An endophytic Cladosporium sp. HNU21 and its applications
By spraying spores of HNU21 from plant endogenous clots HNU21 on Northeast yew seedlings, promoting the biosynthesis of paclitaxel and the expression of synthesis-related genes, the problem of difficulty in increasing the paclitaxel content in Northeast yew in the prior art was solved, and a significant increase in paclitaxel content was achieved, providing a sustainable solution to the problem of insufficient drug sources.
Patent Information
- Application Number
- CN202411631908.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2044-11-15
AI Technical Summary
The existing technology is difficult to effectively increase the content of paclitaxel in Northeast yew, and the traditional extraction methods are unsustainable and cannot meet market demand.
Provide a plant endophytic cerevisia HNU21 and its application. By spraying the spore liquid of HNU21 on Northeast yew seedlings, it promotes the biosynthesis of paclitaxel and the expression of synthesis-related genes.
The paclitaxel content in the leaves of Northeast yew has been significantly improved to reach more than 1.5 times, providing an effective solution to the problem of insufficient drug sources.
Smart Images

Figure CN119144465B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microbial technology and relates to a plant endophytic Cladosporium sp. HNU21 and its application. Background Art
[0002] Plant endophytes are fungi or bacteria that live inside the tissues and organs of plants at certain stages or throughout their entire life cycles. They are widespread in higher plants, including woody and herbaceous plants, monocotyledons and dicotyledons. Endophytic bacteria have been utilized as potential microbial pesticides, yield-increasing bacteria, or potential biocontrol carrier bacteria in biological control.
[0003] Among them, endophytic fungi play an important role in the growth and development of medicinal plants. They can produce regulator substances required for plant growth, enhance the absorption of trace elements by plants, and promote plant growth and development. In addition, endophytic fungi can also improve the physiological activity indexes and stress resistance of host plants, including resistance to biotic and abiotic stresses. In terms of the regulation of secondary metabolites and active substances in medicinal plants, endophytic fungi directly or indirectly affect the distribution and content of active substances in medicinal plants by influencing and regulating the synthesis, content, and accumulation of secondary metabolites in medicinal plants.
[0004] Extracting endophytic fungi from plants is of great significance for understanding the interaction between endophytic fungi and plants and exploring new drug components. For example, paclitaxel is a precious anti-cancer drug extracted from Taxus plants, with significant therapeutic effects; however, Taxus grows slowly and is an endangered species, and traditional extraction methods are not sustainable. The increasing market demand has made it urgent to find alternative production methods. Therefore, scientists have begun to explore methods for fermenting paclitaxel using endophytic fungi to solve the problem of insufficient drug sources. Summary of the Invention
[0005] The purpose of the present invention is to provide a plant endophytic Cladosporium sp. HNU21 and its application in view of the deficiencies of the prior art.
[0006] In the first aspect, the present invention provides an endophytic fungus isolated and purified from the Taxus cuspidata Sieb. et Zucc. of the genus Taxus, taxonomically named Cladosporium sp. Cladosporium sp. HNU21, the preservation number of this strain is CCTCC NO: M2024232, the preservation date is January 26, 2024, and the preservation unit is the China Center for Type Culture Collection (CCTCC), and the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province; its ITS sequence is as shown in SEQ ID NO.1.
[0007] In a second aspect, the present invention provides a cell culture, cell metabolite, cell culture supernatant or cell lysate of the above-mentioned endophytic Cladosporium sp. HNU21.
[0008] In a third aspect, the present invention provides a composition for increasing the content of paclitaxel in Taxus cuspidata leaves, which comprises components selected from the following group: the above-mentioned endophytic Cladosporium sp. HNU21; or the above-mentioned cell culture, cell metabolite, cell culture supernatant or cell lysate.
[0009] In a fourth aspect, the present invention provides an application of the above-mentioned endophytic Cladosporium sp. HNU21, which can increase the content of paclitaxel in Taxus cuspidata leaves and the expression level of key genes in the paclitaxel synthesis pathway.
[0010] Further, the application specifically is: spraying the spore solution of endophytic Cladosporium sp. HNU21 on Taxus cuspidata seedlings, thereby achieving an increase in the content of paclitaxel in Taxus cuspidata needles;
[0011] The spore solution is prepared by the following steps: inoculating endophytic Cladosporium sp. HNU21 into a PDA solid medium (Potato Dextrose Broth), culturing in an incubator at a temperature of 25 - 30 °C for 5 - 7 days, waiting for spores to generate, and obtaining a spore-containing solution by vacuum filtration, which is the spore solution.
[0012] The beneficial effects of the present invention are as follows:
[0013] The present invention provides an endophytic Cladosporium sp. HNU21, and the plant is Taxus cuspidata. This bacterium can be used to promote the biosynthesis of paclitaxel components and the expression of related synthesis genes in Taxus cuspidata, increase the content of paclitaxel, and thus provide an effective solution to the problem of insufficient drug sources, with high application value; at the same time, the present invention also provides a cell culture, cell metabolite, cell culture supernatant or cell lysate of endophytic Cladosporium sp. HNU21, as well as a method for preparing a spore solution containing endophytic Cladosporium sp. HNU21. By spraying the filtered spore solution on the twigs of Taxus cuspidata seedlings, the synthesis of paclitaxel can be effectively promoted. Compared with the existing fungal elicitors, the spore solution of the endophytic Cladosporium sp. HNU21 of the present invention can increase the content of paclitaxel by more than 1.5 times, with good application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 : Fungi of the genus Cladosporium Cladosporium sp. Colony morphology of HNU21 on a solid medium.
[0015] Figure 2 : Fungi of the genus Cladosporium Cladosporium sp. Mycelium and spore morphology of HNU21 under an optical microscope.
[0016] Figure 3 : Fungi of the genus Cladosporium Cladosporium sp. Agarose gel electrophoresis map of the ITS sequence of HNU21
[0017] Figure 4 : Fungi of the genus Cladosporium Cladosporium sp. Phylogenetic tree of HNU21
[0018] Figure 5 : Fungi of the genus Cladosporium Cladosporium sp. Histogram of the increase in taxol content in Taxus cuspidata leaves infected by HNU21
[0019] Figure 6 : Genes related to taxol synthesis in Taxus cuspidata Cladosporium sp. Expression level differences under the treatment of HNU21 Specific implementation mode
[0020] The following combines examples to make a detailed description of the specific implementation mode provided by the present invention
[0021] Example 1: Cladosporium sp. Isolation, identification and preservation of HNU21:
[0022] Endophytic fungi are obtained according to the following steps:
[0023] (1) Rinse the healthy two-year-old stem segments of Taxus cuspidata freshly picked under tap water for 30 minutes to remove the soil on its surface, dry the surface moisture of the stem segments with filter paper, and put them into a clean workbench. Immerse the stem segments in 75% alcohol solution for 1 minute, and continuously shake the beaker during this period to ensure full contact between the Taxus tissue and alcohol. After disinfection, wash the stem segments three times with sterile water to remove the residual alcohol on the surface. Then place the stem segments in 0.1% mercuric chloride solution for 5 minutes, place the plant materials in a clean beaker and wash 4 to 5 times to remove the residual mercuric chloride on the tissue surface. To verify whether the disinfection is thorough, take 100 μL of the last washed sterile water and coat it as a control. If there is no growth of miscellaneous bacteria after culturing for 3 - 5 d at 26°C, it is considered that the disinfection is effective
[0024] (2)Use a scalpel to peel the disinfected stem segments, and cut the stem bark into small pieces of 5 mm; lay the processed plant materials flat on the PDA medium (Potato Dextrose Agar medium, containing: 200.0 g / L of potato, 50.0 g / L of glucose, 6.0 g / L of NH4NO3, 0.3 g / L of anhydrous MgSO4, 0.5 g / L of KH2PO4, 0.05 g / L of vitamin B1). Place five pieces of materials in each petri dish and culture them at a constant temperature of 26°C in the dark. Mycelia will grow from the tissue blocks after three to seven days of culture. Transfer to a new PDA plate with an inoculation needle from the edge of the stem bark wound every 12 hours after inoculation. Observe the phenotypic characteristics of the transferred fungal colonies, pick the mycelia at the edge of a single colony, streak and culture on a new PDA plate. After continuous purification 3 times, pick a small amount of mycelia and observe under a microscope. If there are no contaminants, it can be considered a single strain. After obtaining a single strain, inoculate it on a PDA slant and store it at 4°C. As Figure 1 shown, the solid culture characteristics of HNU21 are gray fluffy colonies. The morphological characteristics under the microscope are gray mycelia with branches, as Figure 2 shown.
[0025] (3)Extract the DNA of the endophytic fungal strain of Taxus cuspidata Sieb. et Zucc. var. nana Rehd. using the TIANGEN plant genomic DNA extraction kit, and use this as a template to amplify the ITS sequence. The primers are ITS4 (see SEQ ID NO.2) and ITS5 (see SEQ ID NO.3). The PCR (Polymerase Chain Reaction) reaction system is 2×Taq MasterMix (Dye), 25 μL; ITS5 (10 μM), 2 μL; ITS4 (10 μM), 2 μL; Template DNA, 3 μL; ddH2O, 18 μL. The PCR reaction program is pre-denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, and the denaturation-annealing-extension cycle is 30 times, and final extension at 72°C for 2 min. Detect whether the amplification is successful by 1% agarose gel electrophoresis. Send the successful PCR product to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The gel electrophoresis pattern of the PCR product amplified from the ITS sequence of HNU21 is as Figure 3 , and the sequenced sequence is as shown in SEQ ID NO.1. Use the NCBI website to compare the sequencing results, and the similarity with the known Cladosporium crousii NR_148192 is 99.44%.
[0026] SEQ ID NO.1: gaaaactgcggagggatcattacaagtgaccccggtctaaccaccggggatgttcataaccctttgttgtccgactctgttgcctccggggcgaccctgccttcgggcgggggctccgggtggacacttcaaactcttgcgtaactttgcagtctgagtaaacttaattaataaattaaaacttttaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccccctggtattccggggggcatgcctgttcgagcgtcatttcaccactcaagcctcgcttggtattgggcaacgcggtccgccgcgtgcctcaaatcgaccggctgggtcttctgtcccctaagcgttgtggaaactattcgctaaagggtgttcgggaggctacgccgtaaaacaaccccatttctaaggttgacctcggatcaggtagggatacccgctgaacttaagcatatcaataa
[0027] SEQ ID NO.2:
[0028] 5’-TCCTCCGCTTTATTGATATGC-3’
[0029] SEQ ID NO.3:
[0030] 5’-GGAAGTAAAGTCGTAACAAGG-3’
[0031] Example 2: Construction and Analysis of the Homologous Phylogenetic Tree of the Endophytic Fungus HNU21 from Taxus cuspidata Sieb. et Zucc.
[0032] Using the ITS sequence of the endophytic fungus HNU21 as the target sequence, homologous sequences were searched in the GenBank database of NCBI. The sequence most similar to the ITS sequence of the endophytic fungus HNU21 was downloaded as the reference sequence. A phylogenetic tree was constructed using the neighbor-joining (NJ) method. One sequence was randomly selected and aligned 1000 times repeatedly to determine the phylogenetic position of the endophytic fungus HNU21 strain. The phylogenetic tree is as Figure 4 shown.
[0033] Example 3: Preparation and Application of Spore Solution of Endophytic Fungus HNU21 from Taxus cuspidata Sieb. et Zucc. var. nana Rehd.
[0034] (1) The following operations are carried out in a laminar flow hood: Use an inoculation needle to pick a HNU21 bacterial block about 5 mm×5 mm in size preserved on an inclined plane, invert it on a V8 medium (V8 juice medium, V8 Juice Agar, where V8 juice includes tomatoes, carrots, watercress, lettuce, celery, spinach, beetroot, celery), and culture it at a constant temperature of 26°C in the dark for 5 - 7 days until the fungus produces spores. Add 2 mL of sterile water to the solid plate, scrape the HNU21 mycelium and spores with a spreader to obtain a mixed solution. Fold three layers of gauze into a funnel shape, and filter the mixed solution at the ninth layer to obtain a spore solution. Count the spores under an optical microscope, and adjust the concentration of the obtained fungal spore solution to 1×10 6 cells / mL for standby.
[0035] (2) Lay a wet sterile filter paper in a tray, cut about 20 cm long Taxus cuspidata Sieb. et Zucc. var. nana Rehd. stems and leaves of similar age, wash them 2 - 3 times with sterile water, and place the lower epidermis of the leaves upward on the filter paper. Evenly spray 20 mL of the fungal spore solution onto the leaf surface, and spray an equal amount of sterile water on the control group. Wrap the tray with plastic wrap, let it stand for 48 h, then cut the leaves, wash them with sterile water, quickly freeze them in liquid nitrogen, and store them in a -80°C refrigerator for standby.
[0036] Example 4: Effect of Endophytic Fungus HNU21 on the Paclitaxel Content in Taxus cuspidata Sieb. et Zucc. var. nana Rehd. Leaves
[0037] (1) Pre-cool all extraction reagents at -20°C before use. Weigh 60 mg of leaves into a 1.5 mL centrifuge tube, add an appropriate amount of small steel beads and 600 μL of methanol-water (V:V = 7:3, containing a mixed internal standard, 4 μg / mL); pre-cool in a -40°C refrigerator for 2 min, then put it into a grinder and grind at 60 Hz for 2 min; ultrasonically extract in an ice-water bath for 30 min, and let it stand overnight at -40°C; centrifuge at 12000 rpm at low temperature for 10 min, suck 150 μL of the supernatant with a syringe, filter it through a 0.22 μm organic phase needle filter, transfer it to an LC injection vial, and store it at -80°C for standby; Mix the extraction solutions of all samples in equal volume to prepare a quality control sample (QC).
[0038] (2)The sample was detected using a Waters ACQUITY UPLC I-Class plus ultra-high performance liquid chromatography tandem high-resolution mass spectrometer. Chromatographic conditions: Chromatographic column: ACQUITY UPLC HSS T3 (100 mm × 2.1 mm, 1.8 μm); Column temperature: 45 °C; Mobile phase: water (containing 0.1% formic acid), acetonitrile; Flow rate: 0.35 mL / min; Injection volume: 3 μL; Elution gradient: At 0 min, the volume ratio of water to acetonitrile was 95:5, at 4 min it was 70:30, at 8 min it was 50:50, at 10 min it was 20:80, at 14 min it was 0:100, and at 15.1 min it was 95:5. The separated sample was subjected to mass spectrometry analysis. Mass spectrometry conditions: The sample mass spectrometry signal acquisition was performed by separate scanning of positive and negative ions, and the specific acquisition mode was the DDA (data dependent acquisition) data-dependent scanning mode.
[0039] (3)The transition between the mass-to-charge ratio (m / z) of 876.4 → 308.1 was used for the quantitative analysis of paclitaxel, and the transitions between the mass-to-charge ratio (m / z) of 876.4 → 531.2 and 876.4 → 591.4 were used for the verification analysis of paclitaxel. The paclitaxel (≥99%; CAS: 33069-62-4) standard was purchased from Aladdin Biochemical Technology (Shanghai, China) Co., Ltd. The differences in the paclitaxel content of Taxus cuspidata under the treatment of endophytic fungus HNU21 were as Figure 5 shown, where CK was the control group and HNU21 was the experimental group.
[0040] Example 5: Effects of endophytic fungus HNU21 on the expression levels of genes related to paclitaxel synthesis in Taxus chinensis leaves
[0041] (1)The total RNA of the HNU21 experimental group and the control group was extracted using the TIANGEN RNAprep Pure Plant Kit. After passing the quality inspection, transcriptome library construction and sequencing were carried out. The integrity of the total RNA of the sample was detected using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and a transcriptome library was constructed using the VAHTS Universal V5 RNA-seq Library Prep kit. The library was sequenced using the Illumina Novaseq 6000 sequencing platform to generate 150 bp paired-end reads; the fastp software was used for processing to obtain clean reads for subsequent data analysis.
[0042] (2)Perform genome alignment of Taxus using HISAT2 software and calculate gene expression levels (FPKM), and obtain read counts for each gene through HTSeq-count; use R (v 3.2.0) to perform PCA analysis and plotting on the samples to evaluate biological replicates of the samples. Use DESeq2 software to perform differential expression gene analysis, and define differentially expressed genes (DEGs) as genes that meet the thresholds of P value < 0.05 and fold change > 2 or fold change < 0.5.
[0043] (3)The genes related to Taxus paclitaxel synthesis to be detected and their IDs are: TS (ctg5306_gene.4), TS (ctg7747_gene.1), T13OH (ctg593_gene.12), TBT (ctg4165_gene.7), T5OH (ctg11276_gene.1), DBTNBT (ctg195_gene.25), and T7OH (ctg12564_gene.1). The differences in the expression levels of Taxus chinensis var. mairei genes related to paclitaxel synthesis under the treatment of endophytic fungus HNU21 are as Figure 6 shown.
Claims
1. A plant endophytic Cladosporium HNU21, characterized in that Its taxonomic name is Cladosporium ( Cladosporium sp. ), the strain name is HNU21, the preservation number is CCTCC NO: M2024232, the preservation date is January 26, 2024, the preservation unit is China Center for Type Culture Collection, and the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.
2. A composition for increasing the paclitaxel content in leaves of Taxus cuspidata, characterized in that: The invention comprises: the spore liquid of the plant endophytic Cladosporium HNU21 according to claim 1.
3. Use of the plant endophytic Cladosporium HNU21 according to claim 1 in increasing the paclitaxel content in leaves of Taxus cuspidata.
4. The use according to claim 3, characterized in that: The spore liquid of the plant endophytic Cladosporium HNU21 was sprayed on the seedlings of Taxus cuspidata; The spore liquid is prepared as follows: plant endophytic Cladosporium HNU21 is inoculated into a PDB solid culture medium, cultured in an incubator at 28° C. for 5 to 7 days, and after spores are generated, the spore liquid is obtained by vacuum filtration.
Citation Information
Patent Citations
Taxol-producing Cladosporium cladosporioides and method for preparing taxol by using the same
CN101486972A
Taxol production by a microbe
US6329193B1