A rapid identification kit for Salmonella pullorum and Salmonella gallinarum based on res gene
Through PCR detection technology based on the res gene, the problem of difficult to quickly identify chicken dysentery and chicken typhoid Salmonella in the prior art is solved, and a fast, accurate and simple identification method is achieved, which is suitable for batch testing.
Patent Information
- Application Number
- CN202411247364.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-06
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2044-09-06
AI Technical Summary
The prior art is difficult to quickly, accurately and easily identify chicken dysentery and chicken Salmonella typhimurium, especially when the pathogenesis is extremely similar.
By analyzing the res gene sequence of Salmonella, screening out specific detection targets, and designing corresponding PCR detection primers, a rapid identification kit based on the res gene is developed, which can distinguish between dysentery and Salmonella typhimurium in a PCR reaction.
It achieves rapid and accurate identification of chicken dysentery and chicken typhoid Salmonella, reduces the detection time and cost, and is suitable for batch testing.
Smart Images

Figure CN119120742B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biological detection, and relates to a rapid identification kit for Salmonella pullorum and Salmonella gallinarum based on a res gene. Background Art
[0002] Salmonella is a bacterial disease that seriously endangers the healthy breeding of poultry. It can be divided into three categories according to the type of disease: pullorum, gallinule typhoid and paratyphoid. Among them, pullorum and gallinule typhoid have a great impact on the production of breeder chickens and are seed-borne diseases that must be purified. Pullorum and gallinule typhoid are caused by infection with Salmonella pullorum and Salmonella gallinule typhi, respectively. Salmonella pullorum mainly causes acute systemic diseases in chicks, with a mortality rate of more than 90%. Adult chickens rarely have clinical symptoms after infection, but have a greater impact on production performance such as fertilization rate and hatching rate. Salmonella gallinule typhi causes acute or chronic septicemia, which mainly harms adult poultry.
[0003] Salmonella pullorum and Salmonella gallinarum are very similar in terms of etiology. For example, both cannot express flagella, are not motile, and their colony size on agar plates is significantly smaller than other Salmonella serotypes. They also have the same bacterial antigen (O antigen), so they are currently classified as Salmonella gallinarum serotypes, but they are two different biotypes of this serotype (Salmonella pullorum and Salmonella gallinarum typhoid). Studies have shown that these two biotypes cannot be distinguished by serological experiments, and special biochemical reagents such as ornithine and dulcitol must be used, but their application is limited because they cannot meet the requirements of rapid and batch detection. With the rapid development of molecular biology, some molecular detection technologies for identifying Salmonella pullorum and Salmonella gallinarum have been reported. However, some of the above methods require the use of multiple pairs of primers, some require further enzyme digestion and identification of the amplified products, and some methods still have specificity problems, so there is still a need to further develop simple and rapid identification methods (Gong Jiansen et al. Validation of molecular typing methods for Salmonella pullorum and Salmonella gallinarum. Chinese Journal of Zooinfectious Diseases. 2021).
[0004] In order to quickly, accurately and conveniently identify the two biotypes of Salmonella pullorum and Salmonella typhi in the serotypes of Salmonella typhi, the present invention analyzes and screens a detection target based on the res gene according to the published Salmonella genome sequence, further designs detection primers, and successfully develops a practical technology for quickly identifying Salmonella pullorum and Salmonella typhi. Summary of the invention
[0005] Aiming at the shortcomings of traditional technology in identifying pullorum and Salmonella gallinarum, the present invention provides a molecular kit for specifically identifying pullorum and Salmonella gallinarum and a non-diagnostic detection method thereof.
[0006] The technical solution of the present invention is as follows:
[0007] The invention provides a pullorum and Salmonella typhi rapid identification kit based on res gene and a non-diagnostic detection method thereof. The pullorum and Salmonella typhi rapid identification kit comprises 10×PCR buffer, 10Mm dNTPs, 2.5U / μl Taq DNA polymerase, PCR detection primers, positive control, negative control and blank control, wherein the positive control is Salmonella pullorum ATCC10398 genomic DNA, the negative control is Salmonella typhi ATCC9184 genomic DNA, and the blank control is sterilized double distilled water; the primers of the PCR primer group comprise:
[0008] For: 5'-ATCTCATCAACCAGCATACT-3'
[0009] Rev: 5'-TTCTTACGCAGCAATGAG-3'.
[0010] Furthermore, the components of the PCR detection system are as follows: each 25 μl reaction solution includes 2.5 μl of 10×PCR buffer, 2 μl of dNTPs, 0.25 μl of Taq DNA polymerase, 1 μl of detection primer, 1-2 μl of DNA template and an appropriate amount of sterile double distilled water.
[0011] Furthermore, the preparation method of the PCR detection method is as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds; annealing at 58°C for 30 seconds; extension at 72°C for 40 seconds; a total of 30 cycles, and finally extension at 72°C for 10 minutes.
[0012] Furthermore, the 10× PCR buffer contains 100 mM KCl, 80 mM (NH 4 )SO 4 , 100 mM Tris-HCl, pH 9.0, 15 mM MgCl 2 and 0.5% Tergitol-type NP-40.
[0013] Furthermore, the primer concentration is 10 μM.
[0014] Furthermore, the dNTPs include dATP, dTTP, dCTP, and dGTP, and the concentration of each component is 2.5 mM.
[0015] Furthermore, the kit does not include other primers. Furthermore, a method for non-diagnostic detection using a rapid identification kit for Salmonella pullorum and Salmonella gallinarum comprises the following steps:
[0016] S1: Use the boiling method or commercial kit to extract bacterial genomic DNA to obtain the detection template.
[0017] S2: PCR amplification, add 10× PCR buffer, dNTPs, Taq DNA polymerase, detection primer set and DNA template into a sterile PCR reaction tube, add sterile double distilled water to a total volume of 25 μl, set up positive, negative and blank controls, and use a PCR instrument to perform amplification reaction; use 1.5% agarose gel electrophoresis to perform electrophoresis detection on the amplified products and analyze the results;
[0018] The primers of the primer set include:
[0019] For: 5'-ATCTCATCAACCAGCATACT-3'
[0020] Rev: 5'-TTCTTACGCAGCAATGAG-3'.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] The present invention can quickly identify Salmonella pullorum and Salmonella gallinarum through one reaction, that is, the one with 528bp band is Salmonella gallinarum, and the one without band is Salmonella pullorum. Compared with traditional biochemical typing and other PCR detection methods, it has great advantages in detection time and detection cost, and is suitable for batch detection. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 The figure is the result of gel electrophoresis of the primer screening experiment for distinguishing Salmonella pullorum and Salmonella gallinarum in Example 1. In the figure: M is DL-2000 marker, lanes 1-3 are the detection results of primer set 1 (the order is Salmonella pullorum ATCC10398, ATCC9184, negative control, the same below), lanes 4-6 are the detection results of primer set 2, and lanes 7-9 are the detection results of primer set 3.
[0024] Figure 2 The results of gel electrophoresis in the specificity evaluation experiment in Example 2 are shown in the figure: M is DL-2000 marker, lanes 1 to 6 are Salmonella Galli typhi ATCC9184, CVCC79301, CVCC536, CVCC537, CVCC538 and 9R, lanes 7 to 12 are Salmonella Pullorum ATCC19945, ATCC10398, CMCC50771, CVCC519, CVCC521 and CVCC526, and lane 13 is a negative control.
[0025] Figure 3The sensitivity test experiment gel electrophoresis result diagram in Example 3. In the figure: M is DL-2000 marker, lanes 1 to 6 are the genome of Salmonella typhi ATCC 9184, and the concentrations are 97.5 ng / reaction, 9.75 ng / reaction, 0.975 ng / reaction, 97.5 pg / reaction, 9.75 pg / reaction and 0.975 pg / reaction, respectively; 7: negative control. DETAILED DESCRIPTION
[0026] The present invention is further described below in conjunction with the embodiments and drawings. The following description is only a preferred embodiment of the present invention and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change it into an equivalent embodiment with equivalent changes. Any simple modification or equivalent change made to the following embodiments based on the technical essence of the present invention without departing from the content of the present invention is within the protection scope of the present invention.
[0027] Example 1 Screening of primers for identifying Salmonella pullorum and Salmonella gallinarum and establishment of a rapid identification method
[0028] Salmonella pullorum and Salmonella Gallinarum are two different biotypes of the same serotype, and are highly similar in antigenic structure, biochemical characteristics, and gene sequence. Analysis of the res gene sequences of Salmonella pullorum and Salmonella Gallinarum showed that Salmonella pullorum has one less sequence (76 bp) in the coding region than Salmonella Gallinarum. Based on this finding, we selected three pairs of identification primers (Table 1).
[0029] Table 1. Screening of primers for identification of Salmonella pullorum and Salmonella gallinarum
[0030]
[0031] Preparation of PCR template: After the reference strains Salmonella pullorum ATCC10398 and Salmonella gallinarum ATCC9184 were enriched in broth overnight, the genome of the above-mentioned Salmonella standard strains was extracted using a kit as the template to be tested.
[0032] PCR amplification reagents include: 10×PCR buffer (its components include 100mM KCl, 80mM (NH4)SO4, 100mM Tris-HCl with a pH of 9.0, 15mM MgCl2 and 0.5% Tergitol-type NP-40), dNTPs (including dATP, dTTP, dCTP, dGTP, and the concentration of each component is 2.5mM), Taq DNA polymerase (2.5U / μl), and detection primers.
[0033] PCR detection system and amplification procedure: The detection system is 25 μl, including: 2.5 μl 10×PCR buffer, 2 μl dNTPs, 0.25 μl Taq DNA polymerase, 1 μl detection primer set, 2 μl DNA template and an appropriate amount of sterile double distilled water. The steps of the amplification procedure include: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 40 s, a total of 30 cycles, and finally 72°C extension for 10 min; after the reaction is completed, the amplified product is taken out and stored at 4°C.
[0034] Determination of PCR test results: Take 5μl of amplified product, add 1μl 6× Loading buffer and mix well, spot it in the wells of 1.5% agarose gel electrophoresis plate, 120V voltage, electrophoresis for 30min, and take pictures under gel imager for determination. Recover the amplified product and clone it into pMD-19T vector, pick positive clones for sequencing, and compare the results with known sequences.
[0035] according to Figure 1 From the agarose gel electrophoresis, it can be found that the three designed primers can be specifically amplified (the results after sequencing are consistent with the original sequence). Among the three primers: the two bands of primer 1 are similar in size (less than 100 bp), which is easy to misjudge without comparison; under the same amplification conditions, it can be seen from the scanning grayscale that the amplification efficiency of primers 2 and 3 is higher than that of primer 1, but primer 2 has a non-specific amplification band (lane 4); therefore, primer 3 is selected as the amplification primer of the present invention.
[0036] Example 2 Specificity evaluation experiment
[0037] The specificity of the rapid identification kit of the present invention was evaluated by the method of Example 1. Six reference strains of Salmonella pullorum (ATCC19945, ATCC10398, CMCC50771, CVCC519, CVCC521, and CVCC526) and six reference strains of Salmonella gallinarum (ATCC9184, CVCC79301, CVCC536, CVCC537, CVCC538, and 9R) were selected. After enrichment in broth, bacterial genomic DNA was extracted using the kit. PCR detection was performed according to the method described in Example 1. The results are as follows: Figure 2 As shown, all Salmonella Gallinarum can amplify a specific amplification band of 617 bp, while all Salmonella Pullorum do not have an amplification band. The above results show that the method established by the present invention has good specificity.
[0038] Example 3 Sensitivity test experiment
[0039] The sensitivity evaluation of the rapid identification method of the present invention was performed using the method of Example 1. After the Salmonella enterica serovar Gallinarum ATCC9184 was cultured overnight in broth, the bacterial genomic DNA was extracted using a kit, and its original concentration was measured and then diluted 10 times in a gradient. The genomic DNA of different dilution gradients was subjected to a sensitivity evaluation test. After the reaction was completed, 5 μl of the amplified product was taken, 1 μl of 6× Loading buffer was added and mixed, and the product was detected by 1.5% agarose gel electrophoresis. The electrophoresis results are shown in FIG. Figure 2 As shown, M is DL-200 marker (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp and 100 bp, respectively), and the reaction concentrations of lanes 1-6 are 97.5 ng / reaction, 9.75 ng / reaction, 0.975 ng / reaction, 97.5 pg / reaction, 9.75 pg / reaction and 0.975 pg / reaction, respectively. Figure 3 As shown in Figure 2, after the original concentration of 97.5 ng / reaction of the chicken typhoid genomic DNA was diluted 10,000 times (lane 6), a clear band could still be seen, while after diluting 100,000 times (lane 7), no amplified band could be seen (see Figure 3 ). Therefore, the minimum detection limit of the rapid identification method of the present invention is 9.75 pg / reaction, which has a high detection sensitivity.
[0040] Example 4 Identification of Clinical Isolates
[0041] After 614 clinical isolates of Salmonella pullorum and Salmonella typhi preserved by the research group were cultured in broth overnight, the bacterial genomic DNA was extracted by boiling method, and analyzed according to the identification method of Example 1, positive control and negative control were set, and two biochemical experiments of ornithine and dulcitol were used for identification. The results are shown in Table 2. The method of the present invention identified 602 strains of Salmonella pullorum and 12 strains of Salmonella typhi, and the results were completely consistent with the biochemical identification results of ornithine and dulcitol, indicating that the method established by the present invention not only has the advantages of simplicity, rapidity, high throughput, etc., but also has good specificity.
[0042] Table 2. Identification results of clinical isolates
[0043]
[0044] Example 5 Assembly of a rapid identification kit for pullorum and Salmonella gallinarum
[0045] The positive control of the present invention was obtained by extracting Salmonella typhi ATCC 9184 genomic DNA using a kit; the negative control of the present invention was obtained by extracting Salmonella pullorum ATCC10398 genomic DNA using a kit; a specific detection primer was synthesized according to the sequence of primer 3 in the table of Example 1, diluted with sterile double distilled water to a concentration of 10 μM, and mixed to obtain the detection primer; PCR amplification reagent: 10×PCR buffer (its components include 100mM KCl, 80mM (NH4) SO4, 100mM Tris-HCl with a pH of 9.0, 15mM MgCl 2 and 0.5% Tergitol-type NP-40), dNTPs (including dATP, dTTP, dCTP, dGTP, each component concentration is 2.5mM), Taq DNA polymerase (2.5U / μl), detection primers, positive control (Salmonella Gallinarum ATCC 9184 genomic DNA template), negative control (Salmonella Pullorum ATCC10398 genomic DNA template), blank control (sterile double distilled water).
[0046] The above reagents and products are packaged together, and then equipped with product instructions (including product storage conditions, reaction procedures and result determination methods, etc.) to assemble the pullorum and Salmonella gallinarum rapid identification kit of the present invention.
[0047] The present invention and its embodiments are described schematically above, and the description is not restrictive. The drawings show only one embodiment of the present invention, and the actual structure is not limited thereto. Therefore, if a person skilled in the art is inspired by it and designs a structural method and an embodiment similar to the technical solution without creativity without departing from the purpose of the invention, they shall all fall within the protection scope of the present invention.
[0048] Salmonella pullorum res gene sequence:
[0049] TTAGTTTGCCTTCCCCTCAATCAAGCCATTGATCGTAGAAAATACCGCCGGCGCGCTGGT
[0050] CGCTTCCGCAAACTCGACATTGATATTTTGCCGACGCAGCATATCGAAGAATTTACGTTG
[0051] CGCATCAAGAATAACCTGATCGCCTACGCGCATATTTTCTGCTTTAGTTTCAACCAGTAAA
[0052] TAAACACTGTCGGCGTCCTGACGCTCAATACGGTACACAAAATCCGGCGTAGTAGAGCC
[0053] CCCCGTATATTTGGGGATCTGAATGGCCCGCTTAGGCAGTTTGCCAAACACAGAAACCT
[0054] GTTGCGGATAATCGTATTTTAATAGCGGCAATTCTGGATCGACGCTGTCATAACGCAACG
[0055] GCGGTATTTGATAGAGAGAACGGGGATCGTCTATCGCATTCTCATCCACATTTTTCCCCAC
[0056] AATTTCAGCGCTAATCTCCTCTCTGAACTGCCGTGCCGTGGAATCAAATACCGACGTTGA
[0057] AGCCTGAAAATCGAGAGGCAGATAATCGTGGCGCTGCGCAAAATGCGCATTAATCCGCG
[0058] TCTGTAATGCGCGGGTCATATTGTCCAACGAGATCTCGCTTAAATAGCGTGAATCTCCGT
[0059] GCAAAACATCACGCAGCATCGCCATTAACACCGGGTGCAGGACGTTAACCGGCAGACT
[0060] GGTGCGTAACGCCAGTTGCTTAAGAAAATGGCCATATTTCATGCCCACCATAAATTCGCT
[0061] GGCGGCTAATTCGCCTTCCCGCTGCGCCACTTCAAAACGGCCATTATCTTCATTCGATAC
[0062] CAGCCGTTGTTGCACCTGGCTTGGCTTCTGGCGTATATACAGCGCCGGATCGCGCAGCAC
[0063] CTCGGCGGCAATCTGTTCCAGAGACGCGCCGCTACGCTCGAATTGCAGCATATAACGGC
[0064] GGGAAAACTGCTCCCAGATACTGCTAAGTTGTTCCCAATTCTCTTTGCGTAACCTGACTC
[0065] GCAGTCGGGAGGCGGGCTTATTGTCACGAATGCGATCCGCTCGCACCCGCGCCTGCGTC
[0066] AGCTCAGGGTAGAACTCCAGTAGCCACGCAAAACCACTTTTGGTTTCCCCGTTAAGCGT
[0067] GACGCTGGGTTTAAACTCATTACTCCGGTTGATCAGTTTTTTATCATCCAGATCTTCCAGC
[0068] AAACGAAGCTCCGTAAACGCAGGATCGACTTTTTGCCGCTCGGTGACGATGAGTGTGAT
[0069] CATCGCCTCATCCAGTTTCTGCTCGTTAAGCTGAACTTTGCTGTCGCGATTAATCTCATCA
[0070] ACCAGCATACTGGCAAACGCTTTTTCATCATAACCAATCAGAAACGACAGTCGGGACGG
[0071] CCACTCTTCCTGATGAACGCGATGGCCGTTTTCATCTACCGGTAGCCGCAGGCCGCGCCC
[0072] CACTTCCTGAATTTTGCTCGACTCGCTACCGGAAGAACGTAATTTAGCAATGACAAAAA
[0073] CATTCGGGTTATCCCAGCCTTCGCGAAGCGTCCATTTTGAAAACAGAAAGCGGCGCGTT
[0074] TCCCAGTTGCCGTGATGGTCTGAAAAACTGAGCAACTTCTCTTTATTTTTCAGAATATCA
[0075] TCTACCTCAGCCTGGATCGCCTCATCGCCGCTTCCGCGGTCTTCGCCAAAGTAACCAGC
[0076] GTGGACGTTTTGGTTATCCGAGTGCAGGCTGGCGAGCGTGGCCTGCAGAAACGACAGAT
[0077] ACTCCACTTCTCGCGGCAGGGTCTTGCGCTGATAATCGTCAATCAGTTGCGTCAGTTTCT
[0078] TTTTCAGCAAACGCTCAAAAGTGACTTTCAACCAGCCTTCGTCATCACGATAGCTTTTAA
[0079] TACTGTCAATAAAGAAAAGGCTTAAGGTCTTAATACGCGGGGCATTATTTTCTGGTAGCT
[0080] CGCGCCAAAGGTTCCTGGCACCAGCGCCATCCCTGCCTCCAGCTCCAGATCGTTCGACA
[0081] ACATTTTACTGCCGGCATATTCGATACTGCCTTCAAATCCTGCATCGACATCGGCGAGATT
[0082] TTCGCCCACGCCAACCTCGGCAATTTTGCTCCCCCGTCGGAGGATTAATTTCTTTGCCGT
[0083] GACGCTGTCAACGATATAACGATTGTTGGCCTGTTCTTCGGGGAGATTCGGGTAATAAAT
[0084] ATCAATACCTTTCACCAAACCATCGTTAAAACTGTCCACCGCGTTGAGATCAAACTGCG
[0085] GTTGCCGGCGATAGTAATCTTTACGTACACATTTATTTTTACCCTTACCTTCGACAATATCC
[0086] GGGAAGGTAGCGCCAAAGCGGACGATCATTTGCGGCTGAATGGCCTGAATCGCTCGATA
[0087] AAATTTGTTATCTCGCGCAAAACGATGCGGTTCATCAATAATGACCACCGGTCGCGTCAT
[0088] TTGCAGCCCTTTAACAGGCGACGTCAGCCCGCCCAGTAGCGTTTGATCGTAATCGTCTCG
[0089] CGTCATACTGGCGGAATTGAGCATTTGCGCATTGATCAGCAAAACCTGAATCGTATGGCT
[0090] ATCACGACGGCTGGCATCAGTAAAACTTAATAACTGGGCCGGAAAATTTTTACGCCCCG
[0091] ACTTTACTTTAAAATCACCGGCGTTGATGGTGCAAAGTTCCATCCGCGTATTTTCGTAGA
[0092] ACTGTGAAAAATGCTGTCTGGCGTAATCGCTGGTGATAAAGTTCCGCGCGCCTTCTTTAA
[0093] TGGCTGGCGTCGGCACCACCAGCACAAATTTGAAGAGGCCATACTTCTGATGCAGTTCA
[0094] TACATCAACCGGGTATAGACATAGGTTTTGCCCGTCCCGGTCTCCATTTTAACGTCAATAT
[0095] TGGCCTTATCGTCGTAACGTTCCTTAATCAGCGGATTAGCATAGTGATTATGATCGGCCTG
[0096] CGCGTGATCGATACCGGTGAAACTCGCCAGAATCGCCGCTAACGCCTGTTCCTGATGGG
[0097] GAAGTTCTTCCAGTAAAATATTCAT
[0098] Salmonella gallinarum res gene sequence:
[0099] TTAGTTTGCCTTCCCCTCAATCAAGCCATTGATCGTAGAAAATACCGCCGGCGCGCTGGT
[0100] CGCTTCCGCAAACTCGACATTGATATTTTGCCGACGCAGCATATCGAAGAATTTACGTTG
[0101] CGCATCAAGAATAACCTGATCGCCTACGCGCATATTTTCTGCTTTAGTTTCAACCAGTAAA
[0102] TAAACACTGTCGGCGTCCTGACGCTCAATACGGTACACAAAATCCGGCGTAGTAGAGCC
[0103] CCCCGTATATTTGGGGATCTGAATGGCCCGCTTAGGCAGTTTGCCAAACACAGAAACCT
[0104] GTTGCGGATAATCGTATTTTAATAGCGGCAATTCTGGATCGACGCTGTCATAACGCAACG
[0105] GCGGTATTTGATAGAGGGAACGGGGATCGTCTATCGCATTCTCATCCACATTTTTCCCCAC
[0106] AATTTCAGCGCTAATCTCCTCTCTGAACTGCCGTGCCGTGGAATCAAATACCGACGTTGA
[0107] AGCCTGAAAATCGAGAGGCAGATAATCGTGGCACTGCGCAAAATGCGCATTAATCCGCG
[0108] TCTGTAATGCGCGGGTCATATTGTCCAACGAGATCTCGCTTAAATAGCGTGAATCTCCGT
[0109] GCAAAACATCACGCAGCATCGCCATTAACACCGGGTGCAGGACGTTAACCGGCAGACT
[0110] GGTGCGTAACGCCAGTTGCTTAAGAAAATGGCCATATTTCATGCCCACCATAAATTCGCT
[0111] GGCGGCTAATTCGCCTTCCCGCTGCGCCACTTCAAAACGGCCATTATCTTCATTCGATAC
[0112] CAGCCGTTGTTGCACCTGGCTTGGCTTCTGGCGTATATACAGCGCCGGATCGCGCAGCAC
[0113] CTCGGCGGCAATCTGTTCCAGAGACGCGCCGCTACGCTCGAATTGCAGCATATAACGGC
[0114] GGGAAAACTGCTCCCAGATACTGCTAAGTTGTTCCCAATTCTCTTTGCGTAACCTGACTC
[0115] GCAGTCGGGAGGCGGGCTTATTGTCACGAATGCGATCCGCTCGCACCCGCGCCTGCGTC
[0116] AGCTCAGGGTAGAACTCCAGTAGCCACGCAAAACCACTTTTGGTTTCCCCGTTAAGCGT
[0117] GACGCTGGGTTTAAACTCATTACTCCGGTTGATCAGTTTTTTATCATCCAGATCTTCCAGC
[0118] AAACGAAGCTCCGTAAACGCAGGATCGACTTTTTGCCGCTCGGTGACGATGAGTGTGAT
[0119] CATCGCCTCATCCAGTTTCTGCTCGTTAAGCTGAACTTTGCTGTCGCGATTAATCTCATCA
[0120] ACCAGCATACTGGCAAACGCTTTTTCATCATAACCAATCAGAAACGACAGTCGGGACGG
[0121] CCACTCTTCCTGATGAACGCGATGGCCGTTTTCATCTACCGGTAGCCGCAGGCCGCGCCC
[0122] CACTTCCTGAATTTTGCTCGACTCGCTACCGGAAGAACGTAATTTAGCAATGACAAAAA
[0123] CATTCGGGTTATCCCAGCCTTCGCGAAGCGTCCATTTTGAAAACAGAAAGCGGCGCGTT
[0124] TCCCAGTTGCCGTGATGGTCTGAAAAACTGAGCAACTTCTCTTTATTTTTCAGAATATCA
[0125] TCTACCTCAGCCTGGATCGCCTCATCGCCGCTTCCGCGGTCTTCGCCAAAGTAACCAGC
[0126] GTGGACGTTTTGGTTATCCGAGTGCAGGCTGGCGAGCGTGGCCTGCAGAAACGACAGAT
[0127] ACTCCACTTCTCGCGGCAGGGTCTTGCGCTGATAATCGTCAATCAGTTGCGTCAGTTTCT
[0128] TTTTCAGCAAACGCTCAAAAGTGACTTTCAACCAGCCTTCGTCATCACGATAGCTTTTAA
[0129] TACTGTCAATAAAGAAAAGGCTTAAGGTCTTAATACGCGGGGCATTATTTTCTGGCTCAT
[0130] TGCTGCGTAAGAAATTTGCCTGCTCAGTGTCAAAATGCTTATCGATAGCGTCCTGAATAA
[0131] TCAGTTCCTGGTAGCTCGCGCCAAAGGTTCCTGGCACCAGCGCCATCCCTGCCTCCAGC
[0132] TCCAGATCGTTCGACAACATTTTACTGCCGGCATATTCGATACTGCCTTCAAATCCTGCAT
[0133] CGACATCGGCGAGATTTTCGCCCACGCCAACCTCGGCAATTTTGCTCCCCCGTCGGAGG
[0134] ATTAATTTCTTTGCCGTGACGCTGTCAACGATATAACGATTGTTGGCCTGTTCTTCGGGGA
[0135] GATTCGGGTAATAAATATCAATACCTTTCACCAAACCATCGTTAAAACTGTCCACCGCGT
[0136] TGAGATCAAACTGCGGTTGCCGGCGATAGTAATCTTTACGTACACATTTATTTTTACCCTT
[0137] ACCTTCGACAATATCCGGGAAGGTAGCGCCAAAGCGGACGATCATTTGCGGCTGAATGG
[0138] CCTGAATCGCTCGATAAAATTTGTTATCTCGCGCAAAACGATGCGGTTCATCAATAATGA
[0139] CCACCGGTCGCGTCATTTGCAGCCCTTTAACAGGCGACGTCAGCCCGCCCAGTAGCGTT
[0140] TGATCGTAATCGTCTCGCGTCATACTGGCGGAATTGAGCATTTGCGCATTGATCAGCAAA
[0141] ACCTGAATCGTATGGCTATCACGACGGCTGGCATCAGTAAAACTTAATAACTGGGCCGG
[0142] AGAATTTTTACGCCCCGACTTTACTTTAAAATCACCGGCGTTGATGGTGCAAAGTTCCAT
[0143] CCGCGTATTTTCGTAGAACTGTGAAAAATGCTGTCTGGCGTAATCGCTGGTGATAAAGTT
[0144] CCGCGCGCCTTCTTTAATGGCTGGCGTCGGCACCACCAGCACAAATTTGAAGAGGCCAT
[0145] ACTTCTGATGCAGTTCATACATCAACCGGGTATAGACATAGGTTTTGCCCGTCCCGGTCT
[0146] CCATTTTAACGTCAATATTGGCCTTATCGTCGTAACGTTCCTTAATCAGCGGATTAGCATA
[0147] GTGATTATGATCGGCCTGCGCGTGATCGATACCGGTGAAACTCGCCAGAATCGCCGCTAA
[0148] CGCCTGTTCCTGATGGGGAAGTTCCTCCAGTAAAATATTCATCAT
Claims
1. A rapid identification kit for Salmonella pullorum and Salmonella gallinarum, characterized in that: It includes PCR detection primers, positive control, negative control and blank control, and the PCR detection primers include: For: 5'-ATCTCATCAACCAGCATACT-3' Rev: 5'-TTCTTACGCAGCAATGAG-3'.
2. The rapid identification kit for pullorum and Salmonella gallinarum according to claim 1, characterized in that: The positive control was the genomic DNA of Salmonella Gallinarum ATCC9184, the negative control was the genomic DNA of Salmonella Pullorum ATCC10398, and the blank control was sterilized double distilled water.
3. The rapid identification kit for pullorum and Salmonella gallinarum according to claim 1, characterized in that: The components of the PCR detection system are as follows: each 25 μl reaction solution includes 2.5 μl of 10×PCR buffer, 0.25 μl of Taq DNA polymerase, 2 μl of dNTPs, 1 μl of detection primer set, 1 μl of DNA template and an appropriate amount of sterile double-distilled water.
4. The rapid identification kit for pullorum and Salmonella gallinarum according to claim 1, characterized in that: The concentration of the PCR detection primer is 10 μM.
5. The rapid identification kit for pullorum and Salmonella gallinarum according to claim 3, characterized in that: The dNTPs include dATP, dTTP, dCTP, and dGTP, and the concentration of each component is 2.5 mM.
6. The rapid identification kit for Salmonella pullorum and Salmonella gallinarum according to any one of claims 1 to 5, characterized in that: The kit does not include other primers.
7. A method for non-diagnostic detection using a rapid identification kit for Salmonella pullorum and Salmonella gallinarum, comprising the following steps: S1: Use a commercial kit or boiling method to extract bacterial genomic DNA to obtain a detection template; S2: PCR amplification: Add PCR buffer, Taq DNA polymerase, dNTPs, PCR detection primer set and DNA template into a sterile PCR reaction tube, add sterile double distilled water, set up positive, negative and blank controls, and use a PCR instrument to perform amplification reaction; Agarose gel electrophoresis was used to detect the amplified products and analyze the results; The primers of the PCR detection primer set include: For: 5'-ATCTCATCAACCAGCATACT-3' Rev: 5'-TTCTTACGCAGCAATGAG-3'.
Citation Information
Patent Citations
Primer group, kit and method for identifying salmonella pullorum and salmonella gallinarum
CN105087806A
Molecular identification kit for salmonella pullorum and salmonella gallinarum and non-diagnostic detection method thereof
CN116622871A