Medicament for treating diseases associated with motor neuron impairment

Abstract

The application relates to a drug for treating a disease related to motor neuron injury, the drug comprising: circBank ID hsa_circPTPRN2_018 circular RNA and an applicable drug carrier; and the application also relates to the use of the circular RNA in the preparation of a drug for treating a disease related to motor neuron injury.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of gene therapy, in particular to a drug for treating diseases related to motor neuron injury, the drug comprising: circBank ID hsa_circPTPRN2_018 circular RNA and applicable drug carriers; the present application also relates to the use of circular RNA in the preparation of a drug for treating diseases related to motor neuron injury. BACKGROUND

[0002] Amyotrophic lateral sclerosis (ALS) is a motor neuron disease of unknown etiology, which can simultaneously involve upper and lower motor neurons. Patients show progressive muscle atrophy, weakness, paralysis, and eventually die of respiratory failure. ALS has the characteristics of fast progression and high mortality. The disease is highly heterogeneous, and the pathogenesis is not clear. There is a lack of effective therapeutic drugs. Currently, the drugs approved by FDA and widely used in clinical practice are edaravone, riluzole and AMX0035 (sodium phenylbutyrate and taurine glycol complex preparation), but the efficacy is not ideal. Therefore, it is of great scientific value and social significance to explore the pathological mechanism of ALS disease, develop new treatment strategies, and solve the unmet clinical needs. The following references are of reference value: 1) Errichelli L, Dini Modigliani S, Laneve P, et al. FUS affects circular RNA expression in murine embryonic stem cell-derived motor neurons. Nat Commun. 2017;8:14741. Published 2017 Mar 30. doi:10.1038 / ncomms14741; This literature describes that the depletion and mutation of FUS are key factors affecting the biogenesis of circRNA, and the mutation of FUS gene can cause ALS, thus providing a theoretical basis for the possible regulation of circRNA in the pathological process of ALS. 2) Colantoni A, Capauto D, Alfano V, et al. FUS Alters circRNA Metabolism in Human Motor Neurons Carrying the ALS-Linked P525L Mutation. Int J Mol Sci. 2023;24(4):3181. Published 2023 Feb 6. doi:10.3390 / ijms24043181; This literature shows that the dysregulation of circRNA expression in MN carrying P525L FUS mutation is associated with the pathogenesis of ALS. The above two literatures show that circRNA dysregulation is involved in the regulation of the pathological process of ALS, but they have not confirmed which circRNA is related to which specific pathological process, which is their deficiency.See also reference 3) D'Ambra E, Santini T, Vitiello E, et al. Circ-Hdgfrp3 shuttles along neurites and is trapped in aggregates formed by ALS-associated mutant FUS. iScience. 2021;24(12):103504. Published 2021Nov25. doi:10.1016 / j.isci.2021.103504. This literature found that circ-Hdgfrp3 in MNs carrying mutant FUS binds to mutant FUS positive aggregates under stress, and the localization of circ-Hdgfrp3 changes after stress is removed. This finding proposes the hypothesis that under ALS-related conditions, long-term co-localization of circ-Hdgfrp3 in FUS inclusions may interfere with its transport and may interfere with its functional activity; the shortcoming of this literature is that it does not confirm the biological function of circ-Hdgfrp3 and whether it regulates the pathological process of ALS. Summary of the Invention

[0003] The purpose of this application is to select a novel circular RNA as an early diagnostic marker and therapeutic target for ALS. circPTPRN2 is downregulated in motor neurons with the SOD1D90A mutation in ALS, and can serve as an early diagnostic biomarker for this mutant gene. Overexpression of circPTPRN2 alleviates mitochondrial dysfunction in ALS motor neurons, providing a novel therapeutic approach for the clinical treatment of ALS.

[0004] 1. A drug for treating diseases associated with motor neuron injury in patients, the drug comprising: a circular RNA with circBank ID hsa_circPTPRN2_018 and a suitable drug carrier.

[0005] 2. The drug as described in item 1, wherein the drug carrier is an adeno-associated virus.

[0006] 3. The drug as described in item 1 or 2, wherein the patient is a mammal.

[0007] 4. The drug as described in item 1 or 2, wherein the disease associated with motor neuron injury is selected from any one of the following groups: amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA).

[0008] 5. Use of the circular RNA with circBank ID hsa_circPTPRN2_018 in the preparation of a medicament for treating a disease associated with motor neuron injury in a patient.

[0009] 6. The use of item 5, wherein the disease associated with motor neuron injury is selected from any one of the group consisting of amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA).

[0010] 7. The use of item 5 or 6, wherein, in the preparation of a medicament for treating a disease associated with motor neuron injury, a suitable pharmaceutical carrier is used in addition to the circular RNA with circBank ID hsa_circPTPRN2_018.

[0011] 8. The use of item 7, wherein the pharmaceutical carrier is an adeno-associated virus.

[0012] 9. The use of item 7, wherein the patient is a mammal.

[0013] 10. A method of administering the medicament of any one of items 1-4, wherein the medicament of any one of items 1-4 is injected into the spinal canal of the patient, i.e. intrathecally.

[0014] Beneficial technical effects achieved by the technical solution of the present application

[0015] The technical solution of the present application can be used to treat patients suffering from ALS or SMA, and can improve the motor function of the above-mentioned patients and delay the disease progression by intrathecally delivering an adeno-associated virus overexpressing circPTPRN2. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 For the iPSC adhesion of each group after drug screening, the iPSC adhesion of the Circ group transfected with overexpression lentivirus, the NC group transfected with control lentivirus and the D90A group without virus addition were shown 72 hours after the addition of puromycin. It can be seen that the Circ group and the NC group both have cell survival, while the blank group D90A has no cell survival, indicating that the drug screening is successful.

[0017] Figure 2To verify the transfection efficiency of motor neurons; wherein, Figure A is the GFP expression of D90D MN, D90A MN, OE-NC MN and OE-Circ MN groups, it can be known that the motor neurons of NC-OE and Circ-OE groups have GFP expression, indicating that the lentivirus is successfully transfected into the motor neurons; Figure B is the RT-qPCR detection of the mRNA expression level of circPTPRN2 in each group, wherein the overexpression efficiency of the Circ-OE MN group is significantly higher than that of each group.

[0018] Figure 3 To show the mitochondrial membrane potential of each group of motor neurons; wherein, the left graph is TMRM staining of mitochondria in living cells of D90D MN, D90A MN, NC-OE MN and Circ-OE MN, and the fluorescence intensity of mitochondria in the axon of MN is used to reflect the level of mitochondrial membrane potential; the right graph is a statistical analysis graph, which shows that the mitochondrial membrane potential of Circ-OE MN is significantly higher than that of D90A MN and NC-OE MN, indicating that CircRNA PTPRN2 can improve the decrease of mitochondrial membrane potential of D90A MN.

[0019] Figure 4 To show the ATP generation of each group of motor neurons; by detecting and counting the ATP level of each group of motor neurons, it can be known that the ATP level of the Circ-OE group is significantly higher than that of each group, thereby indicating that overexpression of circRNAPTPRN2 can improve the ATP generation of D90A MN.

[0020] Figure 5 The survival of each group of mice is shown. By comparison and analysis, it is concluded that the median survival of mice injected with overexpression of circ PTPRN2 adeno-associated virus is 21 days and 19 days longer than that of mice injected with PBS and control adeno-associated virus ALS SOD G93A mice, respectively. DETAILED DESCRIPTION

[0021] Specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although specific embodiments of the present application are shown in the drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided so that the present application can be more thoroughly understood and the scope of the present application can be accurately conveyed to those skilled in the art.

[0022] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. It is further understood that unless specifically defined in this specification, the terms "including", "including but not limited to", and "comprising" are not intended as limiting and are used interchangeably. It is further to be understood that the description of a certain feature does not indicate that all and only those features are present by implication, other features can or can not be present. It is further to be understood that the description of any feature as an "aspect" does not indicate that all and only those features are present by implication, other features can or can not be present. It is intended that the specification set forth the breadth of the application and any claims eventually drafted will be construed in accordance with the full breadth and scope of the claims, without undue restriction. The specification and drawings are accordingly to be regarded in an illustrative rather than a restrictive sense.

[0023] As used herein, "substantially free of" with respect to a particular component means that the particular component has not been deliberately formulated into the composition and / or is present only as a contaminant or in trace amounts. Thus, the total amount of a particular component resulting from any inadvertent contamination of the composition is less than 0.05%, preferably less than 0.01%. Most preferably, compositions are free of detectable amounts of a particular component as determined by standard analytical methods.

[0024] As used in this specification, "a" or "an" can mean one or more. As used in the claims, the word "a" or "an" when used in conjunction with the word "comprising" can mean one or more than one.

[0025] The term "or" is used in the claims as a total or as an alternative to the limitation that it follows, unless explicitly indicated to the contrary. As used herein, "another" can mean at least a second or more.

[0026] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects over time.

[0027] The ways of obtaining the various biomaterials described in the examples are only provided to achieve the specific purposes disclosed and should not be considered as a limitation on the sources of the biomaterials used in the present application. In fact, the sources of the biomaterials used are broad and any biomaterial that can be obtained without violating laws and moral ethics can be used according to the hints in the examples.

[0028] The present application provides, in a first aspect, a medicament for treating a disease associated with motor neuron injury.

[0029] In one specific embodiment, there is provided a medicament for treating a disease associated with motor neuron injury, the medicament comprising: a circRNA of circBank ID hsa_circPTPRN2_018 and a suitable pharmaceutical carrier. Herein, the sequence of the circRNA of circBank ID hsa_circPTPRN2_018 is set forth in SEQ ID NO. 1:

[0030] AAAAGCAAACTCAAGTTCCTGCCTCCTCAGGCGGAGCAAGAAGACTCCACCAAGTTCATCGCGCTCACCCTGGTCTCCCTCGCCTGCATCCTGGGCGTCCTCCTGGCCTCTGGCCTCATCTACTGCCTCCGCCATAGCTCTCAGCACAGGCTGAAGGAGAAGCTCTCGGGACTAGGGGGCGACCCAGGTGCAGATGCCACTGCCGCCTACCAGGAGCTGTGCCGCCAGCGTATGGCCACGCGGCCACCAGACCGACCTGAGGGCCCGCACACGTCACGCATCAGCAGCGTCTCATCCCAGTTCAGCGACGGGCCGATCCCCAGCCCCTCCGCACGCAGCAGCGCCTCATCCTGGTCCGAGGAGCCTGTGCAGTCCAACATGGACATCTCCACCGGCCACATGATCCTG.

[0031] In the context of the present specification, circBank (http: / / www.circbank.cn / index.html) is a database that can obtain human circRNA sequences. circBank is a comprehensive human circRNA database, which includes more than 140000 human annotated circRNAs from different sources. In addition to the basic information of circRNA, it also includes the information of combined miRNA predicted by two methods, circRNA protein coding potential, circRNA conservation, circRNA modification such as mutation and methylation, etc.

[0032] The reason for the applicant to choose the circular RNA of hsa_circPTPRN2_018 is: first, through literature review, it is found that circular RNA is specifically expressed in neural tissue and can play an important regulatory function in neurodegenerative diseases; second, the applicant found and verified the down-regulation of the expression of the circular RNA of hsa_circPTPRN2_018 in motor neurons carrying the ALS mutant gene SOD1 through sequencing and qPCR, and therefore we selected overexpression of the circular RNA to observe whether it can alleviate the disease phenotype of ALS motor neurons.

[0033] In one embodiment, a pharmaceutical is provided, wherein the pharmaceutical carrier is an adeno-associated virus.

[0034] In the context of the present specification, the "adeno-associated virus" as a "pharmaceutical carrier" has various methods of use, and the measures taken by the applicant in animal experiments are: injecting the adeno-associated virus overexpressing the circular RNA into the spinal canal of mice. In clinical trials, the way to introduce the circular RNA into the body of the patient is limited, and the commonly used method is to inject the adeno-associated virus overexpressing the circular RNA into the spinal canal of the patient. Here, any technical means that can introduce the circular RNA into the body of the patient and have a therapeutic effect are suitable.

[0035] In still another embodiment, a pharmaceutical is provided, wherein the disease related to motor neuron injury is selected from any one of the following group: amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA).

[0036] In the context of the present specification, amyotrophic lateral sclerosis (ALS), also known as ALS, is a chronic and progressive neurological disease that mainly damages upper and lower motor neurons and the muscles of the trunk, limbs and head and face. The cause of this disease is not clear, which may be related to genetic factors, lifestyle, exposure to toxic substances, excessive physical labor, low body mass index, head trauma history, metabolic diseases, autoimmune dysfunction and other factors; the peak incidence usually occurs at the age of 45 or older, and the incidence in men is higher than that in women. The main clinical manifestations of amyotrophic lateral sclerosis are progressive skeletal muscle weakness, muscle atrophy, muscle bundle tremor and bulbar palsy, which will gradually worsen with the development of the disease, and even affect the respiratory muscles, leading to dyspnea. Patients may also experience symptoms such as numbness, limb paralysis, weight loss, arrhythmia, and may also face emotional problems such as depression and anxiety. Parkinson's disease, also known as "tremor paralysis", is a neurodegenerative disease. The main cause of this disease is the degeneration and death of dopaminergic neurons in the substantia nigra, which may be related to genetics, environmental factors and aging of the nervous system; it is recognized that aging is the most important factor in the occurrence of Parkinson's disease, and the disease has a significant old age high incidence, with a slightly higher incidence in men than in women; the symptoms of Parkinson's disease vary, mainly including motor and non-motor symptoms; motor symptoms include static tremor, muscle rigidity, motor retardation and posture balance disorders; non-motor symptoms mainly include constipation, olfactory dysfunction, sleep disorders, autonomic nervous dysfunction and mental and cognitive disorders. Spinal muscular atrophy (SMA), also known as progressive spinal muscular atrophy and spinal muscular atrophy, is a disease caused by degeneration of motor neurons in the anterior horn of the spinal cord and brainstem motor nuclei, leading to muscle weakness and muscle atrophy. It is an autosomal recessive genetic disease and is not uncommon in clinical practice. According to the age of onset and the severity of muscle weakness, it is clinically divided into three types: SMA-I, SMA-II and SMA-III, i.e. infantile type, intermediate type and juvenile type. The common feature is the degeneration of the anterior horn cells of the spinal cord, and the clinical manifestations are progressive, symmetrical, extensive flaccid paralysis and muscle atrophy mainly in the proximal limbs. Intelligence development and sensation are normal. The difference between each type is determined according to the age of onset, the rate of disease progression, the degree of muscle weakness and the length of survival. There is no specific and effective treatment for this disease, and the main treatment measures are to prevent or treat complications such as pneumonia, malnutrition, skeletal deformity, movement disorders and mental and social problems caused by severe muscle weakness.

[0037] In yet another specific embodiment, there is provided a medicament, wherein the patient is a mammal. Specifically, the mammal includes, but is not limited to, tiger, wolf, mouse, rat, mink, monkey, zebra, fox, bear, elephant, leopard, musk ox, lion, small panda, warthog, antelope, reindeer, koala, rhinoceros, lynx, giraffe, panda, anteater, orangutan, manatee, otter, civet, dolphin, walrus, hedgehog, polar bear, kangaroo, armadillo, hippopotamus, seal, whale, weasel, and common domestic animals and pets; specifically, the domestic animals include, but are not limited to, horse, cow, sheep, pig, chicken; specifically, the pets include, but are not limited to, cat, dog, hamster, rabbit.

[0038] The present application provides, in a second aspect, a pharmaceutical use of a specific circular RNA.

[0039] In one specific embodiment, there is provided a use of a circular RNA with circBank ID of hsa_circPTPRN2_018 in the preparation of a medicament for treating a disease associated with motor neuron injury.

[0040] In yet another specific embodiment, there is provided the above use, wherein the disease associated with motor neuron injury is selected from any one of the group consisting of amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA).

[0041] In yet another specific embodiment, there is provided the above use, wherein, in the preparation of a medicament for treating a disease associated with motor neuron injury, a suitable pharmaceutical carrier is used in addition to the circular RNA with circBank ID of hsa_circPTPRN2_018.

[0042] In one specific embodiment, there is provided the above use, wherein the pharmaceutical carrier is an adeno-associated virus.

[0043] In yet another specific embodiment, there is provided the above use, wherein the patient is a mammal.

[0044] The present application provides, in a third aspect, a method of administering a medicament.

[0045] In yet another specific embodiment, there is provided the method of administering a medicament as described above, wherein the medicament as described above is injected into the spinal canal of the patient; here, the "patient" can be an animal or a human being, which should be interpreted in a broad sense.

[0046] Examples

[0047] Example 1 Effect of circPTPRN2 on mitochondrial function (in vitro cell experiment):

[0048] ①Experimental supplies:

[0049] 1) Experimental materials: 35mm confocal dishes, sterile syringe tips, sterile centrifuge tubes, sterile pipettes.

[0050] 2) Cell culture reagents: DMEM / F-12 medium, Neurobasal medium, DMEM / F12, GlutaMax, AA, B27, N2, RA, SAG, BDNF, GDNF, IGF, Compound E.

[0051] 3) Mitochondrial dye: TMRM.

[0052] 4) Induction and drug screening reagents: doxy, puromycin, Bicyclomycin S0027 enhanced ATP detection kit.

[0053] 5) Instruments: CO2 cell incubator, biological safety cabinet, electric pipette, Olympus confocal microscope, microplate reader.

[0054] ②Experimental method: The construction and packaging of overexpression lentiviral vectors were completed by Jikai Company, the process includes: A) Preparation of overexpression lentivirus clone. Linearized vector was obtained by restriction enzyme digestion, PTPRN2 gene fragment was prepared by PCR amplification. The reaction system was prepared with linearized vector and target gene amplification product, and the recombination reaction was carried out to realize the in vitro circularization of linearized vector and target gene fragment. The recombination product was directly transformed, and the single colony on the plate was identified by PCR, and the positive clone was sequenced and the results were analyzed. The correct clone broth was expanded and extracted to obtain high-purity plasmid. B) Packaging lentivirus. Jikai uses a tool vector plasmid and two virus packaging auxiliary plasmids to co-transfect 293T cells. Virus collection of un-purified cell supernatant was carried out 48-72h after transfection, and high-titer overexpression CircPTPRN2 lentivirus stock solution was obtained by centrifugal contraction concentration purification. After obtaining, it was placed in-80 degree refrigerator and could be stored for one year.

[0055] 1) iPSCs overexpressing circPTPRN2 are obtained: The appropriate amount of lentivirus overexpressing circPTPRN2 and control lentivirus are prepared in advance, and divided into control lentivirus transfection group (NC-OE) and overexpression lentivirus transfection group (Circ-OE). After the ALS mutant iPSC cells are digested with dispase, they are washed twice with DF-12, then the medium is added, the target clone is gently blown off with a 200ul gun head, the clone is blown off with a 1ml gun head, and the gun head is first wetted with DF-12 to avoid the clone sticking to the gun head wall, and then 10ul of trypan blue is mixed for counting. According to the instructions, the amount of cells infected in a 6-well plate is 200,000, so the cells are divided into corresponding amounts, NC-OE at least two holes, Circ-OE at least two holes.

[0056] Then the cell suspension is transferred to a clean EP tube, 250ul / tube. Add the corresponding virus amount 6.67ul, this time the NC multiplicity of infection (MOI) is 5, the circ multiplicity of infection (MOI) is 5, after adding the virus, add 750ul of medium and mix gently, then cover the lid and put it in the incubator for half an hour. After half an hour, take out the EP tube and add the cells to each well of the 6-well plate, and add Rho 1ul per well.

[0057] After transfection for 72h, add puromycin 1.5ug / ml for drug screening, continue to screen for three days, then expand the remaining iPSC clones, add doxy for induction for one day, then observe the expression of GFP under a microscope to determine whether the transfection is successful. The iPSC stable transfection strain stably overexpressing CircPTPRN2.

[0058] 2) Differentiate iPSC overexpressing CircPTPRN2 into mature motor neurons. Human iPSCs are directionally differentiated into neuroepithelial cells (NEP) in vitro, the small molecules in NEP medium are DMH1 (2 mM) + SB431542 (2 mM) + CHIR99021 (3 mM); NEP is directionally differentiated into spinal MNP in vitro, the small molecules in MNP medium are DMH1 (2 mM) + SB431542 (2 mM) + CHIR99021 (1 mM) + RA (0.1 mM) + SAG (0.5 mM); spinal motor neuron progenitor cells are directionally differentiated into post-mitotic spinal motor neurons in vitro, the motor neuron progenitor cells are resuspended after digestion for suspension culture, the small molecules in MN medium are RA (0.5 mM) + SAG (0.1 mM), MNP is directionally differentiated into post-mitotic motor neurons after 7 days, and after adhering, it specifically expresses Hb9 and Tuj1; maturation of spinal motor neurons, the step of coating a 24-well plate with matrigel on ice and overnight; prepare MN maturation medium in the dark, the medium is the same as the MN medium (4.7 mL DMEM / F12 + 4.8 mL Neurobasal + 0.05 mL N2 + 0.1 mL B27 + 0.1 mL AA + 0.1 mL Glutamax + 0.1 mL P / S + 5 uL RA (0.5 mM) + 1 uL SAG (0.1 mM), but Compound E (0.5 mM) needs to be added for the first 3 days, the MN balls on the 19th day of differentiation are digested into single or several cells with Accutase, and are seeded in a matrigel-coated 24-well plate, which is cultured at 37°C, 5% CO2, after 3 days, Compound E is removed, and the culture is continued for 7 days (equivalent to a total of 10 days); post-mitotic neurons are not mature, under the action of the notch signal inhibitor Compound E, post-mitotic motor neurons adhere to the culture plate for 10 days to mature, and specifically express Chat and Map2. MN adheres to the culture plate coated with matrigel, and doxy (1 mg / ml) is added on the third day to induce the expression of CircPTPRN2. Mature motor neurons overexpressing CircPTPRN2 can be obtained on the 10th day after adhering. The overexpression efficiency of CircPTPRN2 is verified by RT-qPCR.

[0059] 3) Staining of mitochondrial membrane potential of live motor neurons. Four groups of motor neurons are obtained according to the above differentiation steps, which are ALS SOD1 mutant D90A group (referred to as D90A MN) and mutant gene correction D90D group (referred to as D90D MN), transfection control lentivirus group (referred to as NC-OE MN), and CircPTPRN2 overexpression group (referred to as Circ-OE MN).

[0060] TMRM dye was used to label mitochondrial membrane potential, and the TMRM dye reagent was prepared by taking an appropriate amount of DMSO and TMRM stock solution to 200 nM. 1 μl of TMRM was taken and added to a 1 ml confocal dish containing motor neurons, and then incubated in a 37 degree incubator for half an hour. Then the culture medium was aspirated and washed with DF-12, and fresh medium and a small amount of TMRM dye were added to a final concentration of 25 nM, and then placed back in the incubator for 10 minutes. The dyed confocal dish was placed under a confocal microscope for observation and photography, and the laser excitation wavelength was set to 594. The fluorescence intensity of D90D MN, D90A MN, OE-NC MN, and OE-Circ MN groups was counted using ImageJ.

[0061] 4) Evaluation of motor neuron ATP production. After D90D MN, D90A MN, OE-NC MN, and OE-Circ MN were plated on 24-well plate slides for 13 days, the ATP production level was detected. The reagents for detection were prepared in advance on ice, including ATP detection working solution and ATP standard solution with multiple concentration gradients as standard. After the formal detection started, the motor neuron culture medium was aspirated, and 80 μl of lysis solution was added to each well to lyse the cells. To ensure complete lysis, the lysis solution can be repeatedly blown or shaken to fully contact and lyse the cells. After lysis, centrifuge at 12000g for 5 minutes at 4°C, and take the supernatant as the sample of each group. Add 100 μl of ATP detection working solution to the detection well or tube. Place at room temperature for 3-5 minutes to consume all the background ATP, thereby reducing the background. Add 20 μl of sample or standard to the detection well or tube, mix quickly with a gun (micropipette), and at least 2 seconds later, measure the RLU value or CPM with a luminometer or liquid scintillation counter. At the same time, the protein concentration of each group was detected by protein concentration kit.

[0062] According to the standard curve and the protein concentration of each group, the normalized ATP concentration of D90D MN, D90A MN, OE-NC MN, and OE-Circ MN samples was calculated.

[0063] ③ Experimental results:

[0064] Figure 1 The iPSC adhesion of each group after drug screening is shown.

[0065] The iPSC adhesion of Circ group transfected with overexpression lentivirus, NC group transfected with control lentivirus, and D90A group transfected with virus after adding puromycin for 72 hours is shown in the figure. It can be seen that both Circ group and NC group have cell survival, while the blank group D90A has no cell survival, indicating that the drug screening is successful.

[0066] Figure 2 The transfection efficiency of motor neurons is verified.

[0067] Figure A shows the GFP expression of D90D MN, D90A MN, OE-NC MN, and OE-Circ MN 4 groups. It can be seen that the motor neurons of NC-OE and Circ-OE groups have GFP expression, indicating that the lentivirus is successfully transfected into the motor neurons. Figure B shows the mRNA expression level of circPTPRN2 in each group detected by RT-qPCR, wherein the overexpression efficiency of the Circ-OE MN group is significantly higher than that of each of the other groups.

[0068] Figure 3 The mitochondrial membrane potential of each group of motor neurons is shown.

[0069] The left graph shows that TMRM stains the mitochondria in the living cells of D90D MN, D90A MN, NC-OE MN, and Circ-OE MN. The fluorescence intensity of the mitochondria in the MN axons is evaluated by taking pictures with a microscope to reflect the level of mitochondrial membrane potential. The right graph is a statistical analysis graph. It can be seen from the graph that the mitochondrial membrane potential of Circ-OE MN is significantly higher than that of D90A MN and NC-OE MN, indicating that CircRNA PTPRN2 can improve the decrease of mitochondrial membrane potential of D90A MN.

[0070] Figure 4 The ATP generation of each group of motor neurons is shown.

[0071] By detecting and counting the ATP level of each group of motor neurons, it can be seen that the ATP level of the Circ-OE group is significantly higher than that of each of the other groups, indicating that overexpression of circRNA PTPRN2 can improve the ATP generation of D90A MN.

[0072] The above results are summarized: mitochondria are the energy centers of cells, responsible for producing most of the energy molecules required by cells, adenosine triphosphate (ATP). Mitochondrial dysfunction can lead to decreased energy production, increased oxidative stress, mitochondrial DNA damage, and other phenotypes, resulting in impaired function of cells and tissues. Mitochondrial dysfunction has been reported in several articles as a feature of neurodegenerative diseases, including ALS. Mitochondrial dysfunction can be defined as: decreased mitochondrial respiratory capacity, decreased mitochondrial membrane potential, increased generation of oxygen free radicals, and abnormalities in mitochondrial mass and oxidative phosphorylation. In this patent, overexpression of circPTPRN2 can alleviate some mitochondrial dysfunction, including increasing the mitochondrial membrane potential and ATP generation of ALS MN, thereby becoming a possible treatment strategy for ALS.

[0073] Alternative:

[0074] In the above-mentioned step 2), the matrigel-coated glass slides for motor neurons can be replaced with plo and laminin-coated, and the specific experimental procedures are as follows:

[0075] After placing sterile glass slides in a 24-well plate, add 80ul plo (0.1mg / ml), and place in a 37°C, 5% CO2 incubator for coating overnight. The next day, remove the plate and discard the plo, wash with sterile BI water for 2-3 times, then add 50ul laminin per well, and place in a 37°C, 5% CO2 incubator for coating for 2 hours. Then add the motor neuron pellet suspension to the glass slides, and place in a 37°C, 5% CO2 incubator for adhesion. After 1 hour, remove the cell plate and add freshly prepared MN medium 500ul / well, then change the medium every other day. After 10 days, mature motor neurons are obtained.

[0076] Example 2 Intrathecal injection of AAV overexpressing CircPTPRN2 prolongs the survival of ALS mice (in vivo experiment using mice)

[0077] ① Experimental supplies:

[0078] 1) Experimental materials: 25ul microsyringe

[0079] 2) Experimental reagents: 3% sodium pentobarbital, PBS, overexpression of circPTPRN2 adeno-associated virus, control adeno-associated virus

[0080] ② Experimental method:

[0081] 1) Obtain AAV overexpressing circPTPRN2.

[0082] A) First prepare the circPTPRN2 adeno-associated virus clone. The steps are the same as "lentivirus preparation". That is, linearize the vector by restriction enzyme digestion, amplify the PTPRN2 gene fragment by PCR, prepare the reaction system with the linearized vector and the amplified gene fragment, and perform recombination to realize in vitro circularization of the linearized vector and the gene fragment. The recombinant product is directly transformed, and the single colony on the plate is identified by PCR. The positive clone is sequenced and the results are analyzed. The correct clone is cultured and extracted to obtain high-purity plasmid.

[0083] B) Adeno-associated virus packaging. The company uses GV series AAV9 vector, pHelper vector and pAAV-RC vector to constitute AAV Helper-Free System three plasmid system to co-transfect HEK 293T cells. Virus harvesting (i.e. unpurified cell supernatant and cell precipitate) is performed 72h after transfection, and high-purity overexpression CircPTPRN2 AAV9 virus stock solution is obtained by gradient density centrifugation. After obtaining, it can be placed in a -80 degree Celsius refrigerator for one year.

[0084] 2) Intrathecal injection: 24h before intrathecal injection, the mice were fasted but not watered. The body weight of the mice was measured and recorded using an electronic scale before the operation. Anesthesia was performed by intraperitoneal injection of 3% sodium pentobarbital (0.5ml / 100g). The mice were considered to be successfully anesthetized when they showed no response to tail pinching or footpad and corneal reflex was lost. Sterile operation was performed during the operation, and the environmental temperature was controlled at about 28°C. The anesthetized mice were fixed on the operating table in a prone position, and the limbs were fixed with adhesive tape. The hair at the lumbar vertebrae site was removed with an electric shaver, and the pink skin was exposed. The right hand held forceps dipped in alcohol cotton ball gently wiped the skin of the lumbar vertebrae. A knife blade was used to slowly cut 1.5-2.0cm along the lumbar vertebrae, and the skin was slowly pushed away until the lumbar vertebrae process was fully exposed. The non-dominant hand of the experimenter fixed the head and upper body of the mouse, and the iliac crest hip was firmly fixed with the thumb and index finger, so as to accurately position later. The processus spinosus of L6 was used as a positioning marker (the most prominent processus spinosus of the mouse), and a micropipette (25μl) was used to puncture at the center point between L5 and L6 segments. After piercing the skin, the experimenter could feel the micropipette "sliding into" between the vertebrae. At this time, the needle insertion speed should be slowed down as much as possible. After continuing to enter a few millimeters, the mouse's tail would appear to be flicked or appear "S" shape swing, which was considered to be a sign of successful puncture. Then, a total volume of 10μl of adeno-associated virus was injected into the subarachnoid space at a constant rate of 10μl / min (no more than 10μl for a single injection). After that, the syringe was rotated out to complete the intrathecal injection of the mouse.

[0085] 3) Observe the state of the mouse, change the cage, bedding and water every week, and record the survival time of the mouse

[0086] 4) The end of the experiment: when the motor function of the ALS mouse degenerates seriously and the mouse cannot stand up within 30 seconds of lateral recumbency, the mouse is sacrificed.

[0087] ③ Experimental results:

[0088] Figure 5 The survival time of each group of mice is shown.

[0089] By comparing and analyzing, it is concluded that the median survival time of the mice injected with overexpression circPTPRN2 adeno-associated virus is longer than that of the mice injected with PBS and the mice injected with control adeno-associated virus. G93AMice were prolonged for 21 days and 19 days (SOD G93A - PBS vs SOD G93A - circPTPRN2 P<0.01; SOD G93A - NC vs SOD G93A - circPTPRN2 P<0.05). It is suggested that the overexpression of circPTPRN2 in ALSSOD G93A Intrathecal delivery of overexpression of circPTPRN2 adeno-associated virus can significantly prolong the survival of mice.

[0090] Although the embodiments of the present application are described above with reference to the drawings, the present application is not limited to the specific embodiments and application fields described above, and the specific embodiments described above are merely illustrative and instructive, but not restrictive. Those skilled in the art can make many forms under the inspiration of the present specification and without departing from the scope protected by the claims of the present application, which all belong to the protection of the present application.

Claims

1. A medicament for treating a disease associated with motor neuron impairment in a subject, the medicament comprising: The circRNA with circBank ID hsa_circPTPRN2_018 and a suitable pharmaceutical carrier.

2. The medicament of claim 1, wherein, The pharmaceutical carrier is an adeno-associated virus.

3. Use of the circular RNA with circBank ID hsa_circPTPRN2_018 in the preparation of a medicament for treating a disease associated with motor neuron injury in a subject; wherein, The disease associated with motor neuron injury is amyotrophic lateral sclerosis (ALS).

4. The use of claim 3, wherein, In the preparation of a drug for treating a disease associated with motor neuron injury, the circRNA with circBank ID hsa_circPTPRN2_018 is used in addition to a suitable pharmaceutical carrier.

5. The use of claim 4, wherein, The pharmaceutical carrier is an adeno-associated virus.

6. The use of claim 4, wherein, The patient is a mammal.

Images