Mutant sequence of rice osabci gene and method and application thereof in regulating cadmium accumulation in rice

Abstract

The present disclosure relates to a mutant sequence of rice OsABCD1 gene and a method and application thereof in regulating cadmium accumulation in rice. Specifically, it relates to a mutant sequence of rice OsABCD1 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants and the application thereof. The present disclosure makes the function of the gene lost by gene mutation at the target site I of rice OsABCD1 gene, thereby reducing the accumulation of cadmium in rice; provides gene resources and technical support for breeding rice varieties with reduced cadmium absorption content, effectively improves the problem of excessive cadmium content in rice, and has important agricultural application value.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the technical field of rice genetic engineering, in particular, to a mutant sequence of rice OsABCD1 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants and application thereof. BACKGROUND

[0002] Rice is one of the most important food crops in the world, and its quality is closely related to human food safety. Cadmium (Cd) is a transitional heavy metal element, known as the "first of the five poisons", and has the characteristics of accumulation, concealment and irreversibility, which is difficult to eradicate. Cadmium accumulated in the edible part of crops can be enriched in the human body through the food chain and cause various diseases, posing a potential threat to human health. Rice has a higher cadmium accumulation characteristic compared to other crops. Studies have shown that nearly 80% of rice grown in high-cadmium contaminated soil has exceeded the standard, posing a great threat to human health. Different varieties of rice have different cadmium absorption capacities, so breeding low-cadmium rice varieties is an effective strategy to reduce cadmium content in rice, and low-cadmium rice varieties do not increase the additional cost of rice production, and play an important role in soil pollution prevention and control.

[0003] The ABC transporter family, also known as ATP-binding cassette transporter, is one of the largest and oldest protein superfamilies known. ABC transporters have ATP-binding domains and transmembrane structures, and members of this family are widely distributed in cytoplasmic membranes, mitochondrial membranes, endoplasmic reticulum membranes, and vacuole membranes. Their function is to transport substrates such as metal ions, secondary metabolites, and lipids across the membrane, and they release energy for substrate transport across the membrane through ATP binding and hydrolysis. Currently, the largest number of ABC transporters are found in plants, with 133 in rice. The ABC family in rice is divided into eight subfamilies ABCA~ABCI, of which the ABCG subfamily has the largest number of proteins. Studies have shown that the OsABCG43 member of this family may be related to the transport of heavy metal Cd. However, there are few reports on the regulation of cadmium transport by other ABC family proteins in rice. Therefore, finding target genes that can reduce cadmium content in rice can provide gene resources for low-cadmium breeding in rice, and has important agricultural application value. SUMMARY

[0004] To solve the problem of excessive cadmium in rice in the prior art, the purpose of the present disclosure is to screen genes and methods that can reduce cadmium in rice, and to breed rice varieties with reduced cadmium absorption content.

[0005] In order to achieve the above-mentioned purpose, the first aspect of the present disclosure provides a mutant sequence of rice OsABCD1 gene, wherein the mutant sequence is obtained by mutating the nucleotide sequence of rice OsABCD1 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides on the rice OsABCD1 gene.

[0006] The nucleotide sequence of the rice OsABCD1 gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the rice OsABCD1 gene is shown as SEQ ID NO: 2.

[0007] Optionally, the mutant sequence is selected from at least one of the following sequences:

[0008] (1) the nucleotide sequence shown as SEQ ID NO: 3 obtained by inserting base A between the 6th and 7th bases of the sequence of target site I of the rice OsABCD1 gene;

[0009] (2) the nucleotide sequence shown as SEQ ID NO: 5 obtained by inserting base C between the 6th and 7th bases of the sequence of target site I of the rice OsABCD1 gene;

[0010] (3) the nucleotide sequence shown as SEQ ID NO: 7 obtained by deleting the fragment AAAGCAC from the 4th to 10th bases of the sequence of target site I of the rice OsABCD1 gene;

[0011] (4) the nucleotide sequence shown as SEQ ID NO: 9 obtained by deleting the fragment AAAG from the 4th to 7th bases of the sequence of target site I of the rice OsABCD1 gene;

[0012] The nucleotide sequence of the target site I is shown as SEQ ID NO: 11.

[0013] The second aspect of the present disclosure provides a protein encoded by the mutant sequence of the first aspect, and the amino acid sequence of the protein is shown as SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and / or SEQ ID NO: 10.

[0014] The third aspect of the present disclosure provides a vector, wherein the vector is a CRISPR / Cas9 editing vector, the vector is inserted with a target site I, and a mutant sequence as described in the first aspect is generated;

[0015] The nucleotide sequence of the target site I is shown as SEQ ID NO: 11.

[0016] The fourth aspect of the present disclosure provides a transformant, wherein a host of the transformant is a genetically engineered bacterium; and wherein the transformant has a target site I introduced therein, or wherein the transformant has the vector of the third aspect introduced therein.

[0017] The nucleotide sequence of the target site I is shown in SEQ ID NO: 11.

[0018] The fifth aspect of the present disclosure provides a method for reducing cadmium accumulation in a rice plant, the method comprising:

[0019] The nucleotide sequence of the target site I is shown in SEQ ID NO: 11.

[0020] The nucleotide sequence of the target site I is shown in SEQ ID NO: 11.

[0021] Optionally, the method for gene editing comprises:

[0022] S1, designing a CRISPR / Cas9 editing vector according to a target site I of a rice OsABCD1 gene;

[0023] S2, introducing the CRISPR / Cas9 editing vector into a rice plant through Agrobacterium infection, randomly mutating at the target site I in the rice plant, and then detecting and screening a T0 generation positive plant with a functional defective mutation according to a designed primer;

[0024] S3, selfing the T0 generation positive plant to screen a T1 generation homozygous mutant plant, and obtaining a rice plant with reduced cadmium content;

[0025] The nucleotide sequence of the target site I is shown in SEQ ID NO: 11.

[0026] The nucleotide sequence of the target site I is shown in SEQ ID NO: 11.

[0027] Optionally, in step S2, the mutation comprises one of the following:

[0028] (a) inserting a base A between the 6th and 7th bases of the sequence of the target site I of the rice OsABCD1 gene;

[0029] (b) inserting a base C between the 6th and 7th bases of the sequence of the target site I of the rice OsABCD1 gene;

[0030] (c) deleting the fragment AAAGCAC of the sequence from the 4th to the 10th of the target site I of the rice OsABCD1 gene;

[0031] (d) deleting the fragment AAAG of the sequence from the 4th to the 7th of the target site I of the rice OsABCD1 gene.

[0032] The sixth aspect of the present disclosure provides the application of the rice OsABCD1 gene and the protein encoded by the rice OsABCD1 gene in regulating the accumulation of cadmium in rice and cultivating rice varieties with reduced cadmium absorption content.

[0033] The seventh aspect of the present disclosure provides the application of the rice OsABCD1 gene of the first aspect, the protein of the second aspect, the vector of the third aspect or the transformant of the fourth aspect in regulating the accumulation of cadmium in rice and cultivating rice varieties with reduced cadmium absorption content.

[0034] Through the above technical solution, the present disclosure makes the function of the gene lost by performing gene mutation on the target site I of the rice OsABCD1 gene, and then reduces the accumulation of cadmium in rice. The present disclosure provides gene resources and technical support for cultivating rice varieties with reduced cadmium absorption content, effectively improves the problem of excessive cadmium content in rice, and has important agricultural application value.

[0035] Other features and advantages of the present disclosure will be described in detail in the following specific implementation part. BRIEF DESCRIPTION OF DRAWINGS

[0036] The accompanying drawings are used to provide a further understanding of the present disclosure, and constitute a part of the specification, and are used to explain the present disclosure together with the following specific implementation, but do not constitute a limitation of the present disclosure. In the drawings:

[0037] Figure 1 is a genotype analysis diagram of the mutant and the wild type obtained by CRISPR / Cas9 osabcd1-1 , osabcd1-2, osabcd1-3 and osabcd1-4 mutant and wild type (WT) cadmium content detection results.

[0038] Figure 2 is a genotype analysis diagram of the mutant and the wild type obtained by CRISPR / Cas9 osabcd1-1 and osabcd1-2 mutant and wild type (WT) cadmium content detection results. DETAILED DESCRIPTION

[0039] The specific implementation of the present disclosure is described in detail below in combination with the drawings. It should be understood that the specific implementation described herein is only used to illustrate and explain the present disclosure, and is not used to limit the present disclosure.

[0040] The first aspect of the present disclosure provides a mutant sequence of rice OsABCD1 gene, wherein the mutant sequence is obtained by mutating the nucleotide sequence of rice OsABCD1 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides on the rice OsABCD1 gene.

[0041] The nucleotide sequence of the rice OsABCD1 gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the rice OsABCD1 gene is shown as SEQ ID NO: 2.

[0042] In the present disclosure, the inventors of the present disclosure surprisingly found that the OsABCD1 (accession number: LOC_Os01g11946) gene can regulate the accumulation of cadmium in rice, and the present disclosure makes the function of the gene lost by mutating the target site I of the rice OsABCD1 gene, thereby reducing the accumulation of cadmium in rice.

[0043] In one specific embodiment of the present disclosure, the mutant sequence is selected from at least one of the following sequences:

[0044] (1) a nucleotide sequence shown as SEQ ID NO: 3 obtained by inserting base A between the 6th and 7th bases of the sequence of the target site I of the rice OsABCD1 gene;

[0045] (2) a nucleotide sequence shown as SEQ ID NO: 5 obtained by inserting base C between the 6th and 7th bases of the sequence of the target site I of the rice OsABCD1 gene;

[0046] (3) a nucleotide sequence shown as SEQ ID NO: 7 obtained by deleting the fragment AAAGCAC from the 4th to 10th bases of the sequence of the target site I of the rice OsABCD1 gene;

[0047] (4) a nucleotide sequence shown as SEQ ID NO: 9 obtained by deleting the fragment AAAG from the 4th to 7th bases of the sequence of the target site I of the rice OsABCD1 gene;

[0048] The nucleotide sequence of the target site I is shown as SEQ ID NO: 11.

[0049] In the present disclosure, the inventors of the present disclosure design an editing vector according to the target site I, the vector is infected into the rice plant through Agrobacterium, in the rice plant, random mutation is carried out at the target site, then the mutation sequence is detected according to the designed primer, and the mutant strain with base A or C insertion and AAAGCAC fragment or AAAG fragment deletion is selected, the base A or C is inserted into the sequence of the target site I, the codon sequence and composition after the insertion of the base are changed accordingly, the stop codon appears in advance, and the protein function is changed; or, the AAAGCAC fragment or the AAAG fragment is deleted, the open reading frame is changed, the translation of the protein is terminated in advance, and the protein function is changed.

[0050] The second aspect of the present disclosure provides a protein encoded by the mutant sequence of the first aspect, and the amino acid sequence of the protein is shown as SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and / or SEQ ID NO: 10.

[0051] According to the present disclosure, the nucleotide sequence shown as SEQ ID NO: 3 encodes the protein shown as SEQ ID NO: 4; the nucleotide sequence shown as SEQ ID NO: 5 encodes the protein shown as SEQ ID NO: 6; the nucleotide sequence shown as SEQ ID NO: 7 encodes the protein shown as SEQ ID NO: 8; and the nucleotide sequence shown as SEQ ID NO: 9 encodes the protein shown as SEQ ID NO: 10.

[0052] The third aspect of the present disclosure provides a vector, and the vector is a CRISPR / Cas9 editing vector, the vector is inserted with the target site I, and the mutant sequence as described in the first aspect is generated.

[0053] The nucleotide sequence of the target site I is shown as SEQ ID NO: 11.

[0054] The fourth aspect of the present disclosure provides a transformant, and the host of the transformant is a genetically engineered bacterium; the transformant is introduced with the target site I, or the transformant is introduced with the vector of the third aspect.

[0055] The nucleotide sequence of the target site I is shown as SEQ ID NO: 11.

[0056] In the present disclosure, the host cell of the transformant can be a genetically engineered bacterium, preferably, the genetically engineered bacterium can be Agrobacterium EHA105.

[0057] The fifth aspect of the present disclosure provides a method for reducing the accumulation of cadmium in rice plants, and the method comprises:

[0058] The OsABCD1 gene of rice is edited to mutate the nucleotide sequence of the OsABCD1 gene of rice and change the protein encoded by the OsABCD1 gene.

[0059] The mutation includes substitution, deletion and / or addition of one or more nucleotides in the OsABCD1 gene of rice.

[0060] In the present disclosure, the OsABCD1 gene of rice is edited to change the protein encoded by the OsABCD1 gene, so as to lose the function of the OsABCD1 gene, which is beneficial to breed rice varieties with reduced cadmium absorption content and solve the problem of excessive cadmium content in rice.

[0061] In one specific embodiment of the present disclosure, the method for gene editing comprises:

[0062] S1, designing a CRISPR / Cas9 editing vector according to a target site I of the OsABCD1 gene of rice;

[0063] S2, introducing the CRISPR / Cas9 editing vector into rice plants by Agrobacterium infection, randomly mutating at the target site I in the rice plants, and then detecting and screening T0 generation positive plants with functional defective mutations according to the designed primers;

[0064] S3, selfing the T0 generation positive plants to screen T1 generation homozygous mutant plants, and obtaining rice plants with reduced cadmium content;

[0065] The nucleotide sequence of the target site I is shown in SEQ ID NO: 11.

[0066] The sequence of the primer is shown in SEQ ID NO: 12 and SEQ ID NO: 13.

[0067] In a preferred embodiment of the present disclosure, in step S2, the mutation includes one of the following:

[0068] (a) inserting base A between the 6th and 7th bases of the sequence of the target site I of the OsABCD1 gene of rice;

[0069] (b) inserting base C between the 6th and 7th bases of the sequence of the target site I of the OsABCD1 gene of rice;

[0070] (c) deleting the fragment AAAGCAC from the 4th to 10th bases of the sequence of the target site I of the OsABCD1 gene of rice;

[0071] (d) deleting the fragment AAAG of positions 4-7 of the sequence of the target site I of the rice OsABCD1 gene.

[0072] The sixth aspect of the present disclosure provides the application of the rice OsABCD1 gene and the protein encoded by the rice OsABCD1 gene in regulating the accumulation of cadmium in rice and cultivating rice varieties with reduced cadmium absorption content.

[0073] The seventh aspect of the present disclosure provides the application of the rice OsABCD1 gene of the first aspect, the protein of the second aspect, the vector of the third aspect or the transformant of the fourth aspect in regulating the accumulation of cadmium in rice and cultivating rice varieties with reduced cadmium absorption content.

[0074] In the present disclosure, by mutating the rice OsABCD1 gene and changing the structure and function of the protein encoded by the rice OsABCD1 gene, the cadmium content in the rice grains of the mutant plant is significantly reduced, indicating that the mutation of the rice OsABCD1 gene of the present disclosure can effectively reduce the cadmium content in the rice grains. Cultivating rice varieties with reduced cadmium absorption content using the mutant of the rice OsABCD1 gene has potential application value in agricultural applications.

[0075] The present disclosure is further illustrated in detail by the following examples.

[0076] The raw materials used in the examples can be obtained through commercial channels. The specific experimental conditions not specified in the examples are in accordance with the conventional conditions well known to those skilled in the art.

[0077] Example 1

[0078] This example is used to illustrate the rice osabcd1 Obtaining of the mutant.

[0079] In order to study the function of the rice OsABCD1 gene, the CRISPR / Cas9 technology is used to edit the target site I of the rice OsABCD1 gene with the nucleotide sequence shown in SEQ ID NO: 1, and the sequence of the target site I is: GCCAAAGCACGTAACAAAG (SEQ ID NO: 11).

[0080] The specific method includes:

[0081] 1. Construction of CRISPR / Cas9 recombinant vector:

[0082] (1) Sequence alignment analysis was performed using the NCBI database to find the homologous gene of the Arabidopsis thaliana OsABCD1 gene in rice. The homologous gene was found in the rice genome, and we named the gene OsABCD1 (SEQ ID NO: 1). Its nucleotide coding region (CDS) sequence is shown in SEQ ID NO. 1, and the encoded amino acid sequence is shown in SEQ ID NO. 2.

[0083] (2) Target sites were designed for the OsABCD1 gene in the rice genome, and the target site I for OsABCD1 gene mutation was analyzed as: GCCAAAGCACGTAACAAAG. A CRISPR / Cas9 editing vector was designed based on target site I, and the vector was introduced into rice plants via Agrobacterium infection. Mutations were then performed in the rice plants at target site I; for example... Figure 1 As shown, bases A and C were inserted into the sequence of target site I, respectively, to delete the AAAGCAC or AAAAG fragment in target site I, resulting in four types of mutant editing vectors.

[0084] 2. Obtaining pure genetically modified rice:

[0085] (1) Using the japonica rice variety Nipponbare as the recipient material, the T0 generation transgenic rice plants were obtained by transforming rice callus tissue using Agrobacterium-mediated transformation.

[0086] PCR amplification was performed using two pairs of primers: GP2091-2079-F: ACGAAGGGTTCCCAAAACCA (SEQ ID NO: 12); and GP2091-2079-R: AACACCCAGGAGTGGAAACA (SEQ ID NO: 13) to amplify the fragment containing the target site. After gel extraction and sequencing, plants with mutations at the target site were detected.

[0087] (2) The results showed that the T0 generation transgenic plants contained OsABCD1, and the OsABCD1 gene target site I contained A base insertion target site I ( osabcd1-1 SEQ ID NO: 3), C base insertion target site I ( osabcd1-2 SEQ ID NO: 5), with missing AAAGCAC fragments ( osabcd1-3 (SEQ ID NO: 7) or has a missing AAAA fragment ( osabcd1-4 (SEQ ID NO: 9), causing the stop codon to appear prematurely, thus terminating the translation. osabcd1-1, osabcd1-2, osabcd1-3 and osabcd1-4 The OsABCD1 gene function is altered in the mutant.

[0088] (3) Harvest osabcd1-1 and osabcd1-2Seeds of homozygous mutants with functional defects were used for next-generation propagation. Mixed DNA samples were taken from T1 generation homozygous mutant seedlings for sequencing identification. The results showed that all T1 generation plants were homozygous mutant plants. The harvested seeds were T1 generation gene-edited rice. Cadmium content in the grains (brown rice) of the T1 generation homozygous mutant plants was determined, and the results are as follows... Figure 2 As shown, "**" indicates the difference compared to the wild type. p <0.01; "*" indicates compared to the wild type, p <0.05; "***" indicates compared to the wild type, p <0.001. (By...) Figure 2 It can be seen that, osabcd1-1 and osabcd1-2 The cadmium content in the grains (brown rice) of the functional defect homozygous mutant rice was significantly higher or lower than that in wild-type rice.

[0089] The results show that mutating the rice OsABCD1 gene using gene editing methods can reduce the cadmium content in the grains, providing a new approach for breeding rice varieties with reduced cadmium absorption.

[0090] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0091] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0092] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A method for reducing cadmium accumulation in rice grains, characterized in that, The method includes: Gene editing of the rice OsABCD1 gene mutated the nucleotide sequence of the rice OsABCD1 gene and altered the protein encoded by the OsABCD1 gene. The mutations include the substitution, deletion and / or addition of one or more nucleotides in the rice OsABCD1 gene; The gene editing method includes: S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCD1 gene; S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium. Mutations were randomly performed at target site I in the rice plants. Then, the designed primers were used for detection to screen and obtain T0 generation positive plants with functional defect mutations. S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content. The nucleotide sequence of target site I is shown in SEQ ID NO: 11; The sequences of the primers are shown in SEQ ID NO: 12 and SEQ ID NO: 13; The nucleotide sequence of the rice OsABCD1 gene is shown in SEQ ID NO:

1.

2. The method according to claim 1, wherein, In step S2, the mutation includes one of the following: (a) Insert a base A between the 6th and 7th bases of the target site I sequence of the rice OsABCD1 gene; (b) Insert a base C between the 6th and 7th bases of the target site I sequence of the rice OsABCD1 gene; (c) Delete the AAAGCAC segment from position 4 to position 10 of the target site I of the rice OsABCD1 gene. (d) Deletion of the AAAAG segment from position 4 to position 7 of the target site I of the rice OsABCD1 gene.

Images