 was mutated to tryptophan W.

[0013] Furthermore, the reverse transcriptase variant of the present invention comprises: the aspartic acid D at position 178 of the reverse transcriptase of the amino acid sequence as described in SEQ ID NO: 1 is mutated to cysteine ​​C and at least one of the following mutations:

[0014] The glutamic acid E at position 280 was mutated to arginine R;

[0015] Threonine T at position 284 was mutated to arginine R;

[0016] The tryptophan W at position 291 was mutated to phenylalanine F;

[0017] The glutamic acid E at position 540 was mutated to lysine K;

[0018] The leucine L at position 581 was mutated to tryptophan W.

[0019] Furthermore, the reverse transcriptase variant of the present invention comprises:

[0020] The aspartic acid D at position 178 of the reverse transcriptase with the amino acid sequence as SEQ ID NO: 1 is mutated to cysteine ​​C and the glutamic acid E at position 280 is mutated to arginine R; and / or

[0021] The aspartic acid D at position 178 of the reverse transcriptase with the amino acid sequence as SEQ ID NO: 1 is mutated to cysteine ​​C and the threonine T at position 284 is mutated to arginine R; and / or

[0022] The aspartic acid D at position 178 of the reverse transcriptase with the amino acid sequence as SEQ ID NO: 1 is mutated to cysteine ​​C and the tryptophan W at position 291 is mutated to phenylalanine F; and / or

[0023] The aspartic acid D at position 178 of the reverse transcriptase with the amino acid sequence as SEQ ID NO: 1 is mutated to cysteine ​​C and the leucine L at position 581 is mutated to tryptophan W; and / or

[0024] The amino acid sequence of the reverse transcriptase described in SEQ ID NO: 1 is aspartic acid D at position 178 mutated to cysteine ​​C, glutamic acid E at position 280 mutated to arginine R, threonine T at position 284 mutated to arginine R, and leucine L at position 581 mutated to tryptophan W; and / or

[0025] The amino acid sequence of the reverse transcriptase described in SEQ ID NO: 1 is aspartic acid D at position 178 mutated to cysteine ​​C, glutamic acid E at position 280 mutated to arginine R, threonine T at position 284 mutated to arginine R, tryptophan W at position 291 mutated to phenylalanine F, and leucine L at position 581 mutated to tryptophan W; and / or

[0026] The amino acid sequence of the reverse transcriptase as described in SEQ ID NO: 1 is aspartic acid D at position 178 mutated to cysteine ​​C, glutamic acid E at position 280 mutated to arginine R, threonine T at position 284 mutated to arginine R, glutamic acid E at position 540 mutated to lysine K, and leucine L at position 581 mutated to tryptophan W.

[0027] Reverse transcriptase-FrMLV RT was isolated from Friend murine leukemia virus isolate FB29, and its amino acid sequence is shown in SEQ ID NO:1. Experiments have shown that the activity of wild-type FrMLV RT is weak. In this paper, reverse transcriptase-FrMLV RT was used as a template, and site-directed mutagenesis and cell-free protein expression technology were used to evolve it to obtain variants M5 (W291F / D178C / E280R / T284R / L581W) with higher activity and thermal stability.

[0028] In a specific embodiment of the present invention, the reverse transcriptase having an amino acid sequence as shown in SEQ ID NO: 1 is subjected to single-site mutation and combined mutation of single sites, and the single mutation sites include D178C, E280R, T284R, W291F, E540K, and L581W; the test results of the present invention show that the combined mutations based on the single mutations significantly improve the reverse transcription efficiency at 37°C and 55°C compared with the wild type, among which variants M5 (W291F / D178C / E280R / T284R / L581W) and M502 (D178C / E280R / T284R / L581W) are better, and M5 is the best.

[0029] In the present invention, the reverse transcriptase variant has stronger activity and / or higher stability than the existing reverse transcriptase.

[0030] The present invention provides a biomaterial comprising at least one of the following A) to D):

[0031] A), a nucleic acid encoding the reverse transcriptase variant of the present invention;

[0032] B), a recombinant vector containing the nucleic acid described in A);

[0033] C), transforming or transfecting host cells with the recombinant vector described in B);

[0034] D) culturing the mixture obtained by culturing the host cells described in C).

[0035] Furthermore, the backbone of the recombinant vector includes pUC19 and / or pET28. Specifically, the vector used for mutant screening is pUC19, and the vector used for mutant expression is pET28.

[0036] The nucleic acid described in the present invention can be DNA, RNA, cDNA or PNA. In an embodiment of the present invention, the nucleic acid is in the form of DNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. Nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). Nucleic acids can be linear or circular in topology. Nucleic acids can be part of a vector (such as an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc.

[0037] In the present invention, the nucleic acid may be codon-optimized or non-codon-optimized, and these optimizations include but are not limited to: codon usage preference, elimination of secondary structures that are not conducive to expression (such as hairpin structures), changes in GC content, CpG dinucleotide content, secondary structure of mRNA, cryptic splicing sites, early polyadenylation sites, internal ribosome entry sites and binding sites, negative CpG islands, RNA unstable regions, repetitive sequences (direct repeats, inverted repeats, etc.) and restriction sites that may affect cloning.

[0038] The present invention also provides a transcription unit containing the nucleic acid, wherein the transcription unit refers to a DNA sequence starting from a promoter and ending at a terminator. A regulatory segment may also be included on both sides or between the promoter and the terminator, and the regulatory segment may include a promoter, an enhancer, a transcription termination signal, a polyadenylation sequence, a replication origin, a nucleic acid restriction site, and a homologous recombination site operably connected to the nucleic acid sequence, such as an enhancer of the promoter, a poly (A) signal, etc.

[0039] The present invention provides a recombinant vector, which comprises a vector backbone and the nucleic acid of the present invention.

[0040] Furthermore, the sources of the vector skeleton described in the present invention include plants, animals, bacteria, fungi, bacteriophages or viruses, which are not limited in the present invention.

[0041] The recombinant vector of the present invention refers to a recombinant nucleic acid vector, which is a recombinant DNA molecule comprising a desired coding sequence and an appropriate nucleic acid sequence or element that is essential for the expression of an operably connected coding gene in a specific host organism. Known prokaryotes utilize promoters, enhancers, and terminators. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. In this specification, "plasmid" and "vector" can sometimes be interchanged and used, because plasmid is the most commonly used vector form at present. However, the present invention is intended to include such other forms of expression vectors, which play an equivalent role, which are known or will become known in the art, including but not limited to: plasmids, phage particles, viral vectors and / or are only potential genomic inserts. In a specific embodiment, the vector of the present invention is pET28a or pUC19.

[0042] In the present invention, the host cell includes but is not limited to plants, animals, bacteria, fungi, bacteriophages or viruses, and the present invention does not limit this. In a specific embodiment of the present invention, the host cell is a host bacterium of DH5α (construction clone) or BL21Star (DE3) expressing protein.

[0043] The present invention uses vectors constructed using recombinant DNA technology to transform or transfect host cells, so that the transformed host cells have the ability to replicate protein-encoding vectors or express desired proteins.

[0044] In the present invention, the transformation methods include chemical transformation and electrotransformation; the transfection methods include calcium phosphate coprecipitation, artificial liposome method, and viral transfection. The viral transfection includes adenovirus transfection, adeno-associated virus transfection, lentivirus transfection, and the like.

[0045] The present invention provides a reagent and / or a kit, which comprises at least one of the reverse transcriptase variants of the present invention and / or the biological materials of the present invention and auxiliary materials.

[0046] Furthermore, in the reagent and / or kit described in the present invention, the auxiliary materials include culture fluid, culture medium, antibiotics, buffer, preservatives, antioxidants and / or stabilizers.

[0047] The present invention provides the use of at least one of the following i) to iii) in reverse transcription of RNA samples into DNA:

[0048] i), the reverse transcriptase variant of the present invention;

[0049] ii), the biomaterial of the present invention;

[0050] iii), the reagent and / or kit of the present invention.

[0051] Furthermore, in the present invention, the RNA sample includes at least one of plants, animals, bacteria, fungi and / or RNA viruses.

[0052] The present invention provides a method for reverse transcribing RNA into DNA, which comprises reverse transcribing RNA into DNA using at least one of the following I) to III):

[0053] i), the reverse transcriptase variant of the present invention;

[0054] ii), the biomaterial of the present invention;

[0055] iii), the reagent and / or kit of the present invention.

[0056] The present invention provides a method for reverse transcribing RNA into DNA, comprising the following steps: mixing RNA sample, water, buffer, dNTP and reverse transcriptase variant and then performing reverse transcription.

[0057] The reverse transcriptase variant of the present invention is obtained by mutating the reverse transcriptase shown in SEQ ID NO: 1 as a template, and the reverse transcriptase variant is used for reverse transcription of RNA. The test results show that the reverse transcription activity at 37° C. and 55° C. is significantly improved compared with the wild type. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 1. The flowchart of the scheme of the present invention is shown;

[0059] Figure 2 The results of the single-site mutation activity test are shown, among which, the E280R and L581W mutations had no activity detected at 55°C;

[0060] Figure 3 Shows the results of multi-site mutation activity test;

[0061] Figure 4 Wild-type and variant purification SDS-PAGE is shown;

[0062] Figure 5 RT-qPCR. DETAILED DESCRIPTION

[0063] The present invention provides a high temperature resistant and highly active mutant reverse transcriptase, a preparation method and an application thereof. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0064] FrMLV amino acid sequence: (SEQ ID NO: 1);

[0065]

[0066] The nucleotide sequence of the MSR-R4 primer is: cctctagcacacggggtgcaat (SEA ID NO: 3);

[0067] The nucleotide sequence of Taq-F1 is: gtcgcggtaattggcgc (SEQ ID NO: 4);

[0068] Taq-R1:ggccacgtgttttgatcga (SEQ ID NO:5);

[0069] Probe-MS: aggcgctccgctaccttgccct, with FAM at the 5' end and BHQ1 at the 3' end (SEQ ID NO: 6);

[0070] Amino acid sequence of D178C / E280R mutation: MTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLSQGFKNSPTLFCEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLRRFLGTAGFCRLWIPGFAEMAAPLYPLTKTGTLFEWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPIVALNPATLLPLPEEGLQHDCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSFLQEGQRKAGAAVTTETEVVWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGNRAEARGNRMADQAAREVATRETPETSTLL (SEQ ID NO:7);

[0071] Amino acid sequence of D178C / T284R mutation: MTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLSQGFKNSPTLFCEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGRAGFCRLWIPGFAEMAAPLYPLTKTGTLFEWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPIVALNPATLLPLPEEGLQHDCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSFLQEGQRKAGAAVTTETEVVWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGNRAEARGNRMADQAAREVATRETPETSTLL (SEQ ID NO:8);

[0072] Amino acid sequence of D178C / W291F mutation: MTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLSQGFKNSPTLFCEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGTAGFCRLFIPGFAEMAAPLYPLTKTGTLFEWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPIVALNPATLLPLPEEGLQHDCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSFLQEGQRKAGAAVTTETEVVWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGNRAEARGNRMADQAAREVATRETPETSTLL (SEQ ID NO:9);

[0073] Amino acid sequence of D178C / L581W mutation: MTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLSQGFKNSPTLFCEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGTAGFCRLWIPGFAEMAAPLYPLTKTGTLFEWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPIVALNPATLLPLPEEGLQHDCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSFLQEGQRKAGAAVTTETEVVWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGWLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGNRAEARGNRMADQAAREVATRETPETSTLL (SEQ ID NO:10);

[0074] Amino acid sequence of D178C / E280R / T284R / L581W mutation: MTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLSQGFKNSPTLFCEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLRRFLGRAGFCRLWIPGFAEMAAPLYPLTKTGTLFEWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPIVALNPATLLPLPEEGLQHDCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSFLQEGQRKAGAAVTTETEVVWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGWLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGNRAEARGNRMADQAAREVATRETPETSTLL (SEQ ID NO:11);

[0075] Amino acid sequence of D291F / D178C / E280R / T284R / L581W: MTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLSQGFKNSPTLFCEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLRRFLGRAGFCRLFIPGFAEMAAPLYPLTKTGTLFEWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPIVALNPATLLPLPEEGLQHDCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSFLQEGQRKAGAAVTTETEVVWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGWLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGNRAEARGNRMADQAAREVATRETPETSTLL (SEQ ID NO:12);

[0076] Amino acid sequence of the D178C / E280R / T284R / E540K / L581W mutation: (SEQ ID NO: 13);

[0077] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below in conjunction with the embodiments:

[0078] Example 1 Preparation and performance testing of a high temperature resistant and highly active mutant reverse transcriptase

[0079] 1. Solution of the present invention

[0080] First, the FrMLV RT variant was obtained by site-directed mutagenesis, and then the variant protein was synthesized using a cell-free protein expression system. Second, the variant protein was purified using streptavidin magnetic beads, and then the protein was incubated at a specified temperature for a period of time and then reverse transcribed. Finally, the ability of the reverse transcriptase to synthesize cDNA was detected using a probe method, and its thermal stability was inferred. Figure 1 shown.

[0081] 2. Specific experimental methods

[0082] 1. Preparation of mutation templates: Based on the wild-type FrMLV RT sequence, site-directed single mutations and combined mutations of D178C, E280R, T284R, L581W and W291F were performed, and the mutant plasmids were obtained by homologous recombination with the pUC19 vector. The recombinant plasmids were used as templates and amplified using high-fidelity polymerase to obtain the original and mutant templates.

[0083] 2. Synthesis of variant proteins: Establishment of cell-free protein expression system. According to the literature Wu Y, Tang M, Wang Z, et al. Efficient In Vitro Full-Sense-Codons Protein Synthesis. Adv Biol (Weinh). 2022; e2200023., establish a cell-free protein expression system. The expression system is shown in Table 1. Melt the required reagents on ice according to the above table, centrifuge the S30 extract at 4℃ 12000rpm / min for 10min; then add water, 4× buffer and S30 extract to a clean centrifuge tube, mix well and dispense into the designated 96-well plate, finally add 4μl of the above-amplified mutant template, and incubate in a 30℃ incubator for 3h.

[0084] Table 1. Cell-free protein expression system

[0085]

[0086] 3. Purification of variant proteins

[0087] 3.1 Magnetic bead pretreatment

[0088] Take 20 μl / well of magnetic beads, calculate the required amount, add to the centrifuge tube, place on the magnetic stand for 30 seconds, aspirate the supernatant with a gun, add 5 times the volume of binding buffer to wash, place on the magnetic stand for 30 seconds, aspirate the supernatant with a gun, repeat once, and finally add binding buffer to resuspend the magnetic beads to obtain 0.111× magnetic beads for use.

[0089] 3.2 Binding of target protein to magnetic beads

[0090] Add 180 μl of 0.111× magnetic beads to each well of the CFPS reaction plate, shake at 4°C, 1000 rpm / min for 1 min, incubate at 4°C, 10 rpm / min for 30 min;

[0091] 3.3 Magnetic bead washing

[0092] Centrifuge briefly, place the sample on a magnetic rack for 30 seconds, slowly aspirate the liquid, be especially careful, as the beads may be easily aspirated, transfer the sample to ice, add 200 μl Wash Buffer, let stand for 30 seconds, then place the sample on a magnetic rack, discard the supernatant after 30 seconds, and repeat twice

[0093] 3.4 Target protein elution

[0094] Add Elution buffer to the sample, 60 μl / well, 4℃ 1000 rpm / min, 1 min, place in shake, incubate at 4℃ 10 rpm / min for 30 min; place on the magnetic stand.

[0095] 3.5 Storage: Take 40 μl of the supernatant for subsequent Reverse Transcription reaction;

[0096] 4. Heat Incubation

[0097] 4.1 Melt the required reagents on ice according to Table 2, flick to mix and set aside; then add water, 5× buffer, dNTP and MSR-R4 to a clean centrifuge tube, mix and dispense into the designated 96-well plate, finally add 2 μl of magnetic bead-purified protein, mix and set aside.

[0098] Table 2. Incubation system

[0099]

[0100] 4.2 Place the 96-well plate in a PCR instrument and program it at 55℃ or 37℃ for 1min. When the temperature reaches 55℃, stop placing the sample, and keep it at 55℃ or 37℃ for 3min, then keep it at 10℃, and then take it out and put it on ice for 30min.

[0101] 5. Reverse Transcription

[0102] 5.1 Template dilution: Add 450 μl of nuclease-free water to a 1.5 mL PCR tube, then add 30 μl of 800 ng / μl MS2 phage RNA, mix well and set aside;

[0103] 5.2 Add template: Add 1 μl MS2 RNA to the 96-well plate, flick to mix, centrifuge, and place in a PCR instrument for reaction;

[0104] 5.3 Reaction conditions: Carry out the reaction according to the following procedure: 55℃ or 37℃ for 45min, 85℃ for 10min, and keep warm at 10℃.

[0105] 6. qPCR

[0106] 6.1 The qPCR reaction system is as shown in Table 3. Melt the required reagents on ice according to Table 3, flick to mix and set aside;

[0107] 6.2 Prepare Mix according to the table below, add water, buffer, dNTPs, primers, probe and enzyme in sequence, mix well, and dispense into 96-well plates;

[0108] 6.3 Add 1 μl cDNA and flick to mix;

[0109] 6.4 Place the 96-well plate in a qPCR instrument and perform the reaction according to the following program: 95°C for 5 min, 95°C for 30 s, 55°C for 30 s, 72°C for 20 s, and 40 cycles.

[0110] Table 3. qPCR reaction system

[0111]

[0112] 7. Protein Expression and Purification

[0113] 7.1 Inoculation: Take a single clone of BL21(DE3) Star host bacteria (pET28a-FrMLV-6×His) and transfer it to 50 mL of LB medium containing 50 μg / m Kana resistance, and culture it at 37°C and 220 rpm / min overnight (12 h);

[0114] 7.2 Transfer: Determine the OD value of the bacteria before transfer, transfer the strain to 1 L LB medium at a ratio of 1:100, and culture at 37°C and 220 rpm / min. When OD600 reaches 0.6, add 1 mL 1 M IPTG and continue to culture at 37°C and 220 rpm / min for 6 hours; determine its absorbance and record;

[0115] 7.3 Harvest bacteria: Place the bacterial solution on ice for 15 min, then centrifuge at 4000 rpm / min, 30 min, 4 ℃, discard the supernatant, add 20 mL Buffer A to resuspend the bacteria, weigh an empty 50 mL centrifuge tube, then transfer the bacteria to a 50 mL centrifuge tube, centrifuge at 5000 rpm / min, 10 min, 4 ℃, discard the supernatant, weigh, and calculate the weight of the wet bacteria; freeze in liquid nitrogen and store at -80;

[0116] 7.4 Disruption: According to the weight of wet bacteria, resuspend the bacteria in Buffer A (200 mg / mL), add freshly prepared lysozyme (prepared to 50 mg / mL, final concentration 0.2 mg / mL when used), and Triton X-100 (0.1% v / v), stir at 4°C for 1 h; use an ultrasonic cell disruptor to disrupt the resuspended bacteria (horn 6 mm total power 950W: power: 25%, total time: 10 min, program: on 2 s, off 8 s);

[0117] 7.5 Centrifugation: After ultrasonic disruption, centrifuge at 12000 rpm, 4°C for 30 min; filter the supernatant on ice using a 0.22 μM filter membrane into a new 50 mL centrifuge tube;

[0118] 7.6 Purification: Affinity chromatography, protein purification according to AKTA procedures;

[0119] 7.7 Dialysis: After collecting the samples, use a 5mL gun to transfer the samples directly to the treated dialysis bag, and then directly transfer them into the dialysis solution for dialysis. Seal the beaker with plastic wrap and place it on a magnetic stirrer for dialysis. Perform dialysis 3 times in total.

[0120] 8. Protein concentration determination: Use Pierce™ 660 nm protein detection reagent kit to determine the protein concentration;

[0121] 9. Data processing

[0122] In fluorescence quantitative PCR, C stands for cycle, t stands for threshold (fluorescence threshold), and the Ct value indicates the number of cycles experienced when the fluorescence signal in each reaction tube reaches the set threshold. The smaller the Ct value, the better the reverse transcription effect and the better the activity of the reverse transcriptase. △CT is used to represent the residual activity of the reverse transcriptase; △CT is the difference between the Ct value of the wild-type RT and the Ct value of the variant, that is, △CT=Ct wt -Ct s ;

[0123] 10. Data

[0124] The results of the single-site mutation activity test are as follows Figure 2 As shown, E280R and L581W mutations had no detectable activity at 55°C, while D178C and W291F had higher reverse transcriptase activity at 37°C and 55°C.

[0125] The results of multi-site mutation activity test are as follows Figure 3As shown in Figure 2, the W291F-D178C-E280R-T284R-L581W combination mutation has the highest reverse transcriptase activity at 37°C and 55°C, followed by the D178C-E280R-T284R-L581W combination mutation. The W291F-D178C-E280R-T284R-L581W combination mutation was named M5, and the mutant was purified. The purified SDS-PAGE is shown in Figure 2 Figure 4 As shown, RT-qPCR was performed with purified WT and M5. The results are shown in Figure 5 As shown, the results show that there is no amplification curve for the no reverse transcription control (No RT control, NRT) and the no template blank control (No template control, NTC), which makes the experimental results reliable; at 37°C, the Ct of M5 is much smaller than that of the wild type, indicating that the M5 variant exhibits high activity; at the same time, at 55°C, the Ct of M5 is much smaller than that of the wild type, indicating that the M5 variant exhibits high thermal stability;

[0126] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A reverse transcriptase variant, characterized in that The reverse transcriptase having the amino acid sequence of SEQ ID NO: 1 has at least one of the following mutations: Aspartic acid at position 178 was mutated to cysteine; The glutamic acid at position 280 was mutated to arginine; Threonine at position 284 was mutated to arginine; The tryptophan at position 291 was mutated to phenylalanine; Glutamic acid at position 540 was mutated to lysine; The leucine at position 581 was mutated to tryptophan.

2. The reverse transcriptase variant according to claim 1, characterized in that include: In the reverse transcriptase described in the amino acid sequence of SEQ ID NO: 1, the aspartic acid at position 178 is mutated to cysteine ​​and at least one of the following mutations: The glutamic acid at position 280 was mutated to arginine; Threonine at position 284 was mutated to arginine; The tryptophan at position 291 was mutated to phenylalanine; Glutamic acid at position 540 was mutated to lysine; The leucine at position 581 was mutated to tryptophan.

3. The reverse transcriptase variant according to claim 1 or 2, characterized in that include: The reverse transcriptase with the amino acid sequence as SEQ ID NO: 1 has aspartic acid at position 178 mutated to cysteine ​​and glutamic acid at position 280 mutated to arginine; and / or The aspartic acid at position 178 of the reverse transcriptase with the amino acid sequence as SEQ ID NO: 1 is mutated to cysteine ​​and the threonine at position 284 is mutated to arginine; and / or The aspartic acid at position 178 of the reverse transcriptase with the amino acid sequence as SEQ ID NO: 1 is mutated to cysteine ​​and the tryptophan at position 291 is mutated to phenylalanine; and / or The aspartic acid at position 178 of the reverse transcriptase with the amino acid sequence as SEQ ID NO: 1 is mutated to cysteine ​​and the leucine at position 581 is mutated to tryptophan; and / or The reverse transcriptase having an amino acid sequence as described in SEQ ID NO: 1 has aspartic acid at position 178 mutated to cysteine, glutamic acid at position 280 mutated to arginine, threonine at position 284 mutated to arginine, and leucine at position 581 mutated to tryptophan; and / or The amino acid sequence of the reverse transcriptase described in SEQ ID NO: 1 is aspartic acid at position 178 mutated to cysteine, glutamic acid at position 280 mutated to arginine, threonine at position 284 mutated to arginine, tryptophan at position 291 mutated to phenylalanine, and leucine at position 581 mutated to tryptophan; and / or The reverse transcriptase having an amino acid sequence as described in SEQ ID NO: 1 has aspartic acid at position 178 mutated to cysteine, glutamic acid at position 280 mutated to arginine, threonine at position 284 mutated to arginine, glutamic acid at position 540 mutated to lysine, and leucine at position 581 mutated to tryptophan.

4. Biomaterial, characterized in that Including at least one of the following A) to D): A), a nucleic acid encoding the reverse transcriptase variant according to any one of claims 1 to 3; B), a recombinant vector containing the nucleic acid described in A); C), transforming or transfecting host cells with the recombinant vector described in B); D) culturing the mixture obtained by culturing the host cells described in C).

5. The biomaterial according to claim 4, characterized in that The backbone of the recombinant vector includes pUC19 and / or pET28.

6. Reagents and / or kits, characterized in that The method comprises at least one of the reverse transcriptase variant according to any one of claims 1 to 3 and / or the biological material according to claim 4 or 5 and auxiliary materials.

7. The reagent and / or kit according to claim 6, characterized in that: The auxiliary materials include culture solution, culture medium, antibiotics, buffer, preservatives, antioxidants and / or stabilizers.

8. Application of at least one of the following i) to iii) in reverse transcription of RNA samples into DNA: i), the reverse transcriptase variant according to any one of claims 1 to 3; ii), the biological material according to claim 4 or 5; iii), the reagent and / or kit according to claim 6 or 7.

9. The use according to claim 8, characterized in that: The RNA sample includes at least one of plants, animals, bacteria, fungi and / or RNA viruses.

10. A method for reverse transcribing RNA into DNA, characterized in that: The method comprises reverse transcribing RNA into DNA using at least one of the following I) to III): i), the reverse transcriptase variant according to any one of claims 1 to 3; ii), the biological material according to claim 4 or 5; iii), the reagent and / or kit according to claim 6 or 7.

Images