Tyrosine phenol lyase mutants and their applications in the synthesis of tyrosine derivatives

Abstract

This invention discloses a tyrosine phenol lyase mutant and its application in synthesizing tyrosine derivatives. The mutant is obtained by single or multiple mutations at position 18 or 417 of the amino acid sequence shown in SEQ ID NO.2. Compared with the wild type, the tyrosine phenol lyase mutant provided by this invention exhibits superior enzyme activity and catalytic performance. The TPL mutant synthesizes levodopa at a cumulative concentration of over 160 g / L, L-tyrosine at a cumulative concentration of over 80 g / L, 3,4,5-TOPA at a cumulative concentration of over 16.4 g / L, 3-fluoro-L-tyrosine at a cumulative concentration of over 33.1 g / L, and 2-fluoro-L-tyrosine at a cumulative concentration of over 20.5 g / L, with an optical purity greater than 99.9%.

Description

(I) Technical Field

[0001] This invention belongs to the fields of genetic engineering and enzyme engineering, and relates to a tyrosine phenol lyase mutant and its application in synthesizing tyrosine derivatives. (II) Background Technology

[0002] Tyrosine phenol lyase (TPL, EC 4.1.99.2) is a class of pyridoxal-5'-Phosphate (PLP)-dependent lyases that catalyze the reversible elimination of L-tyrosine to produce phenol, pyruvate, and ammonia.

[0003] In addition to this physiological reaction, TPL can also catalyze the elimination and substitution reactions of a series of amino acids whose b-positions are replaced by easily leaving groups, making it an important biocatalyst for the synthesis of tyrosine derivatives.

[0004] Optically pure tyrosine derivatives, such as 3-methyl-L-tyrosine, 3-fluoro-L-tyrosine, and L-3,4-dihydroxyphenylalanine (L-DOPA), are important intermediates for the treatment of neurological diseases. Developing green and efficient industrial synthesis technologies for these derivatives is of great significance. Using inexpensive chemicals such as phenol derivatives, pyruvate, and ammonia as raw materials, the stereoselective catalytic synthesis of optically pure tyrosine derivatives via TPL offers significant advantages, including environmental friendliness and high atom economy.

[0005] Natural enzymes are the result of long-term adaptation to natural evolution, possessing tight structures and precise regulation. However, they typically exhibit low catalytic efficiency for non-natural substrates and are difficult to adapt to the high-intensity environments of industrial production. With the rapid development of protein engineering technology, modifying enzymes to improve their catalytic performance has become an important means of obtaining excellent biocatalysts. Effective regulation of TPL (Tyrosine Protease) to enhance its catalytic activity for non-natural substrates and the synthesis efficiency of target products is of great significance for achieving the green industrial synthesis of optically pure tyrosine derivatives. (III) Summary of the Invention

[0006] The purpose of this invention is to provide a tyrosine phenol lyase mutant and its application in synthesizing tyrosine derivatives. By using semi-rational design methods to modify tyrosine phenol lyase (Fn-TPL) derived from nucleic acid-containing bacteria, a tyrosine phenol lyase mutant is provided. Using phenol derivatives, sodium pyruvate, and ammonia as substrates, it efficiently catalyzes the synthesis of L-tyrosine derivatives, significantly improving enzyme activity and synthesis efficiency, and promoting the application of this enzyme in the synthesis of tyrosine derivatives.

[0007] The technical solution adopted in this invention is:

[0008] The present invention provides a tyrosine phenol lyase mutant, which is obtained by single or multiple mutations at position 18 or 417 of the amino acid sequence shown in SEQ ID NO.2.

[0009] Furthermore, the tyrosine lyase mutant is obtained by mutating threonine at position 18 of the amino acid sequence shown in SEQ ID NO.2 to leucine (T18L, amino acid sequence SEQ ID NO.4, nucleotide sequence SEQ ID NO.3) or tyrosine at position 417 to asparagine (Y417N, amino acid sequence SEQ ID NO.6, nucleotide sequence SEQ ID NO.5).

[0010] Any amino acid sequence shown in SEQ ID NO.4 and SEQ ID NO.6 that has one or more amino acids deleted, inserted, or replaced and has TPL activity is still within the scope of protection of this invention.

[0011] The amino acid sequence shown in SEQ ID NO.2 of this invention is derived from *F. nucleatum* subsp. *CGMCC* 1.2526, and the encoding gene sequence is shown in SEQ ID NO.1. Using the genome extracted from *F. nucleatum* subsp. *CGMCC* 1.2526 as a template, the gene encoding TPL (Fn-TPL) was successfully cloned, transformed into *Escherichia coli*, and expressed. Then, a plasmid containing Fn-TPL was extracted from *E. coli*, and the TPL gene was mutated using a gene locus saturation mutagenesis method. After being ligated into an expression vector, it was also expressed in *E. coli*, and mutants with enhanced viability were obtained through high-throughput screening.

[0012] This invention also relates to the coding gene of the tyrosine lyase mutant, a recombinant vector constructed from the coding gene, and a genetically engineered bacterium transformed from the recombinant vector, wherein the engineered bacterium is constructed using *Escherichia coli* BL21(DE3) as the host. The recombinant vector can be constructed by linking the nucleotide sequence of the TPL mutant to various vectors using conventional methods in the art. The base vector used in this invention for constructing the recombinant vector is not limited, as long as it can maintain its replication or autonomous replication in various host cells of prokaryotic and / or eukaryotic cells. The base vector can be various conventional vectors in the art, such as various plasmids, bacteriophages, or viral vectors, preferably pET-28b(+). The host cell into which the DNA encoding the TPL mutant of this invention is introduced is not limited, as long as a recombinant expression system has been established for it, and the recombinant expression vector can stably self-replicate and the TPL mutant gene of this invention carried can be effectively expressed. Examples include *Escherichia coli*, *Bacillus subtilis*, yeast, actinomycetes, *Aspergillus*, as well as animal cells and higher plant cells. *Escherichia coli* is preferred in this invention, and *Escherichia coli* BL21(DE3) is more preferred.

[0013] The preparation of the TPL mutant of this invention includes culturing the genetically engineered bacteria of this invention and inducing the production of the TPL mutant protein. The culture medium used to culture the genetically engineered bacteria can be any culture medium in the art capable of enabling the transformant to grow and produce the TPL of this invention, preferably LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, distilled water as solvent, pH 7.2. There are no particular limitations on the culture method and conditions, as long as the transformant can grow and produce TPL. A preferred method is as follows: the genetically engineered bacteria of this invention are inoculated into LB medium containing 50 μg / ml kanamycin and cultured at 37°C until the optical density OD600 reaches 0.5–0.7. Under the induction of isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.1–1.0 mM, the TPL mutant protein of this invention can be efficiently expressed.

[0014] The present invention also relates to the application of the tyrosine phenol lyase mutant in the synthesis of L-tyrosine derivatives. The method of application is as follows: using wet bacterial cells obtained by fermentation culture of engineered bacteria containing the tyrosine phenol lyase mutant encoding gene as catalyst, using phenol derivative (Ⅰ), sodium pyruvate and ammonium acetate as substrates, sodium sulfite and EDTA·Na2 as adjuvants, pyridoxal phosphate (PLP) as coenzyme, and a buffer solution with pH 6.0 to 10.5 (preferably pH 8.5) as the reaction medium to form a transformation system, the transformation reaction is carried out at a temperature of 5 to 30°C (preferably 15°C) and a rotation speed of 100 to 200 rpm (preferably 150 rpm). After the reaction is completed, the reaction solution is separated and purified to obtain L-tyrosine derivative (Ⅱ).

[0015]

[0016] In formula (I), R is monosubstituted or polysubstituted, and R is H, 2-hydroxy, 2,3-dihydroxy, 2-F, 3-F; in formula (II), R is the same as R in formula (I).

[0017] Furthermore, the phenol derivative is one of phenol, catechol, pyrogallol, o-fluorophenol, and m-fluorophenol.

[0018] Furthermore, in the conversion system, the final concentration of phenol derivative is 4-50 g / L (preferably 4-6 g / L), sodium pyruvate is 5-50 g / L (preferably 7 g / L), ammonium acetate is 7.7-108 g / L (preferably 77 g / L), sodium sulfite is 0.5-10 g / L (preferably 1 g / L), EDTA·Na2 is 0.5-10 g / L (preferably 2 g / L), pyridoxal phosphate is 0.05-5 mM (preferably 1 mM), and the amount of wet bacterial cells is 2-50 g / L (preferably 20 g / L).

[0019] Furthermore, when the phenol derivative is catechol, the final concentration added is 5-50 g / L (preferably 5 g / L); when the phenol derivative is phenol, the final concentration added is 4-40 g / L (preferably 4.2 g / L); when the phenol derivative is pyrogallol, the final concentration added is 5-50 g / L (preferably 5.7 g / L); when the phenol derivative is o-fluorobenzene, the final concentration added is 5-50 g / L (preferably 5 g / L); when the phenol derivative is m-fluorophenol, the final concentration added is 5-50 g / L (preferably 5 g / L).

[0020] Furthermore, during the conversion reaction, phenol derivatives, sodium pyruvate, and ammonium acetate are fed every 0.5 to 4 hours, wherein the phenol derivative is fed at a rate of 0.1 to 10 g / L (preferably 5 g / L) each time, the sodium pyruvate is fed at a rate of 0.1 to 10 g / L (preferably 5 g / L) each time, and the ammonium acetate is fed at a rate of 1 to 20 g / L (preferably 3.5 g / L) each time.

[0021] The TPL mutant provided by this invention can catalyze the synthesis of tyrosine and tyrosine derivatives in the form of free enzymes, immobilized enzymes, and recombinant free cells.

[0022] Furthermore, the catalyst is prepared by the following method:

[0023] (1) Slant culture: The engineered bacteria containing the gene encoding the tyrosine lyase mutant were inoculated into a slant culture medium containing 50 μg / mL kanamycin and cultured at 37℃ for 8-16 h to obtain slant cells; the final concentration composition of the slant culture medium was: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar, and distilled water as solvent, pH 7.0;

[0024] (2) Seed culture: The slant cells were inoculated into a seed culture medium containing 50 μg / ml kanamycin and cultured at 37℃ for 8-10 h to obtain seed liquid; the final concentration of the seed culture medium was: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, with distilled water as the solvent and pH 7.0.

[0025] (3) Fermentation culture: The seed culture was inoculated into a sterile 5L mechanically stirred and ventilated general-purpose fermenter containing 3L of fermentation medium at a volume concentration of 2%. Sterilized lactose was added directly to the fermenter at a final concentration of 15g / L. The fermentation was carried out at 28℃, with a stirring speed of 300rpm and an aeration rate of 5m³ / L. 3 After induction culture for 6-8 hours at an aeration ratio of approximately 2 vvm and a pH of 5.5 (adjusted with 30% ammonia and 45% phosphoric acid), the culture was transferred to a container and the wet cells were collected. The final concentration of the fermentation medium was: 25 g / L peptone, 6.55 g / L yeast extract, 10 g / L NaCl, 9.1 g / L sucrose, 0.05 mM pyridoxal phosphate (PLP), 5 mM MgSO4, 10 mM KH2PO4, with distilled water as the solvent and natural pH.

[0026] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0027] (1) The tyrosine phenol lyase mutant provided by the present invention has better enzyme activity than the wild type.

[0028] The T18L mutant showed a 178.0% increase in enzyme activity against phenol, a 97.6% increase against catechol, a 105.4% increase against pyrogallol, a 22.7% increase against o-fluorophenol, and a 118.0% increase against m-fluorophenol.

[0029] The Y417N mutant showed a 151.3% increase in enzyme activity for phenol, an 89.4% increase for catechol, a 16.3% increase for pyrogallol, a 185.0% increase for o-fluorophenol, and a 560.6% increase for m-fluorophenol.

[0030] (2) The tyrosine phenol lyase mutant provided by the present invention has better catalytic performance than the wild type.

[0031] The TPL mutant synthesized levodopa with a cumulative concentration exceeding 160 g / L and an optical purity greater than 99.9%, achieving a conversion rate of over 99.8% for the substrate catechol; L-tyrosine with a cumulative concentration exceeding 80 g / L and an optical purity greater than 99.9%, achieving a conversion rate of over 99.8% for the substrate phenol; 3,4,5-TOPA with a cumulative concentration exceeding 16.4 g / L and an optical purity greater than 99.9%, achieving a conversion rate of over 99.8% for the substrate pyrogallol; 3-fluoro-L-tyrosine with a cumulative concentration exceeding 33.1 g / L and an optical purity greater than 99.9%, achieving a conversion rate of over 95.7% for the substrate o-fluorophenol; and 2-fluoro-L-tyrosine with a cumulative concentration exceeding 20.5 g / L and an optical purity greater than 99.9%, achieving a conversion rate of over 61.9% for the substrate o-fluorophenol. (iv) Description of the attached drawings

[0032] Figure 1 The liquid phase peak spectrum of the catalytic reaction of catechol to generate L-DOPA.

[0033] Figure 2 Liquid phase peak spectrum of the catalytic reaction of phenol to produce L-tyrosine.

[0034] Figure 3 The liquid phase peak spectrum of the catalytic reaction of pyrogallol to generate 3,4,5-TOPA.

[0035] Figure 4 Liquid phase peak spectrum of the catalytic reaction of o-fluorophenol to produce 3-fluoro-L-tyrosine.

[0036] Figure 5 Liquid phase peak spectrum of the catalytic reaction of m-fluorophenol to produce 2-fluoro-L-tyrosine. (V) Detailed Implementation

[0037] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0038] Example 1: Obtaining the TPL gene

[0039] The whole genome DNA of *F. nucleatum* subsp. CGMCC 1.2526 (purchased from the China Industrial Microbial Culture Collection Center) was extracted using a DNA extraction kit (purchased from Thermo Fisher Scientific). PCR amplification was performed using this DNA as a template, with upstream primer (5'TGTTAGCAGCCGGATCTCAGT3') and downstream primer (5'GGAGATATACCATGCGCTTTGA3') as the active primers.

[0040] The following components were added to the PCR reaction system (total volume 50 μL): 10 μL of 5×PrimeSTAR™ HSDNA polymerase Buffer, 4 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP), 1 μL each of 50 μM upstream and downstream primers, 1 μL of genomic DNA, 0.5 μL of PrimeSTAR™ HSDNA polymerase, and 32.5 μL of nucleic acid-free water.

[0041] The PCR reaction conditions were as follows: pre-denaturation at 95℃ for 5 min, followed by temperature cycling at 95℃ for 1 min, 55℃ for 1 min, and 72℃ for 90 s for a total of 30 cycles, with a final extension at 72℃ for 10 min, and a termination temperature of 4℃.

[0042] Sequencing analysis results showed that the gene encoding TPL (Fn-TPL) was amplified through the above process, with a nucleotide sequence length of 1383 bp (its nucleotide sequence is shown in SEQ ID NO.1). This sequence encodes a complete open reading frame, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0043] Example 2: Construction of a TPL saturated mutant library

[0044] Using the TPL gene obtained in Example 1 as a template, the mutant sequence was obtained by PCR amplification. The primers for site-directed saturation mutagenesis at position 18 were:

[0045] TPL-18F: 5'GTGGAANNKGTGAAAATGATTGATAAAGCG 3'

[0046] TPL-18R: 5'TTTCACMNTTCCACTGATTTAATGCGAAA 3'.

[0047] The amplification primers for site-directed saturation mutagenesis at site 417 are:

[0048] TPL-417F: 5'TATACCNNKAAACATATGGATGTTGTTGCC 3'

[0049] TPL-417R: 5'ATGTTTMNNGGTATACACACGACCGCGGAAT 3'.

[0050] The amplification system (50 μL) consisted of: 25 μL of 2×phanta Max buffer; 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP); 2 μL each of 50 μM upstream and downstream primers; 1 μL of DNA template; 0.5 μL of Phanta Max DNA polymerase; and double-distilled water to make up the volume.

[0051] The PCR reaction conditions were as follows: pre-denaturation at 95℃ for 5 min, followed by temperature cycling at 95℃ for 30 s, 59℃ for 30 s, and 72℃ for 4 min 30 s, for a total of 30 cycles, with a final extension at 72℃ for 10 min, and a termination temperature of 4℃.

[0052] PCR products were analyzed by 1% agarose gel electrophoresis, transformed into E. coli BL21(DE3) competent cells, plated on LB plates containing kanamycin (50 μg / mL), incubated overnight at 37°C, and single colonies were picked for screening TPL mutant libraries.

[0053] Example 3: Screening of TPL mutant libraries

[0054] The TPL mutant library constructed in Example 2 was screened using salicylaldehyde spectrophotometry. The colorimetric principle is as follows: under alkaline conditions, sodium pyruvate and salicylaldehyde undergo a Claisen-Schmidt reaction to generate a yellow compound. The color intensity of this compound is directly proportional to the content of sodium pyruvate. The absorbance of the reaction solution was then measured at a specific wavelength using a spectrophotometer for screening.

[0055] (1) Induced expression of mutants

[0056] Using a sterilized toothpick, pick single colonies from the mutant library above into each well of a 96-well deep plate containing 600 μL of sterile LB medium (containing 50 μg / mL kanamycin) (do not pick colonies from the last 4 wells of column 11 and column 12). Pick wild-type single colonies into the last 4 wells of column 11, and do not pick colonies into the last 4 wells of column 12 as a blank control. After culturing at 37℃ and 180 rpm for 15 h, 200 μL of seed culture was transferred from each well to a new sterile 96-well deep plate containing 600 μL of sterile LB medium (containing 50 μg / mL kanamycin) per well. The plate was then incubated at 37℃ and 180 rpm until the OD600 reached 0.6-0.8. IPTG was added to each well to a final concentration of 0.1 mM, and the plate was induced at 28℃ and 180 rpm for 12 h. After incubation, the plate was centrifuged at 4℃ and 4000 rpm for 15 min, the supernatant was discarded, and the cells were stored at -20℃ for later use.

[0057] (2) Initial screening by colorimetric reaction

[0058] Remove the 96-well plate containing bacterial cells stored at 20℃ in step (1), and add 400 μL of reaction solution to each well. The solution consists of 40 mM sodium pyruvate, 40 mM catechol, 50 g / L ammonium acetate, 1 mM PLP, 1 g / L Na2SO3, and 2 g / L EDTA-2Na. Adjust the pH to 8.0 with ammonia. The solvent is 50 mM Tris-HCl buffer at pH 8.0. Incubate at 180 rpm for 30 min at room temperature. After the reaction is complete, add 400 μL of 1 M HCl to terminate the reaction and centrifuge. Use the supernatant after centrifugation for colorimetric reaction.

[0059] In a 1 mL standard reaction system, 100 μL of 250 g / L NaOH aqueous solution, 40 μL of supernatant, 560 μL of ultrapure water, and 20 μL of salicylaldehyde chromogenic solution (salicylaldehyde: anhydrous ethanol = 1:3, volume ratio) were added sequentially. After thorough mixing, 200 μL of 250 g / L NaOH aqueous solution and 80 μL of ultrapure water were added. After standing at room temperature for 2 hours, 200 μL of the chromogenic reaction solution was transferred to a 96-well standard plate, and the absorbance was measured at 465 nm using a microplate reader. The changes in absorbance were compared to identify changes in mutant enzyme activity. Using the unmutated enzyme as a reference, mutants with decreased absorbance were screened. Positive clones with increased activity were initially obtained through chromogenic reaction, and further determination was performed by liquid chromatography.

[0060] Table 1 Initial screening data of the TPL 18th site mutation library

[0061]

[0062] Table 2 Initial screening data of the TPL 417 site mutation library

[0063]

[0064] (3) Liquid chromatography screening

[0065] Step (2) The supernatant with increased activity (decreased absorbance) is then subjected to liquid chromatography detection.

[0066] The liquid chromatography (LC) detection conditions were as follows: The LC system was an Agilent 1260Ⅱ; the column was a C18 column (Welch, 5 μm × 250 × 4.6 mm); column temperature: 34℃; flow rate: 1 mL / min; injection volume: 10 μL; detection wavelength: UV 280 nm, 270 nm, or 210 nm; mobile phase: 20 mM KH₂PO₄ (pH adjusted to 2.6 with HCl): methanol = 9:1. When detecting L-DOPA, catechol, 3,4,5-TOPA, and pyrogallol, a detection wavelength of 280 nm was used; when detecting 3-fluoro-L-tyrosine, o-fluorophenol, 2-fluoro-L-tyrosine, and m-fluorophenol, a detection wavelength of 270 nm was used; and when detecting L-tyrosine and phenol, a detection wavelength of 210 nm was used.

[0067] Under the above chromatographic conditions, the elution times of L-DOPA and catechol were 3.984 min and 17.258 min, respectively; the elution times of 3,4,5-trihydroxyphenylalanine (3,4,5-TOPA) and pyrogallol were 3.542 min and 7.064 min, respectively; the elution times of 3-fluoro-L-tyrosine and o-fluorophenol were 5.919 min and 52.076 min, respectively; the elution times of 2-fluoro-L-tyrosine and m-fluorophenol were 6.488 min and 66.474 min, respectively; and the elution times of L-tyrosine and phenol were 4.983 min and 37.348 min, respectively.

[0068] The mutants TPL-T18L and TPL-Y417N with the highest activity were obtained by liquid chromatography. The enzyme activity of T18L wet cell was increased by 97.6%, and the enzyme activity of Y417N wet cell was increased by 89.4%. Sequencing showed that the amino acid sequence of mutant TPL-T18L is shown in SEQ ID No.4, and the nucleotide sequence is shown in SEQ ID No.3.

[0069] The amino acid sequence of the mutant TPL-Y417N is shown in SEQ ID No. 6, and the nucleotide sequence is shown in SEQ ID No. 5.

[0070] Example 4: Induced expression of wild-type and mutant TPL engineered bacteria

[0071] 1. Construction of engineered bacteria:

[0072] The wild-type TPL (SEQ ID No. 1) and mutant TPL-T18L and TPL-Y417N genes (SEQ ID No. 3 and SEQ ID No. 5) were respectively ligated into the vector pET-28b(+) to construct recombinant expression plasmids pET-28b(+)-Fn-TPL, pET-28b(+)-Fn-TPL-T18L and pET-28b(+)-Fn-TPL-Y417N.

[0073] The recombinant plasmids pET-28b(+)-Fn-TPL, pET-28b(+)-Fn-TPL-T18L and

[0074] pET-28b(+)-Fn-TPL-Y417N was transformed into E. coli BL21(DE3) to obtain engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL, E. coli BL21(DE3) / pET28b(+)-Fn-TPL-T18L and E. coli BL21(DE3) / pET28b(+)-Fn-TPL-Y417N, respectively.

[0075] 2. Induced expression of engineered bacteria

[0076] Engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL and E. coli were respectively introduced.

[0077] BL21(DE3) / pET-28b(+)-Fn-TPL-T18L and E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Then, 2% (v / v) inoculation was added into 50 mL of LB medium containing 50 μg / mL kanamycin and cultured at 37°C and 200 rpm until the bacterial concentration OD600 reached approximately 0.6. IPTG was added to a final concentration of 0.1 mM and induced at 28°C for 6–8 h. After incubation, the cells were centrifuged at 4°C and 8000 rpm for 10 min to collect the wet cells and stored at -80°C for later use.

[0078] Example 5: Preparation of TPL mutant catalyst

[0079] (1) Slant culture: The engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL, E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-T18L, and E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N were inoculated into slant culture medium containing 50 μg / mL kanamycin and cultured at 37℃ for 16 h to obtain slant cells; the final concentration composition of the slant culture medium was: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar, distilled water as solvent, pH 7.0, and 50 μg / mL kanamycin was added before use.

[0080] (2) Seed culture: The slant cells were inoculated into a seed culture medium containing 50 μg / mL kanamycin and cultured at 37℃ for 8-10 h to obtain seed liquid; the final concentration of the seed culture medium was: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, with distilled water as the solvent and pH 7.0.

[0081] (3) Fermentation culture: The seed culture was inoculated into a sterile 5L mechanically stirred and ventilated general-purpose fermenter containing 3L of fermentation medium at a volume concentration of 2%. Sterilized lactose was added directly to the fermenter at a final concentration of 15g / L. The fermentation was carried out at 28℃, with a stirring speed of 300rpm and an aeration rate of 5m³ / L. 3 After induction culture for 6-8 hours at an aeration rate of approximately 2 vvm / h and a pH controlled at 5.5 (adjusted with 30% ammonia and 45% phosphoric acid), the culture was transferred to a container and the wet cells were collected. The final concentration of the fermentation medium was: peptone 25 g / L, yeast extract 6.55 g / L, NaCl 10 g / L, sucrose 9.1 g / L, pyridoxal phosphate (PLP) 0.05 mM, MgSO4 5 mM, KH2PO4 10 mM, with distilled water as the solvent and natural pH.

[0082] Example 6: Synthesis of L-DOPA catalyzed by wild-type and mutant TPL

[0083] The engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-T18L (abbreviated as T18L wet cell), E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N (abbreviated as Y417N wet cell), and the starting strain E. coli BL21(DE3) / pET-28b(+)-Fn-TPL wet cell (abbreviated as TPL wet cell) were used as catalysts to catalyze the synthesis of L-DOPA from catechol.

[0084] 1. Enzyme activity

[0085] Add 5 g / L catechol, 7 g / L sodium pyruvate, 34.7 g / L ammonium chloride, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 2 g / L wet bacterial cells (wet weight) to a 10 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with hydrochloric acid. React at 15℃ and 150 rpm for 5 min. After the reaction is complete, add 10 mL of 1M HCl to terminate the reaction. Filter the terminated reaction solution through a 0.22 μm filter membrane, and use high-performance liquid chromatography (HPLC) to detect the peak area of ​​levodopa. Calculate the levodopa concentration based on the standard curve, and then calculate the enzyme activity.

[0086] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to generate 1 μmol of L-DOPA per minute is defined as one enzyme activity unit (U).

[0087] 2. Fermentation process

[0088] Add 5 g / L catechol, 7 g / L sodium pyruvate, 77 g / L ammonium acetate, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 20 g / L wet bacterial cells (wet weight) to a 500 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with hydrochloric acid. The reaction is carried out at 15℃ and 150 rpm using a substrate-feeding method, with feeding every 2 hours. Each feeding consists of 5 g / L catechol, 5 g / L sodium pyruvate, and 3.5 g / L ammonium acetate, for a total of 18 batches. After the reaction is complete, 1 mL of 1 M HCl is added to terminate the reaction. The terminated reaction solution is filtered through a 0.22 μm filter membrane, and the filtrate is analyzed by high-performance liquid chromatography (HPLC) to determine the peak areas of catechol and levodopa. Figure 1 The concentrations of each component were calculated based on the standard curve, the conversion rate was calculated based on the decrease in catechol in the reaction system, and the yield was calculated based on the accumulation of levodopa in the reaction system.

[0089] 3. High-performance liquid chromatography and standard curve

[0090] Mobile phase: A:B = 9:1 (A: 0.02M KH₂PO₄ - 6M HCl, pH = 2.6; B: methanol); Column:

[0091] C18 (Welchrom 4.6*250mm); detection wavelength 280nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0092] Catechol and levodopa standards were prepared to appropriate concentrations using ultrapure water and detected using the above-described liquid chromatography method. A standard curve was prepared based on the relationship between concentration and peak area. The equation for the catechol standard curve is: Y =

[0093] The standard curve for levodopa is Y = 1528.8X + 21.293, calculated as 1045.5X - 14.519.

[0094] 4. Results

[0095] Table 3. Detection results of catechol substrate by TPL wet cells, T18L wet cells, and Y417N wet cells.

[0096]

[0097] The results showed that the enzyme activity of T18L wet cells increased by 97.6%, the target product concentration reached 160 g / L, the catechol conversion rate reached 99.8%, and the optical purity of L-DOPA was greater than 99.9%.

[0098] The enzyme activity of Y417N wet bacterial cells was increased by 89.4%, the target product concentration reached 149 g / L, the conversion rate reached 97.6%, and the optical purity of L-DOPA was greater than 99.9%.

[0099] During the TPL wet cell reaction, the substrate was fed 14 times, the target product concentration reached 132 g / L, the conversion rate reached 92%, and the optical purity of L-DOPA was greater than 99.9%.

[0100] Example 7: Synthesis of L-tyrosine catalyzed by wild-type and mutant TPL

[0101] The engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-T18L (abbreviated as T18L wet cell), E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N (abbreviated as Y417N wet cell), and the starting strain E. coli BL21(DE3) / pET-28b(+)-Fn-TPL wet cell (abbreviated as TPL wet cell) were used as catalysts to catalyze the synthesis of L-tyrosine from phenol.

[0102] 1. Enzyme activity

[0103] Add 4.2 g / L phenol, 7 g / L sodium pyruvate, 34.7 g / L ammonium chloride, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 2 g / L wet bacterial cells (wet weight) to a 10 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with hydrochloric acid. React at 15℃ and 150 rpm for 5 min. After the reaction is complete, add 10 mL of 1M HCl to terminate the reaction. Filter the terminated reaction solution through a 0.22 μm filter membrane, and use high-performance liquid chromatography (HPLC) to detect the L-tyrosine peak area. Calculate the enzyme activity based on the standard curve.

[0104] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to generate 1 μmol of L-tyrosine per minute is defined as one enzyme activity unit (U).

[0105] 2. Fermentation process

[0106] In a 500 mL reaction system, 4.2 g / L phenol, 7 g / L sodium pyruvate, 77 g / L ammonium acetate, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 20 g / L wet bacterial cells (wet weight) were added. The solvent was Tris-HCl buffer (50 mM), and the pH was adjusted to 8.0 with hydrochloric acid. The reaction was carried out at 15℃ and 150 rpm using a substrate-fed reaction method, with feeding every 2 hours. Each feeding consisted of 4.2 g / L phenol, 5 g / L sodium pyruvate, and 3.5 g / L ammonium acetate, for a total of 8 batches. After the reaction was complete, 1 mL of 1 M HCl was added to terminate the reaction. The terminated reaction solution was filtered through a 0.22 μm filter membrane, and the filtrate was analyzed by high-performance liquid chromatography (HPLC) to determine the peak areas of phenol and L-tyrosine. Figure 2 The conversion rate is calculated based on the decrease in phenol in the reaction system, and the yield is calculated based on the accumulation of L-tyrosine in the reaction system.

[0107] 3. High-performance liquid chromatography and standard curve

[0108] Mobile phase: A:B = 9:1 (A: 0.02M KH₂PO₄ - 6M HCl, pH = 2.6; B: methanol); Column:

[0109] C18 (Welchrom 4.6*250mm); detection wavelength 210nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0110] L-tyrosine and phenol standards were prepared to appropriate concentrations using ultrapure water, and standard curves were prepared using the liquid chromatography detection method described above to correlate concentration with peak area. The equation for the phenol standard curve was Y = 2253.3X + 160.45, and the equation for the L-tyrosine standard curve was Y = 3027.9X + 160.38.

[0111] 4. Results

[0112] Table 4. Detection results of phenol substrate by TPL wet cells, T18L wet cells, and Y417N wet cells.

[0113]

[0114] The results showed that the enzyme activity of T18L wet cells increased by 178.0%, the target product concentration reached 80 g / L, the conversion rate reached 99.8%, and the optical purity of L-tyrosine was greater than 99.9%.

[0115] The enzyme activity of Y417N wet bacterial cells was increased by 151.3%, the target product concentration reached 69 g / L, the conversion rate reached 99.9%, and the optical purity of L-tyrosine was greater than 99.9%.

[0116] TPL wet cells achieved a target product concentration of 61.4 g / L, a conversion rate of 96.0%, and an L-tyrosine optical purity greater than 99.9%.

[0117] Example 8: Synthesis of 3,4,5-TOPA catalyzed by wild-type and mutant TPL

[0118] The engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-T18L (abbreviated as T18L wet cell), E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N (abbreviated as Y417N wet cell), and the starting strain E. coli BL21(DE3) / pET-28b(+)-Fn-TPL wet cell (abbreviated as TPL wet cell) were used as catalysts to catalyze the synthesis of 3,4,5-TOPA from pyrogallol.

[0119] 1. Enzyme activity

[0120] Add 5.7 g / L pyrogallol, 7 g / L sodium pyruvate, 34.7 g / L ammonium chloride, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 2 g / L wet bacterial cells (wet weight) to a 10 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with ammonia. React at 15℃ and 150 rpm for 10 min. After the reaction is complete, add 10 mL of 1M HCl to terminate the reaction. Filter the terminated reaction solution through a 0.22 μm filter membrane, and use high-performance liquid chromatography (HPLC) to detect the peak area of ​​3,4,5-TOPA. Calculate the amount of pyrogallol consumed per minute in the reaction system based on the standard curve, and then calculate the enzyme activity.

[0121] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to consume 1 μmol of pyrogallol per minute is defined as one enzyme activity unit (U).

[0122] 2. Fermentation process

[0123] Add 5.7 g / L pyrogallol, 7 g / L sodium pyruvate, 77 g / L ammonium acetate, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 20 g / L wet bacterial cells (wet weight) to a 500 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with hydrochloric acid. The reaction is carried out at 15℃ and 150 rpm using a substrate-feeding method, with feeding every 2 hours. Each feeding consists of 5.7 g / L pyrogallol, 5 g / L sodium pyruvate, and 3.5 g / L ammonium acetate, for two batches. After the reaction is complete, 1 mL of 1 M HCl is added to terminate the reaction. The terminated reaction solution is filtered through a 0.22 μm filter membrane, and the filtrate is analyzed by high-performance liquid chromatography (HPLC) to determine the peak areas of pyrogallol and 3,4,5-TOPA. Figure 3 The decrease in pyrogallol and the increase in 3,4,5-TOPA in the reaction system were obtained based on the standard curve, and the conversion rate and yield were calculated.

[0124] 3. High-performance liquid chromatography and standard curve

[0125] Mobile phase: A:B = 9:1 (A: 0.02M KH₂PO₄ - 6M HCl, pH = 2.6; B: methanol); Column:

[0126] C18 (Welchrom 4.6*250mm); detection wavelength 280nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0127] Phloroglucinol and 3,4,5-TOPA standards were prepared to appropriate concentrations using ultrapure water. Standard curves were then constructed using the aforementioned liquid chromatography detection method, relating concentration to peak area. The phloroglucinol standard curve was Y = 112.43X + 29.728, and the 3,4,5-TOPA standard curve was Y = 19.463X + 14.371.

[0128] 4. Results

[0129] Table 5. Detection results of the substrate pyrogallol by TPL wet cells, T18L wet cells, and Y417N wet cells.

[0130]

[0131] The results showed that the enzyme activity of T18L wet cells increased by 105.4%, the target product concentration reached 16.4 g / L, the conversion rate reached 99.8%, and the optical purity of 3,4,5-TOPA was greater than 99.9%.

[0132] The enzyme activity of Y417N wet cells was increased by 16.3%, the target product concentration reached 15.2 g / L, the conversion rate reached 97.8%, and the optical purity of 3,4,5-TOPA was greater than 99.9%.

[0133] TPL wet cells achieved a target product concentration of 11.4 g / L and a conversion rate of 98.8%, with 3,4,5-TOPA optical purity greater than 99.9%.

[0134] Example 9: Synthesis of 3-fluoro-L-tyrosine catalyzed by wild-type and mutant TPL

[0135] The engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-T18L (abbreviated as T18L wet cell), E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N (abbreviated as Y417N wet cell), and the starting strain E. coli BL21(DE3) / pET-28b(+)-Fn-TPL wet cell (abbreviated as TPL wet cell) were used as catalysts to catalyze the synthesis of 3-fluoro-L-tyrosine from o-fluorophenol.

[0136] 1. Enzyme activity

[0137] Add 5 g / L o-fluorophenol, 7 g / L sodium pyruvate, 34.7 g / L ammonium chloride, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 2 g / L wet bacterial cells (wet weight) to a 10 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with hydrochloric acid. React at 15℃ and 150 rpm for 10 min. After the reaction is complete, add 10 mL of 1M HCl to terminate the reaction. Filter the terminated reaction solution through a 0.22 μm filter membrane, and use high-performance liquid chromatography (HPLC) to detect the peak area of ​​3-fluoro-L-tyrosine. Obtain the 3-fluoro-L-tyrosine content in the reaction system according to the standard curve, and calculate the enzyme activity.

[0138] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to generate 1 μmol of 3-fluoro-L-tyrosine per minute is defined as one enzyme activity unit (U).

[0139] 2. Fermentation process

[0140] Add 5 g / L o-fluorophenol, 7 g / L sodium pyruvate, 77 g / L ammonium acetate, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 20 g / L wet bacterial cells (wet weight) to a 500 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with hydrochloric acid. The reaction is carried out at 15℃ and 150 rpm using a substrate-feeding method, with feeding every 2 hours. Each feeding consists of 5 g / L o-fluorophenol, 5 g / L sodium pyruvate, and 3.5 g / L ammonium acetate, for a total of 3 batches. After the reaction is complete, 1 mL of 1 M HCl is added to terminate the reaction. The terminated reaction solution is filtered through a 0.22 μm filter membrane, and the filtrate is analyzed by high-performance liquid chromatography (HPLC) to determine the peak areas of o-fluorophenol and 3-fluoro-L-tyrosine. Figure 4 The contents of o-fluorophenol and 3-fluoro-L-tyrosine in the reaction system were obtained according to the standard curve, and the conversion rate and yield were calculated.

[0141] 3. High-performance liquid chromatography and standard curve

[0142] Mobile phase: A:B = 9:1 (A: 0.02M KH₂PO₄ - 6M HCl, pH = 2.6; B: methanol); Column:

[0143] C18 (Welchrom 4.6*250mm); detection wavelength 270nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0144] o-Fluorophenol and 3-fluoro-L-tyrosine standards were prepared to appropriate concentrations using ultrapure water. A standard curve was prepared using the liquid chromatography method described above to correlate concentration with peak area. The equation for the o-fluorophenol standard curve is: Y =

[0145] The standard curve for 3-fluoro-L-tyrosine is Y = 700.72X - 38.971, where 831.59X - 185.35 is the value of 3-fluoro-L-tyrosine.

[0146] 4. Results

[0147] Table 6. Detection results of o-fluorophenol substrate by TPL wet cells, T18L wet cells, and Y417N wet cells.

[0148]

[0149] The results showed that the enzyme activity of T18L wet cells increased by 22.7%, the target product concentration reached 31.6 g / L, the conversion rate reached 93.5%, and the optical purity of 3-fluoro-L-tyrosine was greater than 99.9%.

[0150] The enzyme activity of Y417N wet cells was increased by 185.0%, the target product concentration reached 33.1 g / L, the conversion rate reached 95.7%, and the optical purity of 3-fluoro-L-tyrosine was greater than 99.9%.

[0151] TPL wet cells achieved a target product concentration of 29.8 g / L and a conversion rate of 89.2%, with an optical purity of 3-fluoro-L-tyrosine greater than 99.9%.

[0152] Example 10: Synthesis of 2-fluoro-L-tyrosine catalyzed by wild-type and mutant TPL

[0153] The engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-T18L (abbreviated as T18L wet cell), E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N (abbreviated as Y417N wet cell), and the starting strain E. coli BL21(DE3) / pET-28b(+)-Fn-TPL wet cell (abbreviated as TPL wet cell) were used as catalysts to catalyze the synthesis of 2-fluoro-L-tyrosine from m-fluorophenol.

[0154] 1. Enzyme activity

[0155] Add 5 g / L m-fluorophenol, 7 g / L sodium pyruvate, 34.7 g / L ammonium chloride, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 2 g / L wet bacterial cells (wet weight) to a 10 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with ammonia. React at 15℃ and 150 rpm for 10 min. After the reaction is complete, add 10 mL of 1M HCl to terminate the reaction. Filter the terminated reaction solution through a 0.22 μm filter membrane, and use high-performance liquid chromatography (HPLC) to detect the peak area of ​​2-fluoro-L-tyrosine. Obtain the 2-fluoro-L-tyrosine content in the reaction system according to the standard curve, and calculate the enzyme activity.

[0156] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to consume 1 μmol of m-fluorophenol per minute is defined as one enzyme activity unit (U).

[0157] 2. Fermentation process

[0158] Add 5 g / L m-fluorophenol, 7 g / L sodium pyruvate, 77 g / L ammonium acetate, 1 g / L sodium sulfite, 2 g / L EDTA·Na2, 1 mM pyridoxal phosphate (PLP), and 20 g / L wet bacterial cells (wet weight) to a 500 mL reaction system. The solvent is Tris-HCl buffer (50 mM), and the pH is adjusted to 8.0 with hydrochloric acid. The reaction is carried out at 15℃ and 150 rpm using a substrate-feeding method, with feeding every 2 hours. Each feeding consists of 5 g / L m-fluorophenol, 5 g / L sodium pyruvate, and 3.5 g / L ammonium acetate, for a total of 3 batches. After the reaction is complete, 1 mL of 1 M HCl is added to terminate the reaction. The terminated reaction solution is filtered through a 0.22 μm filter membrane, and the filtrate is analyzed by high-performance liquid chromatography (HPLC) to determine the peak areas of m-fluorophenol and 2-fluoro-L-tyrosine. Figure 5 The contents of intermediate fluorophenol and 2-fluoro-L-tyrosine in the reaction system were obtained according to the standard curve, and the conversion rate and yield were calculated.

[0159] 3. High-performance liquid chromatography and standard curve

[0160] Mobile phase: A:B = 9:1 (A: 0.02M KH₂PO₄ - 6M HCl, pH = 2.6; B: methanol); Column:

[0161] C18 (Welchrom 4.6*250mm); detection wavelength 270nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0162] m-Fluorophenol and 2-fluoro-L-tyrosine standards were prepared to appropriate concentrations using ultrapure water. A standard curve was prepared using the liquid chromatography method described above to correlate concentration with peak area. The m-Fluorophenol standard curve is Y =

[0163] The standard curve for 2-fluoro-L-tyrosine is Y = 244.82X - 1481.2, where 373.63X + 965.33 is the sum of its components.

[0164] 4. Results

[0165] Table 7. Detection results of TPL wet cells, T18L wet cells, and Y417N wet cells on the substrate m-fluorophenol.

[0166]

[0167]

[0168] The results showed that the enzyme activity of T18L wet cells increased by 118.0%, the target product concentration reached 14.3 g / L, the conversion rate reached 45.8%, and the optical purity of 2-fluoro-L-tyrosine was greater than 99.9%.

[0169] The enzyme activity of Y417N wet cells was increased by 560.6%, the target product concentration reached 20.5 g / L, the conversion rate reached 61.9%, and the optical purity of the 2-fluoro-L-tyrosine produced was greater than 99.9%.

[0170] TPL wet cells achieved a target product concentration of 8.2 g / L, a conversion rate of 27.8%, and an optical purity of 2-fluoro-L-tyrosine greater than 99.9%.

[0171] This invention is not limited to the specific textual description above. Various modifications can be made to this invention within the scope outlined in the claims, and all such modifications are within the scope of this invention.

Claims

1. A tyrosine phenol lyase mutant, characterized in that, The tyrosine phenol lyase mutant is obtained by mutating threonine at position 18 of the amino acid sequence shown in SEQ ID NO.2 to leucine or tyrosine at position 417 to asparagine.

2. A recombinant genetically engineered bacterium constructed from the encoding gene of the tyrosine phenol lyase mutant of claim 1.

3. The application of the tyrosine phenol lyase mutant of claim 1 in the synthesis of L-tyrosine derivatives, characterized in that, The method described is as follows: using wet bacterial cells obtained by fermentation culture of engineered bacteria containing the gene encoding tyrosine phenol lyase mutant as a catalyst, phenol derivative (Ⅰ), sodium pyruvate and ammonium acetate as substrates, sodium sulfite and EDTA·Na2 as auxiliaries, pyridoxal phosphate as a coenzyme, and a buffer solution with pH 6.0 to 10.5 as the reaction medium to form a transformation system, the transformation reaction is carried out at a temperature of 5 to 30°C and a rotation speed of 100 to 200 rpm. After the reaction is completed, the reaction solution is separated and purified to obtain L-tyrosine derivative (Ⅱ). Ⅰ Ⅱ In formula (I), R is monosubstituted or polysubstituted, and R is H, 2-hydroxy, 2,3-dihydroxy, 2-F, 3-F; in formula (II), R is the same as R in formula (I); The phenol derivative is one of phenol, catechol, pyrogallol, o-fluorophenol, and m-fluorophenol.

4. The application as described in claim 3, characterized in that, In the transformation system, the final concentration of phenol derivative is 4–50 g / L, sodium pyruvate is 5–50 g / L, ammonium acetate is 7.7–108 g / L, sodium sulfite is 0.5–10 g / L, EDTA·Na2 is 0.5–10 g / L, pyridoxal phosphate is 0.05–5 mM, and the amount of wet bacterial cells is 2–50 g / L.

5. The application as described in claim 3, characterized in that, When the phenol derivative is catechol, add it to a final concentration of 5–50 g / L; when the phenol derivative is phenol, add it to a final concentration of 4–40 g / L; when the phenol derivative is pyrogallol, add it to a final concentration of 5–50 g / L; when the phenol derivative is o-fluorobenzene, add it to a final concentration of 5–50 g / L; when the phenol derivative is m-fluorophenol, add it to a final concentration of 5–50 g / L.

6. The application as described in claim 3, characterized in that, During the conversion reaction, phenol derivatives, sodium pyruvate, and ammonium acetate are fed every 0.5 to 4 hours, with each feeding of phenol derivatives at a rate of 0.1 to 10 g / L, sodium pyruvate at a rate of 0.1 to 10 g / L, and ammonium acetate at a rate of 1 to 20 g / L.

7. The application as described in claim 3, characterized in that, The catalyst is prepared according to the following method: (1) Slant culture: The engineered bacteria containing the gene encoding the tyrosine lyase mutant were inoculated into a slant culture medium containing 50 μg / mL kanamycin and cultured at 37℃ for 8-16 h to obtain slant cells; the final concentration composition of the slant culture medium was: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar, and distilled water as solvent, pH 7.0; (2) Seed culture: The slant cells were inoculated into a seed culture medium containing 50 μg / mL kanamycin and cultured at 37℃ for 8-10 h to obtain seed liquid; the final concentration composition of the seed culture medium was: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, with distilled water as the solvent and pH 7.

0. (3) Fermentation culture: The seed culture was inoculated into a sterile 5L mechanically stirred and ventilated general-purpose fermenter containing 3L of fermentation medium at a volume concentration of 2%. Sterilized lactose was added directly to the fermenter at a final concentration of 15g / L. The fermentation was carried out at 28℃, with a stirring speed of 300 rpm and an aeration rate of 5 m³ / L. 3 After induction culture at pH 5.5 for 6-8 hours, the culture is transferred to a container and the wet cells are collected. The final concentration of the fermentation medium is: peptone 25 g / L, yeast extract 6.55 g / L, NaCl 10 g / L, sucrose 9.1 g / L, pyridoxal phosphate (PLP) 0.05 mM, MgSO4 5 mM, KH2PO4 10 mM, with distilled water as the solvent and natural pH.

Images