A method for creating pseudo-male Trachinotus ovatus

Abstract

The present invention belongs to the field of modern agricultural technologies, and particularly relates to a method for creating pseudo-male Trachinotus ovatus. The method for creating pseudo-male Trachinotus ovatus is to use α-naphthoflavone and 17α-methyltestosterone in combination, starting feeding induction from the 2-month-old stage, and finally sperm can be observed in the gonads of genetically female Trachinotus ovatus at the 8-month-old stage. This method can reverse the gonads of genetically female Trachinotus ovatus (whose gonads normally develop into ovaries) into testes. At the 8-month-old stage, the observed reversal efficiency is 63.6%. Compared with the single use of α-naphthoflavone, the sex reversal ratio is increased by more than 1 time, and the sperm quantity and maturity in the testes of pseudo-male fish are significantly improved, greatly enhancing the success rate of subsequent creation of all-female Trachinotus ovatus.

Description

Technical Field

[0001] The present invention belongs to the field of modern agricultural technologies, and particularly relates to a method for creating pseudo-male Trachinotus ovatus Background Art

[0002] Sex control breeding technology is a key research and application field in the genetic breeding of aquaculture animals. In nature and under farming conditions, there are significant differences between the two sexes in many aquatic animals, mainly reflected in growth and body size differences, sexual maturity time differences, body color and pattern differences, etc. Therefore, fish sex control breeding has important theoretical significance and application value. Fish sex includes two aspects. One is the genetic basis that determines the sex of an animal, which is called genetic sex; the other is the sex manifested by its physiological constitution, which is called physiological sex. Physiological sex is the external manifestation of fish sex and is the result of the interaction between genetic sex and the environment. In addition, due to the strong plasticity of fish sex, the physiological sex of fish can be affected by changing environmental factors.

[0003] Trachinotus ovatus Trachinotus ovatus ), the aquaculture production has increased significantly in the past decade. The total national output in 2023 has reached 2.92 million tons, making it the most produced fish in marine aquaculture. The market share of Trachinotus ovatus eggs and fry in Hainan exceeds 70% in the national market. Therefore, Hainan is the most important Trachinotus ovatus seed industry center in China. Trachinotus ovatus has significant growth differences between males and females. The growth rate of 1-year-old females is more than 20% faster than that of males. Therefore, cultivating a single-sex farming population can not only shorten the farming cycle, but also reduce the screening link during the farming process, greatly reducing the farming management cost and significantly improving the production efficiency. To obtain an all-female Trachinotus ovatus farming population, inducing genetic female individuals to reverse into physiological male individuals is a key link.

[0004] Artificial control methods for fish sex include interspecific hybridization, artificial induction of gynogenesis (androgenesis), environmental regulation, gene manipulation, hormone induction, etc. The advantages and disadvantages of each method are as follows:

[0005] (1) Interspecific hybridization technology: Hybridize fish of different species and use the sex determination mechanism or sex ratio characteristics of different species to control the sex of offspring. Utilize natural biological processes without external chemical or physical intervention, and may produce hybrid offspring with specific excellent traits. However, the success rate is low, and it is limited by genetic relationships and reproductive barriers. The sex ratio and reproductive ability of offspring may be unstable, affecting the farming effect;

[0006] (2)Artificial induction of gynogenesis (androgenesis): Using physical or chemical means to induce the haploid development of eggs or sperm into individuals (such as gynogenesis to produce all-female offspring), it can achieve the production of all-female or all-male populations, with significant effects, and can accelerate the breeding process to quickly obtain offspring with specific traits. However, it requires strict experimental conditions and operation techniques, high costs, and the haploid development leads to a decrease in genetic diversity, lower survival rates and health conditions of individuals, affecting population adaptability;

[0007] (3)Environmental regulation: By changing environmental conditions (such as temperature, pH value, light, etc.) to affect fish sex differentiation. This method has no chemical drug residues, is environmentally friendly, and utilizes natural environmental factors without exogenous intervention. However, the impact on sex differentiation is relatively complex, the effects are unstable, and it needs to be optimized for specific fish species, with poor universality;

[0008] (4)Gene manipulation techniques: Using gene editing techniques (such as CRISPR / Cas9) to directly modify sex-determining genes or regulatory genes to change the sex differentiation process. It has not been achieved in marine fish yet, and there are ethical controversies and regulatory restrictions in its application in food production, and consumers' acceptance of genetically engineered foods is relatively low.

[0009] (5)Hormone induction method: At specific stages of fish development, changing the direction of sex differentiation by adding hormones to the feed or injecting hormones (such as methyltestosterone or estrogen). This technique is relatively simple, suitable for large-scale operations, and the hormone cost is relatively low, suitable for commercial applications in aquaculture. However, the hormone induction method requires accurate selection of appropriate hormones, as well as precise control of hormone dosage and treatment time, otherwise the effects are unstable.

[0010] Currently, there are no reports on the creation of pseudo-male Trachinotus ovatus and its sex control technology and application, and there is no method for sex reversal of Trachinotus ovatus in this field. Summary of the Invention

[0011] At present, it is not certain whether Trachinotus ovatus has an XY or ZW sex determination system. In order to obtain all-female Trachinotus ovatus (genetic females) with better growth traits, it is necessary to breed physiological male Trachinotus ovatus (genetic females) with physiological female Trachinotus ovatus (genetic females) to obtain all genetic female Trachinotus ovatus. Therefore, creating pseudo-male Trachinotus ovatus has become the key in this field.

[0012] The purpose of the first aspect of the present invention is to provide a method for creating pseudo-male Trachinotus ovatus.

[0013] The purpose of the second aspect of the present invention is to provide a feed for creating pseudo-male Trachinotus ovatus.

[0014] The purpose of the third aspect of the present invention is to provide a preparation method for a feed for creating pseudo-male Trachinotus ovatus.

[0015] The objective of the fourth aspect of the present invention is to provide the application of the feed of the second aspect of the present invention in improving the breeding efficiency of Trachinotus ovatus.

[0016] The objective of the fifth aspect of the present invention is to provide a method for raising Trachinotus ovatus.

[0017] The objective of the sixth aspect of the present invention is to provide a method for identifying the sex determination type of Trachinotus ovatus.

[0018] To achieve the above objectives of the present invention, the technical solutions adopted by the present invention are as follows:

[0019] The first aspect of the present invention provides a method for creating pseudo-male Trachinotus ovatus, including the following steps:

[0020] Using α-naphthoflavone and 17α-methyltestosterone to induce female Trachinotus ovatus.

[0021] In some embodiments of the present invention, the induction means: adding α-naphthoflavone and 17α-methyltestosterone to the feed and then feeding the female Trachinotus ovatus; the physiological sex of the female Trachinotus ovatus is reversed to male.

[0022] Among them, the female Trachinotus ovatus refers to Trachinotus ovatus with a genetic sex of female; the genetic sex refers to the sex directly indicated by sex chromosomes; the physiological sex refers to the sex showing specific bisexual physiological structures under the comprehensive influence of multiple conditions such as genetics, environment (such as temperature), behavior, and physiological factors.

[0023] The Trachinotus ovatus with a physiological sex of male is specifically embodied as: Trachinotus ovatus having testes and capable of producing mature sperm.

[0024] In the present invention, the Trachinotus ovatus with a genetic sex of female and a physiological sex changed to male after induction is called pseudo-male fish.

[0025] In some embodiments of the present invention, the content of α-naphthoflavone in the feed is 180 - 220 mg / kg.

[0026] In some embodiments of the present invention, the content of 17α-methyltestosterone in the feed is 80 - 120 mg / kg.

[0027] In some embodiments of the present invention, the feeding starts when the female Trachinotus ovatus is 55 - 65 days old; preferably, it is 58 - 62 days old.

[0028] In some embodiments of the present invention, the feeding time is 160 - 200 days; preferably, it is 170 - 190 days.

[0029] In some embodiments of the present invention, the feeding method is satiated feeding; the satiated feeding is carried out 1 to 3 times a day; preferably, 2 times.

[0030] In some embodiments of the present invention, the feed changes according to the growth stage of the golden pompano, specifically:

[0031] When the golden pompano is 2 to 6 months old, extruded feed with a diameter specification of 1.0 to 2.0 mm is selected;

[0032] When the golden pompano is 6 to 8 months old, extruded feed with a diameter specification of 5.0 to 10.0 mm is selected.

[0033] The second aspect of the present invention provides a feed for creating pseudo-male golden pompano, comprising α-naphthoflavone, 17α-methyltestosterone, and a golden pompano basal feed.

[0034] In some embodiments of the present invention, the content of α-naphthoflavone in the feed is 180 to 220 mg / kg.

[0035] In some embodiments of the present invention, the content of 17α-methyltestosterone in the feed is 80 to 120 mg / kg.

[0036] In some embodiments of the present invention, the golden pompano basal feed uses a commercial feed, with the product standard number: Q / ZJHD 01-2023 and the production license number: Yue Si Zheng (2023) 15082; crude protein ≥ 41%, crude fat ≥ 5%, lysine ≥ 2.1%, crude ash ≤ 18%, crude fiber ≤ 3.5%, moisture ≤ 10%.

[0037] In some embodiments of the present invention, the golden pompano basal feed uses a commercial golden pompano feed.

[0038] The third aspect of the present invention provides a preparation method of the feed for creating pseudo-male golden pompano according to the second aspect of the present invention, comprising the following steps:

[0039] Dissolve α-naphthoflavone and 17α-methyltestosterone, spray them on the golden pompano basal feed, mix, and dry in the air.

[0040] In some embodiments of the present invention, to avoid the degradation of α-naphthoflavone and 17α-methyltestosterone affecting the effect, the feed is dried in a cool, light-proof, and well-ventilated place, and the dried feed is stored in a 4°C refrigerator.

[0041] The fourth aspect of the present invention provides the application of the feed for inducing sex reversal of golden pompano according to the second aspect of the present invention in improving the breeding efficiency of golden pompano.

[0042] The feed can induce female golden pompano into male golden pompano with physiological male sex. The male golden pompano with physiological male sex has a faster growth rate, which can shorten the breeding cycle, reduce the screening process during breeding, greatly reduce the breeding management cost, significantly improve the production efficiency, and thus improve the breeding benefit of golden pompano.

[0043] The fifth aspect of the present invention provides a method for raising golden pompano, including the following steps:

[0044] When the golden pompano is 55 - 65 days old, start feeding it with the feed described in the second aspect of the present invention until it is full, and continue for 160 - 200 days.

[0045] In some embodiments of the present invention, the feeding starts when the female golden pompano is 58 - 62 days old.

[0046] In some embodiments of the present invention, the feeding time is 170 - 190 days.

[0047] The sixth aspect of the present invention provides a method for identifying the sex determination type of golden pompano, including the step of creating pseudo - male golden pompano.

[0048] If the golden pompano has an XX - XY sex determination system, cross the XX pseudo - male fish with normal XX female fish to obtain all XX female fish;

[0049] If the golden pompano has a ZZ - ZW sex determination system, first create ZW - type pseudo - male fish, and then mate the ZW pseudo - male with normal ZW female fish. At this time, three different genotypes of ZZ, ZW, and WW will appear, and the ratio is ZZ:ZW:WW = 1:2:1, thus differentiating from the XX - XY system for identification and judgment. Further screen to obtain WW super - female fish, and finally cross the WW super - female fish with normal ZZ male fish to obtain all Zw female offspring.

[0050] The beneficial effects of the present invention are:

[0051] The present invention provides a method for inducing sex reversal of golden pompano, which uses a combination of α - naphthoflavone and 17α - methyltestosterone to induce golden pompano. This method has the following outstanding advantages:

[0052] 1. More efficient

[0053] This method uses a mixture of α - naphthoflavone and 17α - methyltestosterone as the inducing hormone. Compared with other hormones or the use of α - naphthoflavone alone, it can more effectively inhibit the synthesis of estrogen, thus promoting the gonadal masculinization process. Under suitable conditions, the induction success rate can reach more than 60%.

[0054] 2. Safer

[0055] Hormones at too high or too low doses can affect the effect of sex transformation and the health of fish bodies. In this method, the feed is fed with α-naphthoflavone at a concentration of 200 mg / kg and 17α-methyltestosterone at 100 mg / kg. No significant effect on the survival rate of Trachinotus ovatus at 8 months of age was found, and the health status of Trachinotus ovatus was not inhibited. Moreover, only the first generation needs to be treated with hormones. Subsequently, the pseudo-male fish can be used to reproduce offspring, and no hormone treatment is required anymore. The hormone levels of the offspring are normal, there is no safety risk, and the pollution to the water body is less.

[0056] 3. Promote spermatogenesis

[0057] In other fish, sex reversal can be achieved by using other hormones such as 17α-methyltestosterone, etc., but it often leads to testicular atrophy and inhibits spermatogenesis. In the present invention, by mixing α-naphthoflavone and 17α-methyltestosterone, selecting appropriate doses, and precisely controlling the treatment time, not only can the sex reversal of Trachinotus ovatus be achieved, but also more sperm can be successfully observed in the gonads of genetically female Trachinotus ovatus compared with the use of α-naphthoflavone alone.

[0058] The present invention forms a systematic scheme for creating pseudo-male Trachinotus ovatus by selecting the mixture of α-naphthoflavone and 17α-methyltestosterone as the inducer, determining the optimized dose, precisely controlling the treatment time, and verifying the effect by observing sperm in the gonads. These key technical points, compared with the existing technology, not only improve the efficiency and stability of sex transformation, ensure the growth and health status of fish bodies, but also enable normal spermatogenesis. It lays a foundation for the subsequent identification of the chromosomal sex determination system of Trachinotus ovatus and the creation of all-female Trachinotus ovatus varieties, and has important scientific significance and significant application value. Description of the Drawings

[0059] The following further describes the present invention in conjunction with the drawings and embodiments, where:

[0060] Figure 1 It is the agarose gel electrophoresis map of the PCR products for the genetic sex identification of Trachinotus ovatus in Example 3 of the present invention. The first lane is the Marker, and the second to fourth lanes are the samples.

[0061] Figure 2 It is the genetic marker sequencing map of Trachinotus ovatus in Example 3 of the present invention. Among them, A is the genetic male marker sequencing map of Trachinotus ovatus, and B is the genetic female marker sequencing map of Trachinotus ovatus.

[0062] Figure 3This is the gonad section and H&E staining diagram of golden pompano in Example 3 of the present invention. Among them, A is the control group (genetic male - physiological male); B is the control group (genetic female - physiological female); C is the α-naphthoflavone group (genetic female - physiological female); D is the α-naphthoflavone group (genetic female - physiological male); E is the α-naphthoflavone and 17α-methyltestosterone group (genetic female - physiological female); F is the α-naphthoflavone and 17α-methyltestosterone mixed group (genetic female - physiological male).

[0063] Figure 4 This is the survival rate result of golden pompano in Example 3 of the present invention. Detailed implementation manners

[0064] The following will clearly and completely describe the concept and technical effects generated by the present invention in combination with the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present invention.

[0065] Example 1 Feed preparation

[0066] The basal feed is golden pompano extruded feed with a diameter specification of 1.0 - 2.0 mm and golden pompano extruded feed with a diameter specification of 5 - 10 mm. The feed is produced by Zhanjiang Haida Feed Co., Ltd., golden pompano extruded compound feed 6305.

[0067] Weigh 1 g of α-naphthoflavone powder (CAS: 604-59-1) and add it to 10 mL of dichloromethane, then make up the volume to 250 mL with absolute ethanol and mix evenly to completely dissolve the α-naphthoflavone powder; weigh 0.5 g of 17α-methyltestosterone (CAS: 58-18-4) and add it to 20 mL of DMSO, then make up the volume to 250 mL with absolute ethanol and mix evenly to completely dissolve the 17α-methyltestosterone powder.

[0068] Spray these solutions evenly respectively or spray them evenly together after mixing on 5 kg of the above-mentioned golden pompano extruded basal feed. Finally, place the feed in a cool, dark and ventilated place to dry. After drying, place the feed in a 4°C refrigerator to avoid the degradation of α-naphthoflavone and 17α-methyltestosterone and affect the effect.

[0069] Example 2 Golden pompano induction

[0070] In this example, the new strain of Trachinotus ovatus "Lanliang No. 1" independently cultivated by Hainan Lanliang Technology Co., Ltd. and Hainan University was selected as the experimental object. 900 Trachinotus ovatus with an age of about 2 months and similar sizes were selected and divided into 3 groups, which were cultured in a net cage of 4m * 4m * 1.5m. The net cage was placed in a seawater pond for standardized farming. The water in the pond was changed every 10 - 15 days, and the amount of water changed each time was 30% - 40% of the total volume.

[0071] The three groups of Trachinotus ovatus were fed different feeds. Among them, the first group was fed with normal feed, the second group was fed with feed containing only α-naphthoflavone, and the third group was fed with feed containing α-naphthoflavone and 17α-methyltestosterone. When feeding, full feeding was adopted, and feeding was carried out twice at 8:00 am and 15:00 pm every day.

[0072] Among them, when the age was 2 - 5 months, the extruded feed prepared in Example 1 with a diameter specification of 1.0 - 2.0 mm was used, and when the age was 6 - 8 months, the extruded feed prepared in Example 1 with a diameter specification of 5 - 10 mm was used.

[0073] Example 3 Gonadal Development Detection

[0074] When the experimental Trachinotus ovatus in the above example was raised to 8 months old, 18 - 21 Trachinotus ovatus with a size of 150 - 250 grams were randomly selected from each of the three groups. The caudal fin rays were cut and placed in absolute ethanol, and the gonadal tissues were taken and fixed in paraformaldehyde.

[0075] 1. Genetic sex identification: After extracting the genome from the caudal fin of Trachinotus ovatus, the genetic sex of each fish was identified using sex-related DNA markers. The specific method is as follows.

[0076] 1.1 Extraction of genomic DNA from the caudal fin of Trachinotus ovatus:

[0077] 1) Add 1 cm 2 fin ray to 300 μL of Hom buffer (cell lysis solution, proteinase K);

[0078] Digest in a 65°C constant temperature metal bath for more than 3 h, shake once every 15 min until the fin ray is completely dissolved; 3) Add 300 μL of 4.5 M Nacl solution and 180 μL of 24:1 nucleic acid extraction reagent (29.78 g of Na2EDTA·2H2O, 12.11 g of Tris-base, 5 g of SDS, and 20 mg of proteinase K, dissolved in 1 liter of ultrapure water), and vortex thoroughly to mix evenly;

[0079] 4) Centrifuge at 10000 rpm for 5 min, take 700 μL of the supernatant, add an equal volume of isopropanol and mix well, and place it at -20°C for precipitation for more than 2 h;

[0080] Centrifuge at 13000rpm for 10min, discard the supernatant and add 1mL 70% alcohol to rinse. 6) Centrifuge at 13000rpm for 5min, discard the supernatant, dry at room temperature, add 80μL ddH2O, mix thoroughly, test the DNA concentration, and place in a 4℃ refrigerator for use as the golden pomfret genome.

[0081] 1.2 Sex identification method: Identification using chain polymerase reaction (PCR) experiment:

[0082] The PCR system is shown in Table 1.

[0083] Table 1 PCR system

[0084]

[0085] Forword primer: CATGGACAAGAAGGTGGTGC (SEQ ID NO: 1);

[0086] Reverse primer: TACCCAGTGCAAGCTCTCTC (SEQ ID NO: 2).

[0087] The PCR program is shown in Table 2.

[0088] Table 2 PCR program

[0089]

[0090] After the PCR program is completed, the PCR product is added to 6× loading buffer for agarose gel electrophoresis detection. The band size is about 165 bp. Figure 1 shown.

[0091] The PCR products were sequenced by Sanger sequencing. The sequencing results were opened with chromas software. Genetic males were A / A and genetic females were A / G, respectively. Figure 2 Middle A and Figure 2 As shown in B.

[0092] The nucleotide sequence of the product is: CATGGACAAGAAGGTGGTGCTGATCACAGGCTGCTCCTCGGGAATCGGTCTCAGCCTGGCTGTCCGGTTAGCATCTGACCCCGACAAAACATTCAAAGATAACAGCCCACATCTACACACAATGATGGACCTTTGTTGTATTTCCGAGAGAGCTTGCACTGGGTA (SEQ ID NO: 3).

[0093] Among them, the 99th position is the sex detection locus of Trachinotus ovatus. The genetic male is A / A, and the genetic female is A / G.

[0094] This locus has been proven and published in the literature at https: / / doi.org / 10.1016 / j.aquaculture.2021.737044. 2. Physiological sex identification: Paraffin section and H&E staining methods are used for identification.

[0095] 2.1 Tissue wax block preparation

[0096] 1) Tissue fixation: The obtained gonad tissue is fixed in 4% paraformaldehyde at room temperature for more than 24 h.

[0097] 2) Tissue rinsing: The tissue is placed in a sample frame and slowly rinsed with running water for 5 min to remove the residual fixative on the tissue.

[0098] 3) Tissue gradient dehydration: Soak in 60% alcohol for 4 h, 70% alcohol for 12 h, 80% alcohol for 2 h, 90% alcohol for 2 h, 95% Ⅰ alcohol for 1.5 h, 95% Ⅱ alcohol for 1 h, 100% absolute ethanol Ⅰ for 30 min, 100% absolute ethanol Ⅱ for 30 min, benzyl alcohol solution (volume ratio 1:1) for 10 min, xylene Ⅰ for 7 min, and xylene Ⅱ for 7 min.

[0099] 4) Tissue wax infiltration and embedding: Soak in paraffin Ⅰ for 1 h; soak in paraffin Ⅱ for 1 h, and soak in paraffin Ⅲ for 1 h.

[0100] Finally, use forceps to embed the tissue in the mold, place it at room temperature, and take it out after complete solidification for standby. 2.2 Tissue sectioning

[0101] 1) Adjust the water temperature of the spreading machine to 40 ºC for standby.

[0102] 2) Carefully trim the wax block with a scalpel for standby.

[0103] 3) Fix the wax block on the paraffin slicer, first slowly trim it with the slicer (20 μm), and then perform formal sectioning after cutting to the tissue, with a thickness of 5 μm.

[0104] 4) Place the tissue section in the water tank of the spreading machine to flatten it, pick it up with a glass slide, and observe the tissue morphology under a microscope to select tissue samples with complete morphology.

[0105] 5) Place the glass slide with the tissue section in an oven at 65 ºC for 2 h and store it at room temperature for standby.

[0106] 2.3 Hematoxylin&eosin staining (H&E staining)

[0107] 1) Place the gonad tissue sections in an oven at 65 ºC for 10 min, then perform tissue dewaxing. Place the sections in xylene I, xylene II, and xylene III for 15 min each in sequence.

[0108] 2) To remove xylene, place the slides in absolute ethanol I, absolute ethanol II, and 75% ethanol for 5 min each in sequence.

[0109] 3) Slowly rinse with distilled water for 5 min to remove the residual ethanol on the slides; place them in a dyeing cylinder containing hematoxylin for 3 min to stain the cell nuclei.

[0110] 4) Slowly rinse with tap water for 5 - 10 min to remove the residual hematoxylin on the slides.

[0111] 5) Immerse in the differentiation solution (1% hydrochloric acid, volume ratio of tap water to concentrated hydrochloric acid is 1:99) for 5 s.

[0112] 6) After rinsing with tap water for 5 min, place them in the blueing solution (1% ammonia water, volume ratio of tap water to concentrated ammonia water is 1:99) for 5 s.

[0113] 7) After slowly rinsing with tap water for 5 min, place in 90% absolute ethanol for 5 min and eosin staining solution for 2 min.

[0114] 8) Absolute ethanol I, absolute ethanol II, and n-butanol for 5 min each.

[0115] 9) Place in xylene for 5 min, seal the slides with neutral gum, and after placing in a fume hood for 24 h, observe and take pictures under a microscope.

[0116] 3. Experimental results

[0117] The gonad sections and H&E staining results of the control group and the experimental group are as Figure 3 shown.

[0118] Among them, a total of 18 were detected in the NF treatment group. The genetic sex was detected by sex markers and divided into 2 types, including 9 genetic males and 9 genetic females. Then, through paraffin section and HE staining, their physiological sex was detected; among the 9 genetic males, all their physiological sexes were also male; among the 9 genetic females, 6 of them remained female (as shown in Figure 3 C); only 3 of them underwent sex reversal to male (as shown in Figure 3 D).

[0119] A total of 21 individuals were detected in the group treated with a mixture of α-naphthoflavone and 17α-methyltestosterone. Among them, genetic sex was detected by sex markers and divided into two types, with 10 genetically male and 11 genetically female. Then, paraffin sections and HE staining were used to detect their physiological sex; among the 11 genetically female individuals, only 4 remained physiological females (as shown in E in Figure 3 ), but 7 were physiological males (as shown in F in Figure 3 ).

[0120] It can be seen that the sex reversal efficiency of α-naphthoflavone alone was 33.33%, while the sex reversal efficiency of the group treated with a mixture of α-naphthoflavone and 17α-methyltestosterone reached 63.6%. Compared with the single use of α-naphthoflavone, the sex reversal ratio increased by more than one time, and the sperm quantity and maturity of pseudo-male fish testes were significantly improved.

[0121] Furthermore, the survival rate results of the three groups of Trachinotus ovatus are as shown in Figure 4 . There was no significant difference in the survival rate between the α-naphthoflavone group and the mixed group and the normal control group, indicating that this hormone treatment had no obvious effect on the growth status of Trachinotus ovatus and had high safety.

Claims

1. A method for creating a pseudo-male fish of golden pomfret, comprising the following steps: Female golden pomfret were induced using α-naphthoflavone and 17α-methyltestosterone; The induction is to add α-naphthoflavone and 17α-methyltestosterone to feed the female golden pomfret; The content of α-naphthoflavone in the feed is 180-220 mg / kg; The content of 17α-methyltestosterone in the feed is 80-120 mg / kg; The feeding begins when the female golden pomfret is 55 to 65 days old; The feeding period is 160 to 200 days; The feeding method is feeding after satiation.

2. A feed for producing golden pomfret pseudomale fish, characterized in that: The feed includes α-naphthoflavone and 17α-methyltestosterone; The content of α-naphthoflavone in the feed is 180-220 mg / kg; The content of the 17α-methyltestosterone in the feed is 80-120 mg / kg.

3. The method for preparing the feed according to claim 2, comprising the following steps: Dissolve α-naphthoflavone and 17α-methyltestosterone, spray them into the base feed of golden pomfret, mix them and dry them.

4. Use of the feed according to claim 2 in improving the breeding efficiency of golden pomfret.

5. A method for raising golden pomfret, comprising the following steps: The golden pomfret is fed with the feed according to claim 2 at 55 to 65 days of age and the feeding is continued for 160 to 200 days.

Images