A peptide vaccine based on a tetrahedral framework nucleic acid and its application
By encapsulating peptides within a tetrahedral framework of nucleic acids and externally loading CpG ODNs, the constructed peptide vaccine TDN-peptide-CpG (TPVax) solves the stability and immunogenicity problems of existing peptide vaccines, achieving highly efficient protection and a strong immune response, especially making significant progress in Th-1 biased cellular and humoral immune responses.
Patent Information
- Application Number
- CN202411318214.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-20
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-09-20
AI Technical Summary
Existing peptide vaccines face problems such as poor stability, weak immunogenicity, and low delivery efficiency. Traditional delivery systems such as liposomes and viral vectors have challenges such as high production costs, safety risks, and unclear immune responses. Tetrahedral framework nucleic acids (TDNs) as carriers have failed to effectively protect the active peptide components, thus affecting vaccine potency.
Using tetrahedral framework nucleic acids as vectors, peptides are encapsulated internally and CpG ODNs are loaded externally. The peptides are linked to the DNA single strands of TDNs through click chemistry. The peptides are encapsulated internally with TDNs via handles, and the CpG ODNs are loaded externally via sticky end hybridization, thus constructing the peptide vaccine TDN-peptide-CpG (TPVax).
It significantly improves the stability and immunogenicity of peptides, promotes cellular uptake and aggregation in lymph nodes, and enhances the immune response, especially showing a significant enhancement in Th-1 biased cellular and humoral immune responses. It has excellent biocompatibility and practical application potential in influenza prevention.
Smart Images

Figure CN119139466B_ABST
Abstract
Description
Technical Field
[0001] This invention specifically relates to a peptide vaccine based on a tetrahedral framework nucleic acid and its application. Background Technology
[0002] Vaccination is one of the most effective medical interventions for preventing the spread of infectious diseases. Peptide vaccines, as an emerging and promising vaccine candidate, are developed through the careful design of specific epitope components of pathogens. Epitopes are short-chain amino acid sequences that can be recognized by the immune system and elicit an immune response. Compared to traditional vaccines using inactivated or attenuated pathogens, peptide vaccines can induce a more precise and effective immune response, avoiding potential problems such as autoimmune diseases, infection risks, and allergic reactions. However, peptide vaccines face challenges such as poor stability, weak immunogenicity, and low delivery efficiency. Therefore, they usually require the use of additional delivery systems or adjuvants to enhance their immunogenicity and ensure effective elicit of an immune response in practical applications.
[0003] Nanoparticles, as an excellent delivery system for peptide vaccines, can mimic the size and morphology of pathogens, eliciting an immune response similar to that of attenuated vaccines while maintaining high selectivity for peptide vaccines. Currently, various nanoparticles, including liposomes, virus-like particles, and polymers, are widely used in peptide vaccine delivery. However, despite their enormous potential, they still face many challenges. For example, liposomes often suffer from low drug loading, rapid drug leakage, and vesicle fusion due to insufficient thermodynamic stability. Therefore, liposome-based delivery systems often require large amounts of antigen to overcome these problems, leading to increased vaccine production costs. Recently, Yang et al. designed optimized aromatized liposomes, significantly improving drug loading efficiency and prolonging efficacy; however, the physical stability issues caused by the inherent phospholipid bilayer structure of liposomes have not been completely resolved. Furthermore, the application of viral vectors is limited by complex production processes and potential risks of toxicity, immune and inflammatory responses, insertion mutations, and carcinogenicity. Similarly, the application of polymer vectors is constrained by unclear antigenic immunogenicity, difficulties in large-scale production, uncertain biocompatibility, and the potential risk of long-term side effects.
[0004] Tetrahedral framework nucleic acids (TDNs) are nucleic acid molecules formed by the self-assembly of multiple single-stranded DNA molecules through complementary base pairing. They possess good in vivo stability and have shown great research potential as a drug delivery platform in recent years. TDNs occupy a unique position in nanoparticle delivery systems due to their efficient self-assembly, highly controllable physicochemical properties, and high customizability and scalability under editability. CN117797252A proposed a viral peptide-protein subunit combined vaccine based on DNA nanotechnology and its preparation method. By coupling viral B-cell epitope peptides to the four vertices of a tetrahedral framework nucleic acid, a viral peptide vaccine was successfully prepared. However, mounting peptides on the outside of TDNs failed to effectively protect the active peptide components, thus affecting their immunogenicity and ultimately leading to a decrease in vaccine potency. Summary of the Invention
[0005] To address the above problems, the present invention provides a peptide vaccine that uses a tetrahedral framework nucleic acid as a carrier, encapsulates polypeptides internally, and carries CpG ODNs externally.
[0006] The polypeptide is linked to the single strand of DNA of a tetrahedral framework nucleic acid via a handle and is encapsulated inside the tetrahedral framework nucleic acid.
[0007] The amino acid sequence of the polypeptide is shown in SEQ ID NO.1 or 2;
[0008] The nucleotide sequence of the handle is shown in SEQ ID NO.3;
[0009] The nucleotide sequence of the CpG ODNs is shown in SEQ ID NO.8.
[0010] Furthermore, the CpG ODNs are mounted on the outside of the tetrahedral framework nucleic acid via sticky end hybridization.
[0011] Furthermore, the polypeptide is coupled to the handle via click chemistry, and the coupling product hybridizes with the single strand of the tetrahedral framework nucleic acid DNA through sticky ends, and is encapsulated inside the tetrahedral framework nucleic acid.
[0012] Furthermore, the four single-stranded DNA sequences of the tetrahedral framework nucleic acid are shown in SEQ ID NO.4–7.
[0013] Furthermore, the nucleotide sequence of the single strand of DNA hybridizing with the coupling product in the tetrahedral framework nucleic acid is shown in SEQ ID NO.6.
[0014] The present invention also provides a method for preparing the aforementioned peptide vaccine, which includes the following steps:
[0015] 1) Take the polypeptide and modify it with an alkynyl group to obtain peptide-pra; take the handle and modify it with an azide group to obtain handle-N3;
[0016] 2) Mix peptide-pra and handle-N3, and use click chemical coupling method to obtain handle-peptide;
[0017] 3) Take handle-peptide and four DNA single strands, add them to TM buffer, maintain at 70℃ for 10 min, then rapidly cool to 4℃ and maintain for more than 20 min to obtain TDN-peptide;
[0018] 4) Take TDN-peptide and CpG ODNs, mix them in equimolar amounts at room temperature to obtain the peptide vaccine TDN-peptide-CpG (TPVax).
[0019] Further, in step 2), the molar ratio of peptide-pra to handle-N3 is 1 to 3:1.
[0020] The amino acid sequence of the peptide-pra is SIINFEKL-pra or
[0021] SLLTEVETPIRNEWGCRCNDSSD-pra;
[0022] The nucleotide sequence of handle-N3 is GGTTGTTGGGT-N3.
[0023] Furthermore, in step 3), the TM buffer contains four DNA single strands at a molar concentration equal to that of handle-peptide.
[0024] Further, the mixing time in step 4) is 30 minutes.
[0025] Finally, this invention provides the use of the aforementioned peptide vaccine in the preparation of an influenza vaccine.
[0026] The peptide vaccine of this invention uses a specific tetrahedral framework nucleic acid as a carrier, encapsulating an antigenic epitope peptide derived from positions 257-264 of the model antigen ovalbumin (OVA) and an epitope peptide derived from the M2e protein of influenza A virus within the carrier using specific handles, providing necessary protection for the peptide. In serum and enzymatic environments, the stability of the peptide is significantly enhanced, thereby maintaining the integrity of the antigen and ensuring its immunogenicity. Experimental results show that the peptide vaccine based on tetrahedral framework nucleic acid not only promotes cellular uptake of the peptide but also enhances the aggregation of the peptide vaccine in lymph nodes, further ensuring its immunizing effect.
[0027] This invention integrates CpG ODNs onto a tetrahedral framework nucleic acid, significantly enhancing the immunogenicity of the delivered antigen, particularly in recruiting immune cells and inducing strong cellular and humoral immune responses. Experimental results confirm that the TDN-based peptide vaccine effectively promotes dendritic cell activation and cytokine secretion, demonstrating its effectiveness in establishing a broad and durable adaptive immune response, especially in Th-1 biased cellular responses, antibody production, and memory response formation. Furthermore, the vaccine's distribution is uniquely limited to the injection site and inguinal lymph nodes, exhibiting excellent tolerability in mouse experiments with minimal off-target effects and inflammatory responses, highlighting its superior biocompatibility and potential for practical application in influenza prevention.
[0028] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0029] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0030] Figure 1Synthesis and characterization of TPVax; (a) Schematic diagram of the synthesis of FITC-OVA-handle and corresponding 2% agarose gel electrophoresis results (1. FITC-OVA, 2. FITC-OVA-handle, 3. FITC-2OVA-handle, 4. FITC-3OVA-handle); (b) PAGE electrophoresis results of TDN binding site titration; (c) PAGE electrophoresis results of TDN loaded with multiple OVAs; (d) PAGE electrophoresis verification diagram of successful synthesis of O@TPVax (1. S1, 2. S2, 3. anti-handle-S3-8, 4. S4, 5. handle-OVA, 6. CpG, (e) Particle size distribution of TDN, TO, and O@TPVax measured by DLS; (f) Zeta potential of TDN, TO, and O@TPVax analyzed by DLS; (g) Representative transmission electron microscopy (TEM) images of TDN, TO, and O@TPVax, with scale bars of 50 nm and 10 nm, respectively; (h) Representative atomic force microscopy (AFM) images of TDN, TO, and O@TPVax, with scale bars of 100 nm and 10 nm, respectively; (i) Representative cryo-electron microscopy (Cryo-EM) images of TDN, TO, and O@TPVax, with scale bars of 50 nm and 10 nm, respectively.
[0031] Figure 2The TDN exoskeleton enhances the stability of peptide antigens, promoting cellular uptake and accumulation in inguinal lymph nodes; (a) Schematic diagram of the mechanism by which FRET OVA is used to determine peptide stability; (b) Comparison of stability between free FRET OVA and TDN-FRET OVA under pancreatic enzyme conditions (n=3); (c) Comparison of stability between free FRET OVA and TDN-FRET OVA in serum (37℃) (n=3); (d) Schematic diagram of the mechanism by which BMDCs (bone marrow-derived dendritic cells) take up material; (e) Flow cytometry histogram of material uptake by cells; (f) Percentage analysis of material uptake by BMDCs (n=3); (g) Fluorescence image of material uptake by BMDCs (60x magnification, n=3), scale bar 20μm; (h) Validation of the enrichment of Cy5-O@TPVax vaccine in inguinal lymph nodes (iLNs) in vivo. (i) Schematic diagram of the process; (j) In vivo fluorescence imaging at 3 and 6 hours after intramuscular injection of Cy5-O, Cy5-T, Cy5-TO and Cy5-O@TPVax (n=3); (j) Quantitative analysis of fluorescence signals at 3 and 6 hours after injection of Cy5-O, Cy5-T, Cy5-TO and Cy5-O@TPVax (n=3); (k) Ex vivo fluorescence imaging of iLNs taken from mice 6 hours after treatment (n=3); (l) Quantitative analysis of fluorescence signals at 20 μm (n=3). Data are expressed as mean ± standard deviation (SD), and P values are labeled as: ns (no significant difference), (P<0.05), (P<0.01), (P<0.001), **** (P<0.0001).
[0032] Figure 3 The CpG-modified TDN exoskeleton significantly enhanced the immunogenicity of the antigen and the activation effect on dendritic cells (DCs); (a) Schematic diagram verifying the ability of O@TPVax to activate BMDCs; (b) Schematic diagram of the DC maturation process; (c) Representative scanning electron microscope (SEM) images of BMDCs after different treatments, scale bar 20 μm; (d & e) Representative images of DC maturation and percentage of mature cells analyzed by flow cytometry (n = 3); (f) PCR analysis of the expression levels of TNF-α, IL-1β and IL-12a genes in BMDCs after different treatments (n = 3); (g) Quantitative analysis of the expression levels of pro-inflammatory cytokines TNF-α, IL-1β and IL-12p70 in BMDCs after different treatments by ELISA (n = 4); (h) Schematic diagram verifying the ability of O@TPVax to activate DCs in iLNs; (i & j) Representative images of DC maturation and percentage of mature cells in iLNs analyzed by flow cytometry (n = 3). Data are expressed as mean ± standard deviation (SD). P-values are labeled as: ns (no significant difference), (P<0.05), (P<0.01), (P<0.001), **** (P<0.0001).
[0033] Figure 4 TPVax induces B cell and T cell activation in vitro; (a) Flowchart verifying the ability of TPVax to expand B cells in vitro; (b, c) Flow cytometry analysis of B cell proliferation (n=3) after 24 hours of material treatment: (b) TDN, OVA, TO, O@TPVax, (c) TDN, M2e, TM, M@TPVax; (d) Flowchart verifying TPVax's in vitro activation of B cells; (e, f) Flow cytometry analysis of B cell activation (n=3) after 24 hours of material treatment: (e) TDN, OVA, TO, O@TPVax, (f) TDN, M2e, TM, M@TPVax; (g) Flowchart verifying T cell activation of T cells in vitro; (h) Flowchart of T cell activation process; (i, j) Flow cytometry analysis of (i) Th1 and (j) Th2 CD4 + Percentage of T cell activation (n=3). Data are expressed as mean ± standard deviation (SD), and P values are labeled as: ns (no significant difference), (P<0.05), (P<0.01), (P<0.001), **** (P<0.0001).
[0034] Figure 5 TPVax promotes DC maturation and humoral immune response in vivo; (a) Schematic diagram of vaccination regimen and humoral immune response analysis; (b, c) Representative graphs and percentages of DC maturation in iLNs analyzed by flow cytometry (n=4); (d) Serum M2e-specific IgG titer (n=5); (e) Fluorescence imaging of IgG in spleen (n=4), scale bar 100 μm; (f) Representative graphs and percentages of M2e-specific memory B cell response in iLNs analyzed by flow cytometry (n=3); (g) Representative graphs and percentages of M2e-specific memory B cell response in spleen analyzed by flow cytometry (n=3). Data are expressed as mean ± standard deviation (SD), and P values are labeled as: ns (no significant difference), (P<0.05), (P<0.01), (P<0.001), **** (P<0.0001).
[0035] Figure 6 .TPVax enhances in vivo cellular immune response; (a) Schematic diagram of vaccination regimen and cellular immune response analysis; (b, c) Flow cytometry detection of M2e specificity in iLNs (b) CD4 + and (c)CD8 + Statistical data on T cell responses (n=4); (d) Flow cytometry analysis of M2e-specific CD3 in iLNs + CD4 + and CD3 + CD8+ T cell statistics (n=4); (e,f) flow cytometry detection of M2e-specific (e)CD4 in the spleen + and (f)CD8 + Statistical data on T cell responses (n=4), the detection procedure was the same as in (b,c); (g) flow cytometry analysis of M2e-specific CD3 in the spleen. + CD4 + and CD3 + CD8 + Statistical data of T cells (n=4); flow cytometry analysis of M2e-specific central memory T cell responses in (h)iLNs and (i) spleen (n=3). Data are expressed as mean ± standard deviation (SD), and P values are labeled as: ns (no significant difference), (P<0.05), (P<0.01), (P<0.001), **** (P<0.0001).
[0036] Figure 7 PAGE diagrams verify the synthesis of M@TPVax (1.S1,2.S2,3.anti-handle-S3-8,4.S4,5.handle-M2e,6.CpG,7.TDN,8.TM,9.M@TPVax)
[0037] Figure 8 Representative transmission electron microscope (TEM) image of .M@TPVax.
[0038] Figure 9 Representative atomic force microscopy (AFM) image of .M@TPVax.
[0039] Figure 10 Representative cryo-electron microscopy (Cryo-EM) image of .M@TPVax.
[0040] Figure 11 The Cell Counting Kit-8 (CCK8) method was used to detect the cytotoxicity of OVA, TDN, TO, and O@TPVax to BMDCs.
[0041] Figure 12 Ex vivo fluorescence imaging of major organs in mice 6 hours after treatment.
[0042] Figure 13 Changes in mouse body weight after immunization.
[0043] Figure 14 Hematoxylin and eosin (HE) staining of major organs of immunized mice on day 21. Detailed Implementation
[0044] Example 1: Construction of the TPVax peptide vaccine of the present invention
[0045] 1. Synthesis of handle-peptide
[0046] 1) Alkyne-modified peptides are used to prepare peptide-pra:
[0047] The epitope peptides at positions 257-264 of the model antigen ovalbumin (OVA) (amino acid sequence SEQ ID NO.1: SIINFEKL) and the epitope peptide from the M2e protein of influenza A virus (amino acid sequence SEQ ID NO.2: SLLTEVETPIRNEWGCRCNDSSD) were modified with an alkyne group to introduce propargyl glycine (pra) into the peptide-pra at one end of the epitope peptide, namely OVA-pra (SIINFEKL-pra) and M2e-pra (SLLTEVETPIRNEWGCRCNDSSD-pra);
[0048] 2) Azide modification of handle to form handle-N3
[0049] The handle (nucleotide sequence SEQ ID NO.3: GGTTGTTGGGT) was modified with an azide group to obtain a handle-N3 with an azide group (-N3) attached to one end of the nucleotide sequence.
[0050] (GGTTGTTGGGT-N3);
[0051] 3) Click chemical coupling
[0052] Mix 10 μL of 10 mM CuSO4, 29.86 μL of DMSO, and 3.54 μL of 28.3 mM TBTA, let stand for 5 min, then add 6.6 μL of 600 μM peptide-pra (OVA-pra or M2e-pra) and 10 μL of 200 μM handle-N3 and mix. Incubate overnight at room temperature. Finally, remove uncoupled peptides using DNA ethanol precipitation to obtain handle-peptide.
[0053] 2. Synthesis of TDN-peptide
[0054] 1) TDN consists of a 21bp outer framework formed by four single-stranded DNA molecules.
[0055] S1 (SEQ ID NO.4):
[0056] ATTTATCACCCGCCATAGGAGACGTATCACCAGGCAGTTGAGACGA
[0057] ACATTCCTAAGTCTGAA
[0058] S2 (SEQ ID NO.5):
[0059] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGA
[0060] TGGGCATGCTCTTCCCGTTAAATTATCTACCACAACTCAC
[0061] antihandle-S3-8(SEQ ID NO.6):
[0062] cccaacaaccGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGG
[0063] AAGAGCATGCCCATCCACTCCTATG
[0064] S4 (SEQ ID NO.7):
[0065] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGA
[0066] TGGGCATGCTCTTCCCGTTAAATTATCTACCACAACTCAC
[0067] 2) Synthesis process
[0068] The synthesized handle-peptide and four DNA single strands (S1, S2, antihandle-S3, S4) were dissolved in equimolar amounts in TM Buffer (50 mM MgCl2 and 10 mM Tris-HCl, pH 8.0). The final concentration of each of the five oligonucleotide chains was 1000 nM. After thorough mixing, the mixture was rapidly heated to 70 °C, and after 10 minutes, it was rapidly cooled to 4 °C and maintained for more than 20 minutes to obtain TDN-peptide.
[0069] 3. Construction of TPVax vaccine
[0070] 1) CpG ODNs are artificially synthesized single-stranded oligodeoxynucleotides with the following nucleotide sequence (SEQ ID NO.8): TCCATGACGTTCCTGACGTTGTGAGTTGTGGTAGATAATTT
[0071] 2) Synthesis process
[0072] The CpG ODNs were mixed with the previously synthesized TDN-peptide in equimolar amounts for 30 minutes at room temperature to obtain the final product.
[0073] The following experimental examples further illustrate the beneficial effects of the present invention:
[0074] Example 1: Preparation and Characterization of a Peptide Vaccine Based on a TDN Multifunctional Exoskeleton
[0075] 1. Construction of peptide vaccines based on TDN multifunctional exoskeleton
[0076] 1.1 Method
[0077] 1)Synthetic TDN
[0078] Equimolar concentrations of four framework DNA strands (S1–S4, sequences shown in Table 1) were added to TM buffer (50 mM MgCl2 and 10 mM Tris-HCl, pH 8.0). TDN was successfully synthesized through a two-step process of heating to 95 °C for 10 minutes and then cooling at 4 °C for 20 minutes.
[0079] Table 1 Four framework DNA strands
[0080]
[0081] 2) Synthesis of TDN-OVA(TO) and TDN-M2e(TM)
[0082] Handle-peptide was synthesized by coupling peptide-pra with handle-N3 via click chemistry. To construct TDN-peptide, equimolar amounts of handle-peptide were mixed with framework DNA strands (S1–S4). This homogeneous mixture was heated to 70°C for 10 minutes in TM buffer (50 mM MgCl2 and 10 mM Tris-HCl, pH 8.0), then cooled to 4°C for 20 minutes. TDN-OVA (TO) and TDN-M2e (TM) were both synthesized using the above method, differing only in their handle-peptides: handle-OVA and handle-M2e, respectively. OVA refers to the epitope peptide at positions 257-264 of the model antigen ovalbumin (OVA), with its amino acid sequence SEQ ID NO.1; M2e is the epitope peptide of the M2e protein of influenza A virus, with its amino acid sequence SEQ ID NO.2. During the synthesis process, relevant sequences listed in Table 2 were also involved to verify success.
[0083] Table 2. Fluorescently labeled peptide sequences
[0084]
[0085] 3) Synthesize O@TPVax and M@TPVax
[0086] To construct the TPVax vaccine, CpG ODNs were assembled onto TDN-peptide. First, TDN-peptide was prepared as described above. Then, equimolar amounts of CpG ODNs were mixed with TDN-peptide at room temperature for 30 minutes to obtain TDN-peptide-CpG (TPVax). The construction of O@TPVax and M@TPVax followed the same method, differing only in the TDN-peptides used: TDN-OVA (TO) and TDN-M2e (TM), respectively. Successful coupling of the handle-peptide and assembly of the TPVax vaccine were confirmed by polyacrylamide gel electrophoresis (PAGE). The specific nucleotide sequences involved are shown in Table 3.
[0087] Table 3. Nucleotide sequences involved in the assembly process.
[0088]
[0089] 1.2 Results
[0090] To construct a peptide vaccine based on a TDN-based multifunctional exoskeleton, peptides were first extracted from OVA, a model antigen protein widely used in vaccine research. These peptides were then conjugated with handles, and FITC-labeled OVA-handles (FITC-OVA-handles) were successfully synthesized via click chemistry. 2% agarose gel electrophoresis confirmed the successful synthesis of the FITC-OVA-handle and its variants, FITC-2OVA-handle and FITC-3OVA-handle. Figure 1 a).
[0091] Traditionally, vectors are loaded onto the TDN exmascara via direct incubation or sticky-end attachment. However, uncertainties in drug loading, unintended biostability, and nonspecific effects limit the application of this design. To address this, a novel method was devised to precisely encapsulate the vector onto the TDN exmascara at a predetermined location. This method achieves efficient encapsulation by hybridizing the peptide-handle with the TDN via sticky ends. Therefore, the location of the sticky ends is crucial for encapsulation efficiency. To validate the ideal peptide encapsulation site, the OVA-handle bound to sites 5 through 10 of the antihandle-S3 of the TDN (achieved through pairing of a specific nucleotide sequence of the handle with the complementary sequence of the sticky end of the antihandle-S3). Polyacrylamide gel electrophoresis (PAGE) results showed that the TDN attached at site 8 exhibited the fastest migration rate, with its electrophoretic band being closest to that of native TDN. This result demonstrates the successful encapsulation of OVA at site 8 of the TDN, establishing site 8 as the ideal binding site for peptide loading. Therefore, site 8 was selected as the optimal site for peptide encapsulation in subsequent experiments. Figure 1 b).
[0092] The synthesis of TDN-OVA encapsulated with OVA was further confirmed by electrophoresis, where OVA was labeled with FITC and the S2 of TDN was labeled with Cy5. Co-localization of FITC and Cy5 fluorescence in PAGE analysis confirmed successful OVA loading onto TDN. Notably, the yield of TDN-OVA was superior to variants with multiple OVAs (TDN-2OVA and TDN-3OVA), not only in terms of higher yield but also in terms of fewer byproducts. Figure 1 c). Therefore, a single OVA-loaded TDN was chosen as the structural basis for the peptide vaccine.
[0093] Given that CpG ODNs can induce humoral and cellular immune responses, CpG was further integrated into TDN via sticky ends to construct a TDN-based peptide vaccine. PAGE analysis confirmed the successful synthesis of TDN-OVA-CpG (O@TPVax), which simultaneously loads OVA and CpG. Figure 1 d).
[0094] Using the same method, a TDN-M2e-CpG (M@TPVax) conjugate simultaneously loaded with influenza A virus M2e protein epitope peptide and CpG was constructed, and its successful synthesis was confirmed by PAGE. Figure 7 2. Characterization of peptide vaccines based on TDN multifunctional exoskeleton
[0095] 2.1 Methods
[0096] The synthesis of handle-peptide was verified by 2% agarose gel electrophoresis, while the construction of TDN, TDN-peptide, and TPVax was confirmed by 8% polyacrylamide gel electrophoresis (PAGE). To further validate vaccine preparation, its morphology was observed using cryo-electron microscopy (Cryo-EM), transmission electron microscopy (TEM), and atomic force microscopy (AFM). Furthermore, the average particle size and zeta potential of the vaccine were measured by dynamic light scattering (DLS).
[0097] 2.2 Results
[0098] Dynamic light scattering (DLS) characterized the particle sizes of TDN, TO, and O@TPVax, which were 16.24±2.98 nm, 16.28±2.75 nm, and 18.98±3.89 nm, respectively. Figure 1 e). Furthermore, the zeta potentials of TDN, TO, and O@TPVax were measured to be -5.69±5.13 mV, -3.14±7.31 mV, and -5.73±5.78 mV, respectively. Figure 1 f). The size range of 10-20 nm and the slightly negative potential provide optimal conditions for TDN-based vaccines to achieve efficient cellular uptake and targeted lymph node accumulation, enhancing their potential as vaccine delivery and immune stimulation.
[0099] Transmission electron microscopy (TEM) morphological characterization showed that TDN, TO, and O@TPVax had consistent triangular profiles and uniform size distribution. Figure 1 g). Further analysis using atomic force microscopy (AFM) and cryo-electron microscopy (Cryo-EM) confirmed the size range of the nanoparticles (10-20 nm) and their successful preparation. Figure 1 Similarly, the successful fabrication of M@TPVax and its triangular profile were confirmed by TEM, AFM, and Cryo-EM. Figure 8-10 In summary, the comprehensive research methodology, from synthesis to characterization, not only demonstrates the successful construction of TDN-based functionalized peptide vaccines, but also highlights the precision of cargo packaging and their potential to induce targeted immune responses.
[0100] Experimental Example 2: The Powerful Potential of a TDN-Based Multifunctional Exoskeleton as a Delivery Platform
[0101] 1. TDN multifunctional exoskeleton improves peptide stability
[0102] 1.1 Method
[0103] To verify the stability of the peptides, the peptides were encapsulated within TDN using Foster resonance energy transfer (FRET) technology to construct a TDN-FRET peptide vaccine (peptide sequences are shown in Table 1). The FRET peptide and TDN-FRET peptide were co-incubated with trypsin at 37°C for different time intervals (0, 1, 2, 3, 6, 12, and 24 hours). Subsequently, the optical density (OD) was measured at 450 nm using a microplate reader (VarioskaLUX multi-mode microplate reader, Thermo Fisher, MA, USA), and absorbance was calibrated at 570 nm. To assess the stability of the FRET peptides in serum, fetal bovine serum (Corning, New York, USA) was used. Incubation was performed at 10% serum concentration for the same time intervals, followed by OD measurement using the microplate reader and absorbance calibration at 570 nm to ensure accurate measurement.
[0104] 1.2 Results
[0105] To determine whether a TDN-based multifunctional exoskeleton could provide structural protection for the encapsulated peptide, a commonly used FRET peptide was integrated into the TDN framework. This peptide used EDANS as a donor and DABCYL as a quencher, with both placed close together to quench fluorescence. Fluorescence was only detected after EDANS and DABCYL separated by enzymatic cleavage, allowing the stability of the peptide to be assessed using the fluorescence signal from the FRET system. Figure 2 a).
[0106] FRET peptide was encapsulated within TDN to form a TDN-FRET peptide structure, and its enzymatic stability was compared with that of free FRET peptide. The results showed that the TDN-FRET peptide exhibited significantly enhanced stability; after 24 hours of enzymatic treatment, more than 11% of the encapsulated peptide remained, while the free peptide was almost completely degraded within 12 hours. Figure 2 b). Similarly, the stability of FRET peptide and TDN-FRET peptide in goat serum was measured. FRET peptide had a half-life of less than 2 hours and was almost completely degraded within 12 hours, while TDN-FRET peptide showed significantly enhanced stability; after 12 hours of serum incubation, more than 27% of the peptide remained intact, and approximately 13% remained intact after 24 hours. The encapsulated FRET peptide had a half-life extended to 6 hours, four times that of the free peptide. Figure 2 c).
[0107] These results demonstrate that the TDN-based multifunctional exoskeleton provides effective physical protection for peptides, significantly enhancing their stability in enzyme and serum environments. This protective effect likely stems from the spatial isolation effect of the TDN structure, which restricts enzyme contact with the encapsulated peptide and creates a stable microenvironment for the peptide, ensuring its integrity.
[0108] 2. The TDN multifunctional exoskeleton increases cellular uptake of peptides.
[0109] 2.1 Methods
[0110] 2.1.1 Cell Culture
[0111] BMDCs were obtained from C57BL / 6 mice by flushing bone marrow cells from the femur and tibia. Erythrocytes were removed using erythrocyte lysis buffer (BioLegend, USA). Cells were then cultured in RPMI 1640 medium supplemented with 1% penicillin / streptomycin solution, 10% fetal bovine serum, 1% HEPES, 0.1 mM β-mercaptoethanol, 20 ng / ml mouse IL-4 (Invitrogen, USA), and 20 ng / ml mouse granulocyte-macrophage colony-stimulating factor (GM-CSF) (Invitrogen, USA). Immature BMDCs were collected on day 6 for further studies.
[0112] 2.1.2 Cytotoxicity assay
[0113] To evaluate the effects of OVA, TDN, TO, and O@TPVax on the activity of BMDCs, a CCK-8 experiment was conducted. First, 8 × 10⁸ plants were seeded in each well of a 96-well plate. 3 BMDCs were cultured overnight. After 24 hours of starvation, cells were treated with serum-free medium containing 250 nM OVA, TDN, TO, and O@TPVax. Subsequently, cells were incubated with CCK-8 solution (MCE, HY-K0301, USA) for 1 hour, and cell viability was measured by OD value at 450 nm.
[0114] 2.1.3 Cell uptake experiment
[0115] BMDCs were cultured overnight in 6-well plates at 37°C and 5% CO2. For flow cytometry analysis, cells were treated for 24 hours with 250 nM FITC-labeled OVA (FITC-O), FITC-labeled TDN (FITC-TO), Cy5-labeled TDN (Cy5-T), and Cy5-labeled TDN (Cy5-TO), respectively. After treatment, the cells in the 6-well plates were washed and collected into flow cytometry tubes. Cell uptake efficiency was quantified by flow cytometry (FC500 Beckman, Illinois, USA). For confocal microscopy analysis, BMDCs were exposed to 250 nM FITC-labeled OVA (FITC-O), Cy5-labeled TDN (Cy5-T), and FITC-Cy5-labeled TDN (FITC-Cy5-TO) for 24 hours. After washing three times to remove unabsorbed material, cells were fixed with 4% formaldehyde for 30 minutes, and the nuclei were stained with DAPI. Finally, the images were observed under a confocal microscope (FV3000; Olympus, Tokyo, Japan).
[0116] 2.2 Results
[0117] Cellular uptake is a key step in dendritic cell maturation. TDNs, as a promising delivery platform, offer the advantage of significantly improving cellular uptake efficiency. To investigate the effects of TDNs on cellular uptake, bone marrow-derived dendritic cells (BMDCs) were extracted and cultured from mice. After co-culturing BMDCs with FITC-labeled OVA (FITC-O) and FITC-labeled TO (FITC-TO) for 24 hours, the FITC fluorescence signal was detected and quantitatively analyzed using flow cytometry. Figure 2 d). The results showed that the fluorescence intensity of FITC-TO was 2.4 times higher than that of FITC-O, which significantly improved the cellular uptake efficiency of OVA (from 20% to 48%).
[0118] Subsequently, the experiment was repeated using Cy5-labeled TDN (Cy5-T) and Cy5-labeled TO (Cy5-TO), and the results showed that the uptake efficiency of both groups exceeded 90%. Figure 2 e&f). Furthermore, confocal laser scanning microscopy (CLSM) was used to further observe the internalization of BMDCs (e&f). Figure 2d). To more intuitively observe TO uptake in BMDCs, TO simultaneously labeled with FITC and Cy5 (FITC-Cy5-TO) was used. CLSM images showed that BMDCs treated with FITC-Cy5-TO exhibited strong FITC fluorescence in the cytoplasmic region, while BMDCs treated with FITC-O showed a lower FITC fluorescence signal. Furthermore, BMDCs treated with Cy5-T and FITC-Cy5-TO exhibited strong Cy5 fluorescence signals in both the cytoplasmic and nuclear regions, and significant co-localization of FITC and Cy5 fluorescence was observed in BMDCs treated with FITC-Cy5-TO. Figure 2 g).
[0119] These results indicate that TDN delivery significantly enhances cellular uptake efficiency, contributing to antigen presentation and subsequent dendritic cell activation of the immune response. Simultaneously, in vitro cytotoxicity assays showed no significant difference in cell viability between BMDCs and those co-cultured with 250 nM OVA, TDN, TO, and O@TPVax for 24 hours, indicating that the TDN-based vaccine delivery system possesses good biocompatibility. Figure 11 Overall, the experimental results highlight the great potential of TDNs as a vaccine delivery platform, not only for their excellent biocompatibility but also for their ability to efficiently deliver immunogenic substances to immune cells.
[0120] 3. The TDN multifunctional exoskeleton increases vaccine lymph node accumulation.
[0121] 3.1 Method
[0122] 3.1.1 Animal Culture
[0123] All animal experiments were conducted in accordance with the ethical standards established by the Animal Ethics Committee of the West China School of Stomatology, Sichuan University. Six- to eight-week-old female C57BL / 6 mice, weighing 18-20 grams, were used in the experiments and housed in an environment with a 12-hour light / 12-hour dark cycle, with a 7-day acclimatization period.
[0124] 3.1.2 In vivo imaging
[0125] Mice were administered OVA, Cy5-labeled TDN (Cy5-T), Cy5-labeled TO (Cy5-TO), and Cy5-labeled O@TPVax (Cy5-O@TPVax) via intramuscular injection into their right leg, with each mouse receiving a dose of 5 μg of peptide. At 3 and 6 hours post-injection, mice were subjected to fluorescence imaging using an IVIS (PerkinElmer) system. Additionally, at 6 hours post-injection, the right inguinal lymph nodes and major organs were excised for fluorescence imaging.
[0126] 3.2 Results
[0127] Another major advantage of the TDN platform is the smaller than 100 nm diameter of its nanoparticles. Nanoparticles of this size are known to preferentially enter lymph nodes, thereby promoting the activation of dendritic cells and primary T cells. Before evaluating the immune response induced by functionalized peptide vaccines, their biodistribution, particularly their enrichment in inguinal lymph nodes (iLNs), was monitored using fluorescence imaging. Therefore, Cy5-T, Cy5-TO, and Cy5-O@TPVax were prepared using Cy5-labeled S2, and the biodistribution of these vaccines and their accumulation in iLNs were described by Cy5 fluorescence detection. Mice received intramuscular injections in the right leg, followed by in vivo imaging system (IVIS) analysis at 3 and 6 hours post-injection, and further imaging of the right iLNs and major organs at 6 hours post-injection. Figure 2 h).
[0128] At both time points, Cy5-T, Cy5-TO, and Cy5-O@TPVax showed significant fluorescence signals at the injection site, with the fluorescence intensity gradually decreasing over time. Figure 2 i&j). This decrease in fluorescence intensity indicates that these materials migrated from the injection site, partially transferring to iLNs, which is consistent with the higher fluorescence enrichment observed in the lymph nodes 6 hours later. Figure 2 This migration is crucial for the delivery of antigens to lymph nodes, optimizing antigen exposure to resident dendritic cells, T cells, and B cells, which helps to elicit an effective immune response and enhance the immunogenicity of vaccines.
[0129] Furthermore, to avoid systemic toxicity, it is crucial to ensure that vaccine distribution is confined to the administration site and draining lymph nodes. Notably, experimental results showed that these formulations did not accumulate significantly in major organs such as the liver, heart, spleen, lungs, and kidneys, highlighting their targeted delivery efficiency. Figure 12 Therefore, the results indicate that the TDN-based vaccine exhibits significant enrichment in iLNs, providing conditions that promote dendritic cell maturation. Furthermore, the excellent biosafety and minimized off-target distribution further demonstrate the platform's potential for clinical translation.
[0130] 4. CpG-modified TDN multifunctional exoskeleton enhances the immunogenicity of peptides and activates dendritic cells.
[0131] 4.1 Methods
[0132] 4.1.1 In vitro dendritic cell maturation, gene expression, and cytokine production
[0133] Dendritic cell maturation, gene expression, and cytokine production were assessed in BMDCs. Cells were cultured overnight in 6-well plates at 37°C and 5% CO2. The following day, cells were treated with 250 nM OVA, TDN, TO, and O@TPVax for 24 hours. After treatment, the culture supernatant was collected for ELISA detection of TNF-α, IL-12p70, and IL-1β. Cells were washed with PBS and dehydrated sequentially with different concentrations of ethanol (25%, 50%, 75%, and 100%), followed by air drying and gold sputtering coating for scanning electron microscopy (SEM) analysis of cell surface morphology.
[0134] For flow cytometry analysis, cells were first blocked with anti-mouse CD16 / 32 antibody, followed by staining at 4°C for 30 minutes with APC-Cy7-labeled anti-mouse CD45 antibody, FITC-labeled anti-mouse CD11c antibody, PE-labeled anti-mouse MHCII antibody, APC-labeled anti-mouse CD80 antibody, and PE-Cy7-labeled anti-mouse CD86 antibody. The stained cells were then analyzed by flow cytometry (FC500 Beckman, Illinois, USA).
[0135] Gene expression assessment was performed using the same cell treatment as flow cytometry. After treatment, cells were washed three times with cold PBS and lysed using TRIzol reagent (Invitrogen, USA). RNA extraction and purification were performed according to the instructions of the RNApure Total RNA Extraction Kit (RP1202, BioTeke, Jiangsu, China). Subsequently, reverse transcription of total RNA was performed according to the instructions of the PrimeScript RT Kit (Takara Bio, Shiga, Japan). Finally, qPCR analysis was performed using the SYBR Premix Ex TaqII kit on a QuantStudio 6 detection system (Thermo Fisher, USA), with β-actin used as an internal control to normalize mRNA expression. Primer sequences for TNF-α, IL-12a, IL-1β, and β-actin are shown in Table 4.
[0136] Table 4 Primer sequences
[0137]
[0138] Cell culture supernatant was stored at -80°C until cytokine ELISA detection. The experiments were strictly performed following the instructions for the mouse TNF-α ELISA kit (Multi Sciences, Hangzhou, China), mouse IL-12p70 kit (MultiSciences, Hangzhou, China), and mouse IL-1β ELISA kit (Multi Sciences, Hangzhou, China). Finally, OD values were read at 450 nm using a microplate reader (VarioskaLUX multi-mode microplate reader, Thermo Fisher, MA, USA), and absorbance calibration was performed at 570 nm to ensure measurement accuracy.
[0139] 4.1.2 In vivo dendritic cell maturation
[0140] Inguinal lymph nodes were collected 24 hours after each mouse was injected with OVA, TDN, TO, and O@TPVax (5 μg peptide / mouse). The lymph nodes were then ground, washed, filtered, and resuspended in FACS buffer. The collected cell suspension was first blocked with anti-mouse CD16 / 32 antibody, followed by staining at 4°C for 30 minutes with APC-Cy7-labeled anti-mouse CD45 antibody, FITC-labeled anti-mouse CD11c antibody, PE-labeled anti-mouse MHCII antibody, APC-labeled anti-mouse CD80 antibody, and PE-Cy7-labeled anti-mouse CD86 antibody. The stained cells were then analyzed by flow cytometry (FC500 Beckman, Illinois, USA).
[0141] 4.2 Results
[0142] Multifunctional exoskeletons based on TDNs have shown great potential for efficient peptide vaccine delivery. To evaluate the role of TDNs in enhancing dendritic cell (DC) activation and evoking a strong immune response, we first examined the activation capacity of functionalized peptide vaccines on in vitro BMDCs. BMDCs from C57BL / 6 mice were co-cultured with OVA, TDN, TO, and O@TPVax for 24 hours, followed by flow cytometry analysis of BMDC maturation (marked by CD11c). + MHCII + CD80 + CD86 + ,See Figure 3a&b). Scanning electron microscopy (SEM) further provided visual evidence of morphological changes in BMDCs. Control group cells were relatively round with fewer dendritic protrusions, while BMDCs exposed to OVA, TDN, TO, and O@TPVax exhibited more complex dendritic structures. In particular, BMDCs treated with O@TPVax showed significant dendritic extension, cell membrane folds, and a spindle-shaped morphology, indicating higher maturity and readiness for antigen presentation. Figure 3 c).
[0143] Furthermore, flow cytometry results quantitatively confirmed that OVA and TO only induced moderate maturation of BMDCs, while O@TPVax significantly increased the proportion of mature BMDCs. Figure 3 (d&e). Given the known role of CpG ODNs in stimulating DC maturation and the release of pro-inflammatory cytokines, we further analyzed the expression levels of TNF-α, IL-12p70, and IL-1β genes by qPCR and quantified the secretion of these cytokines using ELISA. After 24 hours of culture, TOC significantly enhanced the cytokine response, while TO had a relatively small effect on cytokine expression (d&e). Figure 3 (f&g). This result indicates that CpG modification plays a crucial role in inducing a strong immune response on the TDN platform, further demonstrating the importance of this modification in enhancing vaccine efficacy.
[0144] To verify the in vivo effects, dendritic cells (DCs) were collected from the inguinal lymph nodes (iLNs) of immunized mice 24 hours later, and their maturity (CD11c) was analyzed by flow cytometry. + MHCII + CD80 + CD86 + ,See Figure 3 The results showed that OVA, TDN, and TO moderately increased MHCII expression, but had limited effects on CD80 and CD86. O@TPVax significantly enhanced the maturation of DCs in vivo, as evidenced by a substantial increase in the proportion of mature DCs. Figure 3 These results demonstrate that CpG-modified TDNs not only enhance the immunogenicity of the delivered peptides but also significantly promote the maturation of DCs, which is crucial for an effective vaccine response.
[0145] The mechanisms by which O@TPVax induces dendritic cell (DC) maturation in vivo are likely multifaceted. First, CpG ODNs directly activate DCs, preparing them for the initiation of an immune response. Second, the targeted delivery system of TDNs effectively transports antigens to lymph nodes, a primary site of the immune response. Furthermore, TDNs enhance peptide uptake by dendritic cells, a crucial step in DC maturation. Finally, the TDN exoskeleton maintains the structural integrity of the peptides, prolonging the duration of immune stimulation and thus enhancing the overall immune response.
[0146] 5. CpG-modified TDN multifunctional exoskeleton enhances in vitro B cell and T cell activation.
[0147] 5.1 Method
[0148] 5.1.1 In vitro B cell proliferation and activation
[0149] Spleen cells were obtained from C57BL / 6 mice. Briefly, the spleen was ground and homogenized, and erythrocytes were lysed using erythrocyte lysis buffer (BioLegend, USA). Spleen cells were then obtained after centrifugation and filtration, and resuspended in PBS. For carboxyfluorescein succinimide (CFSE) staining, 2 x 10^7 spleen cells were suspended in 10 mL of PBS, and 1 μL of 8 mM CFSE (BioLegend) dissolved in DMSO was added. The cell suspension was incubated at 37°C for 15 minutes. Subsequently, CFSE-stained spleen cells were collected by centrifugation and resuspended in 1640 medium.
[0150] To assess B cell activation, unstained spleen cells were co-cultured in 6-well plates with 250 nM OVA, TDN, TO, and O@TPVax. After 24 hours of incubation, spleen cells were collected by centrifugation, resuspended in FACS buffer, and labeled with PE anti-mouse CD19 antibody and APC anti-mouse CD80 antibody at 4°C for 30 minutes. Finally, B cell activation was analyzed by flow cytometry (FC500 Beckman, Illinois, USA).
[0151] To assess B cell proliferation, 5*10^5 CFSE-stained spleen cells were co-cultured in 200 μL of 1640 medium with 250 nM MOVA, TDN, TO, and O@TPVax in 96-well round-bottom plates. After 3 days of incubation, spleen cells were collected by centrifugation, resuspended in FACS buffer, and labeled with PE anti-mouse CD19 antibody for 30 minutes at 4°C. Cell proliferation was then assessed by quantifying CFSE fluorescence dilution using flow cytometry.
[0152] 5.1.2 In vitro CD4 + T cell activation
[0153] Following the procedure described above, spleen cells were obtained from C57BL / 6 mice. Naive T cells (CD3+) were then isolated from the spleen cells using a monoclonal antibody-magnetic bead separation system (BioLegend, USA). + CD4 + (CD44-CD62L+). Successful isolation of Naive T cells was confirmed by flow cytometry. BMDCs were co-cultured with 250 nM M2e, TDN, TM, and M@TPVax in 6-well plates for 24 hours. Subsequently, the isolated CD44-CD62L+ cells were isolated. + Naive T cells were co-cultured with treated BMDCs at a ratio of 1:5 to 1:10 for 24 hours. After 24 hours of incubation, the cells were washed and resuspended. First, surface labels were applied using Pacific-blue anti-mouse CD3a and FITC anti-mouse CD4. After incubation for 30 minutes, the cells were fixed and infiltrated using the Cytofix / Cytoperm kit (BD Bioscience, USA). Next, the cells were divided into two groups and intracellularly stained with APC anti-mouse IFN-γ and APC anti-mouse IL-4, respectively, for 30 minutes. Finally, the stained cells were analyzed by flow cytometry.
[0154] 5.2 Results
[0155] Based on the powerful ability of CpG-modified TDNs to promote dendritic cell maturation, we utilized this multifunctional platform to construct another peptide vaccine. Specifically, we encapsulated the influenza virus M2e peptide and combined CpG with TDN to create TDN-M2e(TM) and TDN-M2e-CpG(M@TPVax) vaccines. To assess their effects on B cell proliferation, CFSE-stained spleen cells from C57BL / 6 mice were co-cultured with OVA, TDN, TO, O@TPVax, M2e, TM, and M@TPVax for 3 days. Subsequently, B cells (CD19) were analyzed by CFSE fluorescence dilution assay and flow cytometry. + The proliferation status of ) Figure 4 a). The results showed that OVA, TO, and O@TPVax significantly induced B cell proliferation, with O@TPVax showing the most significant effect. Figure 4 b). In contrast, TDN alone had a smaller effect on B cell proliferation. In the M2e-related vaccine group, M@TPVax significantly increased B cell proliferation to 22%, far exceeding the induction levels of M2e (10%) and TM (11%). Figure 4 c). These results indicate that while TDN-peptide can stimulate B cell proliferation, integrating peptides and CpG ODNs into TDN significantly enhances this effect.
[0156] Next, we investigated the ability of CpG-modified TDNs to activate B cells. After co-culturing spleen cells from C57BL / 6 mice with the vaccine for 24 hours, B cell (CD19) counts were measured using flow cytometry. + Expression of co-stimulatory molecules (such as CD80 / 86) Figure 4 d). The results showed that the O@TPVax group significantly increased the expression of CD80 and CD86 ( Figure 4 e). Similarly, M@TPVax significantly improves CD80. + and CD86 + The proportion of B cells, while M2e and TM only significantly affected CD86 expression, with a smaller effect on CD80. Figure 4 f). These results indicate that CpG-modified TDNs play a key role in B cell activation and have the potential to enhance immune responses.
[0157] Furthermore, considering that CpG-modified TDNs enhance B cell activation, we further investigated their effect on T cell activation induced by BMDC treatment. BMDCs from C57BL / 6 mice were co-cultured with M2e, TDN, TM, and M@TPVax for 24 hours, followed by treatment with CD4+. + T cells were co-cultured and T cell activation was analyzed by flow cytometry. Figure 4 The results showed that M2e, TM, and M@TPVax all induced M2e-specific CD4+ expression of the type 1 (Th1) cytokine IFN-γ. + T cells, but the induction effect of M@TPVax was significantly higher than that of M2e and TM ( Figure 4 i). In addition, these vaccine groups induced CD4 + T cells expressed low levels of the type 2 (Th2) cytokine IL-4, indicating that it elicited a Th1-biased T cell immune response in vitro. Figure 4 j).
[0158] 6. Peptide vaccines constructed based on a TDN multifunctional exoskeleton activate dendritic cells and enhance humoral immune responses.
[0159] 6.1 Method
[0160] 6.1.1 In vivo immunization
[0161] Mice were immunized with M2e and M@TPVax via intramuscular injection using a first-batch strategy, with each injection consisting of 5 μg of the peptide per mouse, administered twice at one-week intervals. Body weight was monitored every 3 days during the experiment. Mice were sacrificed on days 21 and 60, and inguinal lymph nodes and spleens were collected for flow cytometry analysis (FC500 Beckman, Illinois, USA). Additionally, serum samples were isolated from mouse blood on day 21, incubated at room temperature for 30 minutes, centrifuged at 10,000g for 5 minutes, and stored at -20°C for subsequent ELISA assays.
[0162] 6.1.2 Activation of dendritic cells in vivo
[0163] Under a first-buff strategy, spleens were collected from mice on day 21 following immunization with M2e and M@TPVax (5 μg peptide per mouse). The spleens were ground, homogenized, and erythrocytes were lysed using erythrocyte lysis buffer (BioLegend, USA). After centrifugation and filtration, the spleen cells were resuspended in FACS buffer. The cell suspension was blocked with anti-mouse CD16 / 32 antibody and stained for 30 minutes at 4°C with APC-Cy7-labeled anti-mouse CD45 antibody, FITC-labeled anti-mouse CD11c antibody, PE-labeled anti-mouse MHCII antibody, APC-labeled anti-mouse CD80 antibody, and PE-Cy7-labeled anti-mouse CD86 antibody. Finally, the cells were analyzed by flow cytometry (FC500 Beckman, Illinois, USA).
[0164] 6.1.3 M2e-specific IgG titer
[0165] Antigen-specific IgG levels were determined by ELISA. M2e peptide (5 μg / ml in PBS) was coated onto a 96-well Greiner (Germany) microtiter plate and incubated overnight at 4°C. The plate was blocked with blocking buffer (1x PBS, 0.05% Tween-20, 2% BSA) for 1 hour, followed by three PBST washes. Diluted serum samples were added and incubated, then washed and inoculated with HRP-conjugated goat anti-mouse IgG antibody (Invitrogen, USA). After four PBST washes, the plate was developed using a TMB substrate kit (BD Pharmingen, USA), following the manufacturer's recommendations. OD values were measured at 450 nm using a microplate reader (VarioskaLUX, Thermo Fisher, MA, USA), calibrated at 570 nm to ensure accuracy. The endpoint titer was the maximum serum dilution with an OD value at least twice the blank mean.
[0166] 6.1.4 Immunofluorescence (IF) staining
[0167] Immunofluorescence staining was used to assess IgG expression in the spleen. Samples were fixed for 30 minutes and treated with 0.5% Triton X-100 for 10 minutes and 5% sheep serum for 1 hour, respectively. Samples were then stained with diluted secondary antibody (IgG, 1:200), and nuclear staining was performed using DAPI for 10 minutes. Samples were rinsed with PBS (5 minutes, three times) between each step. Finally, images were acquired using a laser scanning confocal microscope (FV3000; Olympus, Tokyo, Japan).
[0168] 6.1.5 In vivo stimulation of memory B cells
[0169] On day 60 following intramuscular immunization with M2e and M@TPVax (5 μg peptide per mouse), mice were sacrificed and inguinal lymph nodes and spleens were collected. The inguinal lymph nodes and spleens were ground, washed, filtered, and resuspended as described above to obtain a single-cell suspension. The collected cells were then blocked with anti-mouse CD16 / 32 antibody and stained with PE-labeled anti-mouse CD19 antibody and APC-labeled anti-mouse CD27 antibody for 30 minutes at 4°C. Finally, the presence of memory B cells was detected by flow cytometry (FC500 Beckman, Illinois, USA).
[0170] 6.2 Results
[0171] To further evaluate the immunogenicity and mechanism of action of the peptide vaccine based on the TDN multifunctional exoskeleton, we investigated dendritic cell (DC) activation in a mouse model using a first-strength strategy. C57BL / 6 mice were randomly assigned to three groups: (I) PBS, (II) M2e, and (III) M@TPVax. The vaccine was administered intramuscularly to mice on days 0 and 14 (5 μg peptide per mouse). On day 21, inguinal lymph nodes (iLNs) were collected, and the proportion of mature DCs (CD11c) was quantified by flow cytometry. + MHCII + CD80 + CD86 + ()( Figure 5 a). The results showed that both M2e and M@TPVax increased the maturity of DCs, but the proportion of mature DCs induced by M@TPVax was significantly higher than that induced by M2e. Figure 5 (b&c). These results demonstrate that TDN-based functionalized peptide vaccines can enhance the immunogenicity of peptides and promote antigen presentation.
[0172] Next, the humoral immune response to these vaccines in mice was evaluated. Figure 5a). On day 21, the M2e-specific IgG titer in serum samples was analyzed by endpoint dilution ELISA. The results showed that M@TPVax significantly enhanced the production of M2e-specific antibodies, with antibody titers reaching 10^4 to 10^5, significantly higher than the M2e group (a). Figure 5 d). Immunofluorescence staining further showed that the IgG expression level of M@TPVax in the spleen was also higher than that in the M2e group, further confirming that M@TPVax has a stronger antibody induction ability than M2e. Figure 5 e). These results are consistent with previous findings, indicating that M@TPVax effectively promotes B cell proliferation and activation, thereby enhancing B cell-mediated humoral immune responses.
[0173] Since M@TPVax induced highly efficient production of M2e-specific antibodies, we further investigated its impact on B-cell immune memory. On day 60, iLNs and spleen samples were collected, and M2e-specific memory B cells (CD19) were analyzed by flow cytometry. + CD27 + ()( Figure 5 a). The results showed that, compared with the M2e group, the M@TPVax group significantly increased the number of memory B cells in iLNs and spleen (a). Figure 5 The results (f&g) indicate that the vaccine has a significant effect on improving long-term humoral immunity.
[0174] In addition, the safety of the vaccine was evaluated. The administered dose of vaccine did not have a significant effect on the body weight of the mice. Figure 13 Meanwhile, 21 days after vaccination, hematoxylin and eosin (H&E) staining results showed no significant damage to the major organs of the mice. Figure 14 In summary, these results indicate that TDN-based functionalized peptide vaccines can effectively induce antibody production and provide long-term protection, and at the tested doses, they did not induce significant side effects, demonstrating good safety.
[0175] 7. Peptide vaccines constructed based on a TDN multifunctional exoskeleton enhance cellular immune responses.
[0176] 7.1 Method
[0177] Spleens were collected from C57BL / 6 mice on day 21 post-immunization. The spleens were milled, lysed, centrifuged, filtered, and resuspended in FACS buffer to obtain a single-cell suspension. To detect specific T cells, 2 million spleen cells were co-incubated in 6-well plates at 37°C for 6 hours with 2 μg M2e peptide, 1 μg / ml Brefeldin A (BD Bioscience, USA), and purified hamster anti-mouse CD28 antibody. After incubation, the cells were washed and stained with Zombie Aqua (Zombie Aqua staining). TM To identify live cells, the cell suspension was blocked for 20 minutes using an anti-mouse CD16 / 32 antibody, followed by peripheral staining with Pacific-blue anti-mouse CD3a, FITC anti-mouse CD4, and BV605 anti-mouse CD8a for 30 minutes. After washing, the cells were fixed and infiltrated using a Cytofix / Cytoperm kit (BD Bioscience, USA). The cells were then divided into two groups for intracellular staining: one group was stained with PE-Cy7 anti-mouse TNF-α, APC anti-mouse IFN-γ, and BV711 anti-mouse IL-2, and the other group was stained with APC anti-mouse IL-4 and PE anti-mouse IL-17, both incubated for 30 minutes. Finally, the stained cells were analyzed by flow cytometry (FC500 Beckman, Illinois, USA). Sorting strategies, antibody lists, and catalog numbers are available at [link to catalog]. Figure 9 .
[0178] To validate the memory immune response of T cells, inguinal lymph nodes and spleens were collected from C57BL / 6 mice on day 60. Inguinal lymph nodes were ground, washed, filtered, and resuspended in FACS buffer to obtain a single-cell suspension. Spleens were similarly ground, homogenized, and erythrocytes were removed using erythrocyte lysis buffer (BioLegend, USA). After centrifugation and filtration, spleen cells were resuspended in FACS buffer. The collected cells were then blocked with anti-mouse CD16 / 32 antibody, followed by labeling with Pacific-blue anti-mouse CD3a, FITC anti-mouse CD4, PE anti-mouse CD44, and BV421 anti-mouse CD62L antibodies for 30 minutes at 4°C. Finally, the stained cells were analyzed by flow cytometry (FC500 Beckman, Illinois, USA).
[0179] 7.2 Results
[0180] The cellular immune responses induced by M2e and M@TPVax vaccines were further investigated. Mice were administered the vaccine twice, two weeks apart, using a first-buff strategy. One week after the booster dose, inguinal lymph nodes (iLNs) and spleens were extracted from immunized mice and stimulated with the M2e peptide pool. Figure 6 a) Measurement of antigen-specific CD4 in lymph nodes by flow cytometry. + and CD8 + T cells. The results showed that M@TPVax significantly induced M2e-specific CD4+ cells expressing Th1 cytokines (IFN-γ, IL-2, and TNF-α). + T cells, while M2e affects CD4 + T cell cytokine expression was almost unaffected. Importantly, neither vaccine induced CD4 cell expression of Th2 cytokines (IL-4 and IL-17). + T cells indicate that the vaccine triggered a Th1-biased immune response. Figure 6 b). Similarly, M@TPVax stimulates M2e-specific CD8. + T cells also outperformed M2e in expressing Th1 cytokines (IFN-γ, IL-2, and TNF-α). Figure 6 c). In addition, M@TPVax significantly increased CD3 levels in lymph nodes. + CD4 + and CD3 + CD8 + The proportion of T cells, while M2e only slightly increased CD3. + CD8 + The proportion of T cells, and CD3 + CD4 + T cells had almost no effect. Figure 6 d). These results indicate that TDN-based functionalized vaccines can induce strong M2e-specific Th1 and CD8+ T cell immune responses in lymph nodes.
[0181] Next, we evaluated antigen-specific CD4 in the spleen. + and CD8 + T cell response ( Figure 6 a) Consistent with the results in lymph nodes, M@TPVax significantly enhanced M2e-specific CD4. + T cells' ability to produce Th1 cytokines (IFN-γ, IL-2, and TNF-α) far exceeds the response induced by M2e. Notably, neither M@TPVax nor M2e induced CD4+. + The upregulation of Th2 cytokines (IL-4 and IL-17) in T cells further confirms the Th1-biased immune response in the spleen and lymph nodes. Figure 6e). Furthermore, M@TPVax significantly enhanced M2e-specific CD8. + T cells express Th1 cytokines (IFN-γ, IL-2, and TNF-α), while M2e only slightly increases M2e-specific CD8 cells expressing IFN-γ. + T cells ( Figure 6 f). CD3 in the spleen + CD4 + and CD3 + CD8 + Analysis of T cells showed that M@TPVax immunity significantly increased the proportion of these two T cell subsets, while M2e had almost no effect on these two T cell types. Figure 6 g). These results further confirm that TDN-based functionalized vaccines induce comprehensive M2e-specific Th1 and CD8 responses in the spleen. + The powerful immunogenicity of T cell responses.
[0182] In addition, to assess the immunological memory effect of the vaccine, we detected M2e-specific CD4 in mice by flow cytometry on day 60 after the initial vaccination. + Central memory T cells (CD3) + CD4 + CD44highCD62Lhigh) Level ( Figure 6 a). Compared with the M2e group, M@TPVax immunization significantly increased the number of iLNs and memory T cells in the spleen ( Figure 6 These results demonstrate that TDN-based functionalized vaccines not only induce a strong immediate immune response but also have the potential to establish lasting immunity.
[0183] In summary, the peptide vaccine of this invention uses a specific tetrahedral framework nucleic acid as a carrier, encapsulating the epitope peptides at positions 257-264 of the model antigen ovalbumin (OVA) and the epitope peptide from the M2e protein of influenza A virus within the carrier using a specific handle. This provides necessary protection for the peptides, significantly enhancing their stability in serum and enzymatic environments, thereby preserving the integrity of the antigen and ensuring its immunogenicity. Furthermore, by integrating CpG ODNs into the tetrahedral framework nucleic acid, the immunogenicity of the delivered antigen is further improved. Animal experimental results show that the vaccine of this invention is uniquely limited to the injection site and inguinal lymph nodes in its distribution, exhibiting excellent tolerability, minimal off-target effects and inflammatory responses, making it suitable for influenza prevention and possessing significant practical application value.
Claims
1. A peptide vaccine, characterized in that: The vaccine uses a tetrahedral framework nucleic acid as a vector, encapsulates peptides internally, and carries CpG ODNs externally. The polypeptide is coupled to the handle via click chemistry, and the coupling product is linked to the single strand of the DNA of the tetrahedral framework nucleic acid via sticky end hybridization and is encapsulated inside the tetrahedral framework nucleic acid. The amino acid sequence of the polypeptide is shown in SEQ ID NO.1 or 2; The nucleotide sequence of the handle is shown in SEQ ID NO.3; The nucleotide sequence of the CpG ODNs is shown in SEQ ID NO. 8; The four single-stranded DNA sequences of the tetrahedral framework nucleic acid are shown in SEQ ID NO.4-7; The nucleotide sequence of the single-stranded DNA that hybridizes with the coupling product in the tetrahedral framework nucleic acid is shown in SEQ ID NO.
6.
2. The peptide vaccine according to claim 1, characterized in that: The CpG ODNs are mounted on the outside of the tetrahedral framework nucleic acid via sticky end hybridization.
3. A method for preparing the peptide vaccine according to claim 1 or 2, characterized in that: It includes the following steps: 1) Take the polypeptide and modify it with an alkynyl group to obtain peptide-pra; take the handle and modify it with an azide group to obtain handle-N3; 2) Mix peptide-pra and handle-N3, and use click chemical coupling method to obtain handle-peptide; 3) Take handle-peptide and four DNA single strands, add them to TM buffer, maintain at 70℃ for 10 min, then rapidly cool to 4℃ and maintain for more than 20 min to obtain TDN-peptide; 4) Take TDN-peptide and CpG ODNs, mix them in equimolar amounts at room temperature to obtain the final product.
4. The preparation method according to claim 3, characterized in that: In step 2), the molar ratio of peptide-pra to handle-N3 is 1 to 3:
1. The amino acid sequence of the peptide-pra is SIINFEKL-pra or SLLTEVETPIRNEWGCRCNDSSD-pra; The nucleotide sequence of handle-N3 is GGTTGTTGGGT-N3.
5. The preparation method according to claim 3, characterized in that: Step 3) The TM buffer contains four DNA single strands at a molar concentration equal to that of handle-peptide.
6. The preparation method according to claim 3, characterized in that: Step 4) The mixing time is 30 minutes.
7. Use of the peptide vaccine of claim 1 or 2 in the preparation of an influenza vaccine.
Citation Information
Patent Citations
Virus polypeptide-protein subunit combined vaccine based on DNA nanotechnology as well as preparation method and application of virus polypeptide-protein subunit combined vaccine
CN117797252A
ATP (adenosine triphosphate) response type vaccine functionalized framework nucleic acid and application thereof
CN117024568A
MiR delivery compound based on DNA tetrahedral framework, preparation method of miR delivery compound and application of miR delivery compound in promoting wound healing
CN118161623A