Construction method and application of high-yield succinic acid escherichia coli

Abstract

The invention discloses a construction method and application of high-yield succinic acid escherichia coli, and belongs to the technical field of bioengineering. According to the invention, a glucose transporter gene ptsG in escherichia coli is replaced by a homologous gene from corynebacterium glutamicum, and the expression of a glutamate decarboxylase dependent acid-resistant system gadBC is up-regulated, so that the acid resistance of the strain is enhanced. And by optimizing the RBS sequence and the promoter, accurate regulation and control on ptsG and gadBC systems are realized. The recombinant Escherichia coli constructed by the invention does not need antibiotic resistance genes, and shows good low-pH environment resistance and efficient succinic acid production characteristics. A two-stage fermentation strategy is adopted, the succinic acid yield can reach 104.23 g / L within 36 hours, the succinic acid yield reaches 0.90 g / g glucose in the whole stage, the production intensity is 2.89 g / L / h, and the method has remarkable industrial production potential.

Description

Technical Field

[0001] The invention relates to a construction method of high-succinic acid-producing Escherichia coli and application thereof, belonging to the technical field of bioengineering. Background Art

[0002] Succinic acid, also known as butyric acid, is an important C4 platform compound. It is widely present in nature and is an intermediate product in the metabolic pathways of many organisms. Succinic acid and its derivatives are widely used in the fields of chemical industry, medicine, food and agriculture. Succinic acid is listed as the first of the 12 most promising bulk bio-based chemicals by the U.S. Department of Energy.

[0003] Traditional succinic acid production mainly relies on chemical synthesis methods, including paraffin oxidation, methyl chloroacetate cyanide hydrolysis, and vanadium pentoxide catalytic hydrogenation. However, with the increasing scarcity of petroleum resources and the intensification of environmental pollution problems, the shortcomings of these chemical synthesis pathways have gradually been exposed. As an alternative, the production of succinic acid through microbial fermentation can not only reduce dependence on non-renewable resources such as petroleum, but also utilize renewable resources, which helps to fix carbon dioxide and thus mitigate the greenhouse effect, showing great development potential.

[0004] At present, researchers have explored a variety of microbial strains for the production of succinic acid, mainly including succinic acid-producing Actinobacillus, succinic acid-producing Anaerobic Spirillum and Escherichia coli. Succinic acid-producing Actinobacillus can tolerate higher concentrations of succinate. Among them, Guettler M et al. achieved a high yield of 110 g / L in 48 hours using glucose as a raw material by using the mutant strain FZ53. Despite this, research on the physiological characteristics, fermentation performance and genetic background of this strain is relatively limited and needs to be further deepened. Succinic acid-producing Anaerobic Spirillum can utilize a variety of fermentation substrates, such as glucose, lactose and glycerol. The research of Samuelov et al. showed that under optimal conditions, the strain can achieve a yield of 1.2 mol succinic acid / 1.0 mol glucose, with a maximum yield of 65.0 g / L. However, since the fermentation process of this strain requires strict anaerobic conditions, this may face challenges in industrial applications. As a thoroughly studied model strain, Escherichia coli has a clear genetic background and is easy to genetically manipulate, making it a research hotspot for fermentation succinic acid production. For example, Li Jiaojiao et al. used Escherichia coli YL104H to achieve a succinic acid concentration of 61.66 g / L and a production intensity of 0.95 g / L / h through two-stage fermentation for 65 h. Vemuri et al. used recombinant Escherichia coli AFP111 to achieve a succinic acid concentration of 99.2 g / L and a yield of 1.1 g / g glucose and a production intensity of 1.3 g / L / h through two-stage fermentation for 76 h. Zhang Xueli et al. constructed recombinant Escherichia coli HX024 through genetic engineering and adaptive evolution strategy, and used a one-step anaerobic fermentation for 96 h, with a final yield of 95.9 g / L and a yield of 1 g / g glucose. Zhu Liwen et al. strengthened the CO2 fixation pathway by optimizing the expression of ppc and pck genes, so that the recombinant Escherichia coli AFP111 strain produced 90.7 g / L succinic acid after 96 h of fermentation. Zhang Jianguo and his colleagues optimized the glucose absorption metabolic pathway and knocked out the gene encoding the byproduct acetic acid, achieving a succinic acid yield of 98.92 g / L after 65 h of fermentation. Tang Wenxiu and his colleagues knocked out the byproduct gene and overexpressed a specific enzyme gene through a plasmid, achieving a succinic acid yield of 137 g / L after 96 h of fermentation.

[0005] Studies have shown that the production of succinic acid using microbial fermentation technology has significant application potential and advantages, especially in terms of increasing yield, improving production efficiency and optimizing production processes. However, there are several technical bottlenecks in the current production of succinic acid using Escherichia coli: the fermentation cycle is long, and long-term anaerobic conditions lead to increased cell mortality and reduced sugar-acid conversion rates; in addition, in order to maintain pH stability during the fermentation process, a large amount of neutralizers need to be added, which not only increases production costs, but also increases the cost of product separation and purification. Therefore, the development of strains with the ability to rapidly produce succinic acid is crucial to shortening the fermentation cycle. Summary of the invention

[0006] To solve the above problems, the present invention provides a method for constructing a recombinant Escherichia coli with high yield of succinic acid at a relatively low pH and its application. The glucose transporter ptsG from Corynebacterium glutamicum is introduced into the host bacteria FMME-N-5, and its promoter and RBS are optimized to accelerate the glucose utilization rate. At the same time, CRISPR-cas9 gene editing technology is used to overexpress the glutamate-dependent acid-resistant system gadBC, and its promoter, RBS and copy number are optimized to improve the expression intensity of ptsG and gadBC.

[0007] The invention provides a recombinant Escherichia coli with high yield of succinic acid under relatively low pH conditions, which overexpresses the glucose transporter ptsG from Corynebacterium glutamicum on the basis of the starting strain, accelerates the glucose utilization rate, and overexpresses the gadBC gene.

[0008] In one embodiment, the recombinant E. coli also replaces the promoter of gadBC with pJ23119, and replaces the RBS sequence of gadBC with RBS34.

[0009] In one embodiment, the overexpression is expression of one or more copies of gadBC.

[0010] In one embodiment, the overexpression is the integration of gadBC at multiple sites in ilvG, rph, ylbE, ygaY, adhE.

[0011] In one embodiment, the overexpression is by integrating gadBC at the ilvG and rph loci, respectively.

[0012] In one embodiment, the replacement glucose transporter is produced by using a recombinant Escherichia coli with an integrated acid-resistant gene as a host bacterium.

[0013] In one embodiment, the nucleotide sequence of gene ilvG is shown as gene ID: 2847699; the nucleotide sequence of gene rph is shown as gene ID: 948156; the nucleotide sequence of gene ylbE is shown as gene ID: 938216; the nucleotide sequence of gene ygaY is shown as gene ID: 2847696; and the nucleotide sequence of gene adhE is shown as gene ID: 945837.

[0014] In one embodiment, the nucleotide sequence of the gene EcptsG is shown as SEQ ID NO.1, and the nucleotide sequence of the gene CgptsG encoding the glucose transporter derived from Corynebacterium glutamicum is shown as SEQ ID NO.2.

[0015] In one embodiment, promoters pJ23119 and RBS34 are used to regulate the expression of the CgptsG gene.

[0016] In one embodiment, the nucleotide sequence of the promoter pJ23119 is shown as SEQ ID NO.3; the nucleotide sequence of the RBS34 is shown as SEQ ID NO.4.

[0017] In one embodiment, the nucleotide sequence of the gadBC gene is shown as SEQ ID NO.5.

[0018] In one embodiment, the Escherichia coli FMME-N-5 is disclosed in the patent application document with publication number CN112239738A.

[0019] The second object of the present invention is to provide a method for constructing the above-mentioned high-yielding succinic acid Escherichia coli, comprising the following steps:

[0020] (1) Preparing competent E. coli FMME-N-5, transforming the plasmid pCas-lac into the cell to obtain a recipient bacterium containing the pCas-lac plasmid;

[0021] (2) constructing the pTargetF-N20 plasmid, designing the N20 nucleotide sequence according to the promoters of ptsG and gadBC and RBS34 to be replaced, and performing whole-plasmid PCR;

[0022] (3) Construct DonorDNA, design homology arms according to the pJ23119 and RBS34 to be inserted, and finally integrate them together by one-step homologous recombination;

[0023] (4) Introduce the pTargetF-N20 plasmid and DonorDNA into the host strain by electroporation;

[0024] (5) IPTG induces transcription of sgRNA on the pCas-lac plasmid to eliminate the pTargetF-N20 plasmid;

[0025] (6) Repeat steps (1) to (5) to integrate gadBC;

[0026] (7) Cultivate the cells overnight at 37°C without adding any antibiotics to eliminate the pCas-lac plasmid.

[0027] In one embodiment, the glucose transporter ptsG and the glutamate decarboxylase-dependent acid-resistant system gadBC are manipulated by CRISPR-cas9 gene editing technology, and the RBS sequence and promoter are used to optimize the expression of the glutamate decarboxylase-dependent acid-resistant system gadBC.

[0028] In one embodiment, when preparing competent E. coli containing the pCas-lac plasmid in step (1), the plasmid pCas-lac is transformed into the cell to obtain a recipient bacterium containing the pCas-lac plasmid.

[0029] In one embodiment, when constructing the pTargetF-N20 plasmid in step (2), the appropriate N20 nucleotide sequence is found on the website (https: / / www.benchling.com / ) according to the gene to be replaced, ptsG, pJ23119-RBS34-gadBC, and the whole plasmid PCR is performed.

[0030] In one embodiment, when constructing DonorDNA in step (3), homology arms are designed according to the gene to be inserted, ptsG, pJ23119-RBS34-gadBC, and finally a homologous recombination step is performed to integrate them together.

[0031] In one embodiment, in step (3), the pTargetF-N20 plasmid constructed according to the gene ptsG to be replaced and the DonorDNA are transformed into the competent E. coli containing the pCas-lac plasmid by electrotransformation; step (3) includes the step of transforming the pTargetF-N20 plasmid constructed according to pJ23119-RBS34-gadBC and the DonorDNA into the competent E. coli containing the pCas-lac plasmid by electrotransformation.

[0032] In one embodiment, in step (5), IPTG induction is used.

[0033] In one embodiment, in steps (5)-(6), the engineered bacteria are obtained by screening on spectinomycin and kanamycin resistance plates.

[0034] In one embodiment, the method of steps (3)-(6) can achieve cyclical genome editing.

[0035] In one embodiment, in step (7), the strain constructed in step (6) is cultured overnight at 37° C. without adding any antibiotics to eliminate the pCas-lac plasmid.

[0036] The present invention also provides a method for producing succinic acid by fermentation, wherein the method uses the recombinant Escherichia coli to perform aerobic-anaerobic two-stage fermentation in a fermentation medium, and optionally, collects succinic acid in the fermentation liquid.

[0037] In one embodiment, the culture medium for fermentation contains: glucose 40-45 g / L, corn steep liquor 10-15 g / L, (NH4)2SO4 2-4 g / L, K2HPO4 1-3 g / L, KH2PO4 0.5-0.9 g / L, MgSO4·7H2O 0.5-0.9 g / L.

[0038] In one embodiment, the aerobic-anaerobic two-stage fermentation is first fermented in an aerobic environment until the glucose in the fermentation medium is exhausted and the OD 600 When the temperature reaches 40-55%, it switches to anaerobic fermentation.

[0039] In one embodiment, the aerobic-anaerobic two-stage fermentation is to convert the aerobic stage to the anaerobic stage 0.25 to 1 hour after the pH is increased (glucose in the fermentation medium is exhausted) and the OD600 reaches 40 to 55.

[0040] In one embodiment, the aerobic stage is converted to the anaerobic stage by introducing CO2 gas or adding bicarbonate at a final concentration of 3 to 7 g / L.

[0041] In one embodiment, during the anaerobic stage, the glucose concentration is controlled to be 0-5 g / L.

[0042] In one embodiment, the inoculation amount of the aerobic-anaerobic two-stage fermentation is 5-15% by volume; and the fermentation temperature is 35-38°C.

[0043] In one embodiment, the fermentation time of the aerobic-anaerobic two-stage fermentation is 26 to 48 hours.

[0044] In one embodiment, during the anaerobic stage, a pH neutralizer is added, wherein the pH neutralizer is one or a mixture of Na2CO3, K2CO3, NaOH, KOH, CaCO3, MgCO3.

[0045] The present invention also provides application of the recombinant Escherichia coli or the method in producing succinic acid or products containing succinic acid.

[0046] Beneficial effects:

[0047] (1) The present invention uses CRISPR-cas9 gene editing technology to replace the glucose transporter gene ptsG in Escherichia coli with the glucose transporter gene ptsG of Corynebacterium glutamicum, thereby accelerating the consumption rate of glucose without affecting the growth rate of the bacteria and improving the accumulation efficiency of succinic acid.

[0048] (2) The present invention also uses RBS sequence and promoter strategy to optimize the expression of glutamate decarboxylase-dependent acid-resistant system gadBC, effectively improving the strain's ability to resist acid and hyperosmosis.

[0049] (3) The recombinant Escherichia coli with high succinic acid production constructed by the present invention adopts a two-stage fermentation strategy in a 5L fermenter. After fermentation for 36 hours, the succinic acid production reaches 104.23 g / L. The succinic acid yield in the anaerobic stage reaches 1.09 g / g glucose, and the production intensity is 2.89 g / L / h. The byproducts lactic acid and formic acid do not accumulate, and the acetic acid is 4-5 g / L. The strain does not contain plasmids, and there is no risk of plasmid loss. No antibiotics are added during fermentation, and the fermentation time of the strain is shortened, the amount of neutralizer used is reduced, and the cost is reduced. It has the potential to be applied to industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 This is a diagram of the CgptsG integration box structure.

[0051] Figure 2 This is a diagram of the gadBC integration box structure.

[0052] Figure 3 To construct the engineered strain fermentation 36h recombinant strain E. coli FMME-N-5, strain FT-1: E. coli FMME-N-5-△EcptsG+CgptsG, strain FT-2: FT-1-△ilvG+gadBC fermenter fed batch fermentation results.

[0053] Figure 4 To construct the feeding curves during the fermentation of the engineered recombinant strains E. coli FMME-N-5, strain FT-1: E. coli FMME-N-5-△EcptsG+CgptsG, and strain FT-2: FT-1-△ilvG+gadBC.

[0054] Figure 5 To construct the engineered strains, recombinant strain E. coli FMME-N-5, strain FT-1: E. coli FMME-N-5-△EcptsG+CgptsG, and strain FT-2: FT-1-△ilvG+gadBC, the fermentation by-product content. DETAILED DESCRIPTION

[0055] The present invention is further described below in conjunction with specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0056] (1) Strains and sequences:

[0057] The deposit number of Escherichia coli FMME-N-5 is CCTCC NO: M 2020454, which has been disclosed in the patent application document with publication number CN112280725A.

[0058] The nucleotide sequence encoding EcptsG is shown in SEQ ID NO.1;

[0059] The nucleotide sequence encoding CgptsG is shown in SEQ ID NO.2.

[0060] The nucleotide sequence of promoter pJ23119 is: 5′-TTGACAGCTAGCTCAGTCCTAGGTATAAT-3′ (SEQ ID NO. 3);

[0061] The nucleotide sequence of RBS34 is: 5′-AAAGAGGAGAAA-3′ (SEQ ID NO. 4);

[0062] The nucleotide sequence of gene gadBC is shown in SEQ ID NO.5.

[0063] (2) Determination method:

[0064] Determination of bacterial concentration: Take an appropriate amount of fermentation liquid and neutralize it with 2 mol / L hydrochloric acid. The bacterial density is expressed by the absorbance value detected at a wavelength of 600 nm using a spectrophotometer.

[0065] Determination of glucose: Pretreatment of fermentation broth: Centrifuge the fermentation broth at 12000r / min for 7min to obtain the supernatant. Dilute to an appropriate multiple and use M-100 biosensor analyzer to detect the glucose concentration of the fermentation broth.

[0066] Determination of organic acids: High performance liquid chromatography: Fermentation broth pretreatment: Take the fermentation broth and centrifuge it at 12000r / min for 7min to take the supernatant. After diluting it to an appropriate multiple, use high performance liquid chromatography (HPLC) to detect the production of succinic acid, lactic acid, formic acid, and acetic acid. The instrument is Agilent high performance liquid chromatograph, and the chromatographic column is Bio-Rad HPX 87H; the mobile phase is 5mmoL / L H2SO4; the flow rate is set to 0.6mL / min; the detector is a UV detector, the detection wavelength is 210nm, and the column temperature is 52℃.

[0067] (3) Culture medium:

[0068] Fermentation medium: glucose 40-45g / L, corn steep liquor 10-15g / L, (NH4)2SO4 2-4g / L, K2HPO4 1-3g / L, KH2PO4 0.5-0.9g / L, MgSO4·7H2O 0.5-0.9g / L;

[0069] Feed medium: glucose 800 g / L.

[0070] Example 1: Construction of CRISPR-Cas9 system

[0071] The E. coli CRISPR-Cas9 system consists of two basic plasmids, pCas-lac and pTargetF. Plasmid pCas-lac is an E. coli free plasmid containing L-arabinose-induced expression of Red recombinase elements, Cas9 protein encoding gene Cas9, temperature-sensitive elements, sgRNA used to induce elimination of plasmid pTargetF, kanamycin resistance gene KanR, etc. All plasmid series containing pCas-lac derivatives need to be cultured in an environment of 30°C to ensure that the plasmid can replicate normally without loss. Plasmid pTargetF is an E. coli free plasmid containing spectinomycin resistance gene aadA and promoter pJ23119 for transcribing sgRNA.

[0072] According to the sequence of the target editing site, primers are designed to amplify the 20 base sequences (N20) matching the target site, and then the sequence is cloned into the pTargetF vector to obtain a knockout plasmid; secondly, the plasmid pCas-lac is transformed into the host cell, the λ-Red recombination system is induced to express, and competent cells are prepared. Then, the knockout plasmid pTargetF and DonorDNA are transformed into competent cells for gene editing and recombination, and the transformants are obtained by plating culture, and the genome recombination is verified by sequencing; then, the plasmid repair system on the pCas-lac plasmid in the induced strain is used to cut the pTargetF knockout plasmid to complete a round of genetic modification. The above work can be performed in sequence to modify multiple gene sites of the host genome to achieve gene deletion or insertion; finally, the pCas-lac plasmid is eliminated by culturing at 37°C.

[0073] The specific steps are:

[0074] (1) Transformation of Escherichia coli with the basic plasmid pCas-lac

[0075] The competent Escherichia coli (E. coli) FMME-N-5 was prepared, and the plasmid pCas-lac was transformed into the cell to obtain the recipient bacteria E. coli FMME-N-5 / pCas-lac containing the pCas-lac plasmid.

[0076] (2) Preparation of competent cells for electroporation of recipient bacteria

[0077] a. Inoculate the E. coli containing the pCas-lac plasmid into liquid LB medium (containing kanamycin at a final concentration of 50 μg / mL) and culture at 30°C and 250 rpm / min until the logarithmic growth phase.

[0078] b. Inoculate in a 500 mL Erlenmeyer flask containing 100 mL LB medium (containing kanamycin at a final concentration of 50 μg / mL) at an inoculum size of 1%, and culture at 30°C and 200 rpm / min until OD600 is 0.2-0.3, then add L-arabinose inducer at a final concentration of 10 mmol / L to induce full expression of the λ-Red recombinase on pCas-lac, and stop culturing when OD600 is 0.5-0.7 (1-1.5 h).

[0079] c. Transfer the culture medium to a 50 mL sterile centrifuge tube in a clean bench and place it in ice for 10 minutes.

[0080] d. Centrifuge the bacterial solution in the centrifuge tube at 4°C and 4000 r / min for 10 min.

[0081] e. Discard the supernatant, add a small amount of pre-cooled 10% glycerol to gently resuspend the bacteria, continue to add 10% glycerol to two-thirds of the volume of the centrifuge tube, centrifuge at 4°C, 4000r / min for 10min; repeat the operation once more.

[0082] f. Suspend the bacteria in 1 mL of pre-cooled 10% glycerol, dispense 100 μL of competent cells into 1.5 mL centrifuge tubes, and place on ice for later use.

[0083] (3) Transformation of pTargetF plasmid and DonorDNA

[0084] a. Add the DNA to be transformed into competent cells, mix gently and place on ice for 30 minutes;

[0085] b. Transfer the mixture into a pre-cooled 2 mm electroporation cup and place on ice for electroporation;

[0086] c. Turn on the electroporator and set the parameter to 2.5kv;

[0087] d. Take out the electroporation cup from the ice, absorb the surface moisture with a paper towel, and put it into the sample tank for electroporation. Immediately after electroporation, add room temperature LB medium to suspend the cells, resuscitate at 30℃ for 2h, spread 50μg / mL kanamycin and 50μg / ml spectinomycin LB plates, and culture at 30℃ overnight;

[0088] e. Pick the clones grown on the plate and perform colony PCR verification using verification primers to obtain the correct gene-edited strain.

[0089] (4) Elimination of basic plasmid

[0090] After genome editing is completed, the genome editing strain containing only the pCas-lac plasmid is inoculated into LB medium, cultured overnight at 37°C without any antibiotics, and then spread on LB plates after dilution and cultured at 37°C. The isolated single colonies are successively screened on LB plates without any antibiotics (cultured at 37°C) and LB plates containing kanamycin with a final concentration of 50 μg / mL (cultured at 30°C). Pick out the single colonies that do not grow on the kanamycin LB plate but grow on the LB plate. This single colony is a strain that eliminates the basic plasmid pCas-lac, and finally obtains a gene editing strain without any plasmid.

[0091] Example 2: Construction of recombinant strain FT-1

[0092] Primers were designed based on the upstream and downstream sequences of the ptsG gene region of E. coli. According to the E. coli genome sequence published on NCBI, the ptsG sequence was found, and the cleavage sites N20-ptsG-1 (TCAGTCGCGTCTTCACGACC), N20-ptsG-2 (CATAACCGATACCGACGATC), and N20-ptsG-3 (GGTTTTAACCATGATGCCAT) in the ptsG region were selected to design reverse amplification primers for pTargetF full plasmid PCR, and N20-ptsG-1, N20-ptsG-2, and N20-ptsG-3 knockout plasmids were obtained respectively. The primers are as follows:

[0093] sgRNA-ptsG-1-U1:TCAGTCGCGTCTTCACGACCGTTTTAGA;

[0094] sgRNA-ptsG-1-D1:GGTCGTGAAAGACGCGACTGAACTAGTATTATACCTAGGAC;

[0095] sgRNA-ptsG-2-U1: CATAACCGATACCGACGATCGTTTTAGAGCTAGAAAT;

[0096] sgRNA-ptsG-2-D1: GATCGTCGGTATCGGTTATGACTAGTATTATACCTAGGACTGAG; sgRNA-ptsG-3-U1: GGTTTTAACCATGATGCCATGTTTTAGAGCTAGAAATAGCA;

[0097] sgRNA-ptsG-3-D1: CTCAGTCCTAGGTATAATACTAGTGGTTTTAACCATGATGCCAT;

[0098] Amplify ptsG to replace the upstream homology arm primer:

[0099] ptsG-UF: ATCGATTACTGGTGGAAACTGAC;

[0100] ptsG-UR: ATACTCAGGAGCACTCTCAATTTTGACAGCTAGCTCAGTCCTAGGTATAATAC;

[0101] Amplify ptsG to replace the downstream homology arm primer:

[0102] ptsG-DF:GGTCAACGGCAAGAACGAGTAATCCGTAAGACGTTGGGGAGAC;

[0103] ptsG-DR:CCCCTTTACTGACTGTCCCATCCAC;

[0104] The one-step homologous recombination technology was used to connect the upstream homologous arm of ptsG, the CgptsG fragment containing promoter pJ23119 and RBS34, and the downstream homologous arm of ptsG into a gene fragment, namely Donor DNA, and PCR amplification was performed. Subsequently, the pTargetF-ptsG-1 / 2 / 3 plasmid and this fragment were co-transformed into the FMME-N-5 strain carrying the pCas-lac plasmid, and the CRISPR-Cas9 technology was used to complete gene knockout and replacement, and the engineered bacteria E. coli FMME-N-5△EcptsG+CgptsG in which the EcoptsG gene was replaced by the CgptsG gene was screened, which was abbreviated as strain FT-1.

[0105] Example 3: Construction of a strain expressing two copies of the gadBC gene

[0106] Primers were designed based on the upstream and downstream sequences of the ilvG gene region of E. coli. According to the E. coli genome sequence published on NCBI, the ilvG sequence was found, the cutting site N20-ilvG (CATGATGAATGTGCAAGAGC) was selected in the ilvG region, and the reverse amplification primers for pTargetF whole plasmid PCR were designed to obtain the pTargetF-ilvG knockout plasmid. The primers are as follows: sgRNA-ilvG-U1: CATGATGAATGTGCAAGAGC GTTTTAGAGCTAGAAATAGCAAGT;

[0107] sgRNA-ilvG-D1:GCTCTTGCACATTCATCATG ACTAGTATTATACCTAGGACTGA;

[0108] The upstream and downstream homology arms of ilvG were amplified by PCR, and the primers are as follows:

[0109] Amplify ilvG and replace the upstream homology arm primer:

[0110] ilvG-UF: GTGCAAGTGAAGTTGAGTTGTCTGGC;

[0111] ilvG-UR: AGTTAGTTCCCGTCCTGAATTCTGA;

[0112] Amplify ilvG to replace the downstream homology arm primer:

[0113] ilvG-DF:TGCAACATCAGGTCAATGTATCGGCT;

[0114] ilvG-DR:TGCGAAACCGGGAAGCGATAGATTTT;

[0115] The upstream homologous arm of ilvG, the gadBC gene containing promoter pJ23119 and RBS34, and the downstream homologous arm of ilvG were connected into a gene fragment using one-step homologous recombination technology. Subsequently, pTargetF-ilvG and this fragment were co-transformed into the strain FT-1 constructed in Example 2 carrying the pCas-lac plasmid to obtain the strain FT-1-△ilvG+gadBC (abbreviated as strain FT-2) containing two copies of gadBC.

[0116] Example 4: Construction of a strain expressing three copies of the gadBC gene

[0117] The specific implementation method is the same as Example 3, except that the cleavage site is N20-rph (GTTTTGTATAGTTACGAGTC, and the reverse amplification primers of the pTargetF whole plasmid PCR are designed to obtain the pTargetF-rph knockout plasmid. The primers are as follows:

[0118] sgRNA-rph-U1:GTTTGTATAGTTACGAGTCGTTTTAGAGCTAGAAATAGCAAGTT;

[0119] sgRNA-rph-D1: GACTCGTAACTATACAAAAC ACTAGTATTATACCTAGGACTGA;

[0120] The upstream and downstream homology arms of rph were amplified by PCR, and the primers were as follows:

[0121] Amplify rph to replace the upstream homology arm primer:

[0122] rph-UF:CGCGTTCCTGACGATCGAGCGAAAT;

[0123] rph-UR:AAGTAAGATGAGGAGCGAAGGCATG;

[0124] Amplify rph to replace the downstream homology arm primer:

[0125] rph-DF:ATTGAAATCTCCGGCTTGAAACAATG;

[0126] rph-DR: GCGTCAAGATCCTGCTCCTGGG;

[0127] The upstream homologous arm of rph, the gadBC gene containing promoter pJ23119 and RBS34, and the downstream homologous arm of rph were connected into a gene fragment using one-step homologous recombination technology, and pTargetF-rph and this fragment were co-transformed into the strain FT-2 constructed in Example 3 carrying the pCas-lac plasmid to obtain the strain FT-2-△rph+gadBC containing 3 copies of gadBC, abbreviated as strain FT-3.

[0128] Example 5: Fed-batch fermentation of recombinant strain FT-2 in a fermenter

[0129] Fermentation medium: glucose 40 g / L, corn steep liquor 10 g / L, (NH4)2SO4 2 g / L, K2HPO4 1 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.9 g / L.

[0130] Pick the recombinant strain FT-2: FT-1-△ilvG+gadBC for two-stage fermentation in a 5L fermenter. Inoculate the recombinant strain monoclone into 25mL (or 50mL shake flask) of LB medium as the primary seed liquid, and culture it at 37°C and 200rpm for 8.5h. Take 200uL of the primary seed liquid and inoculate it into 50mL (or 500mL shake flask) of LB medium; culture it at 37°C and 200rpm for 7.5h to obtain the secondary seed liquid. The initial liquid volume of the fermenter is 2L, the seed inoculation amount is 10%, and the fermentation conditions in the aerobic stage are: the culture temperature is 38°C, the ventilation volume is 1vvm, the initial stirring speed is 600r / min, the pH is controlled at 7.0 with ammonia water, and the dissolved oxygen is controlled at ≥15% during the entire aerobic stage. When the bacterial concentration grows to OD 600=40-55, it is transferred to the anaerobic fermentation stage; anaerobic stage: ventilation is stopped, the stirring speed is 200r / min, 800g / L glucose is added and the feeding rate is controlled to control the sugar concentration of the fermentation liquid to <5g / L, basic magnesium carbonate is used in the anaerobic stage to control the pH at about 6.5, the fermentation cycle of the aerobic-anaerobic two-stage fermentation is 36h in total, the succinic acid production reaches 104.23g / L, the succinic acid yield in the anaerobic stage reaches 1.09g / g glucose, the production intensity is 2.89g / L / h, the by-products lactic acid and formic acid do not accumulate, and the acetic acid is 4.3g / L.

[0131] Example 6: Construction of a strain expressing 4 copies of the gadBC gene

[0132] Referring to the methods of Examples 3 and 4, the gadBC gene was integrated into the ylbE site, the cutting site N20-ylbE (GTTAATGCCAGTATTAAGCG) was used to construct the pTargetF-ylbE knockout plasmid. The required primers are as follows:

[0133] gRNA-ylbE-U1: GTTAATGCCAGTATTAAGCGGTTTTAGAGCTAGAAATAGCAAGTT;

[0134] sgRNA-ylbE-D1:CGCTTAATACTGGCATTAAC ACTAGTATTATACCTAGGACTGA;

[0135] Amplify the upstream and downstream homology arms of ylbE with the following primers:

[0136] Amplify ylbE by replacing the upstream homology arm primers:

[0137] ylbE-UF:ACCCAACCTTACGCAACCAGTTAAT;

[0138] ylbE-UR:GGGAACCCCTTATTGCAAACGTTCTA;

[0139] Amplify ylbE by replacing the downstream homology arm primers:

[0140] ylbE-DF:GGAACGCGCAAATGACGATCATCCATC;

[0141] ylbE-DR:CGGGGCCTTTACCCAGCCAGTG.

[0142] Comparative Example 1:

[0143] The starting strain FMME-N-5 and strain FT-1 were fermented according to the method of Example 5, except that FT-1 was turned into the anaerobic stage 0.5h earlier and fermented for 48h. The results showed that under anaerobic conditions, the bacterial volume of strain FT-1 was similar to that of FMME-N-5, and the bacterial growth in the aerobic stage was not affected; in the anaerobic stage, the residual sugar was maintained at 0-5g / L, and within 48h of fermentation, FT-1 was fed with 60mL of 800g / L glucose more than FMME-N-5, and the glucose utilization efficiency was increased by 15%.

[0144] Comparative Example 2:

[0145] The starting strain FMME-N-5 and the recombinant strain FT-1 constructed in Example 2 were fermented according to the method of Example 5, except that the fermentation time was extended.

[0146] The results showed that the strain FT-1 produced 105 g / L of succinic acid after 45 hours of fermentation; during the 48-72 hours of fermentation, the sugar consumption rate of FT-1 was lower than that of the chassis strain FMME-N-5. Analysis showed that excessive succinic acid accumulation may lead to an imbalance in the cell's tolerance to acid and osmotic pressure, resulting in a significant decrease in cell viability.

[0147] Comparative Example 3:

[0148] Specific implementation method is the same as Example 5, except that the strain FT-3 expressing 3 copies of gadBC is fermented according to the same method.

[0149] The results showed that the strain FT-3 grew slowly in the aerobic stage, and the OD value was only 16 at the end of the aerobic stage. The amount of bacteria was reduced by 64% compared with the strain FT-2, so fermentation continued in the anaerobic stage.

[0150] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Escherichia coli with high succinic acid yield, characterized in that: Based on the starting strain, the glucose transporter ptsG from Corynebacterium glutamicum was overexpressed, and the gadBC gene was overexpressed.

2. The recombinant Escherichia coli according to claim 1, characterized in that The recombinant E. coli also replaced the promoter of gadBC with pJ23119, and replaced the RBS sequence of gadBC with RBS34.

3. The recombinant Escherichia coli according to claim 1 or 2, characterized in that The gadBC gene is integrated at the ilvG and / or rph sites.

4. The recombinant Escherichia coli according to claim 3, characterized in that The overexpression is achieved by integrating gadBC at the ilvG and rph sites, respectively.

5. The recombinant Escherichia coli according to any one of claims 1 to 4, characterized in that The starting strain includes but is not limited to Escherichia coli FMME-N-5.

6. A method for producing succinic acid by fermentation, characterized in that: The recombinant Escherichia coli according to any one of claims 1 to 5 is subjected to aerobic-anaerobic two-stage fermentation in a fermentation medium.

7. The method according to claim 6, characterized in that The culture medium used for fermentation contains: glucose 40-45 g / L, corn steep liquor 10-15 g / L, (NH4)2SO4 2-4 g / L, K2HPO4 1-3 g / L, KH2PO4 0.5-0.9 g / L, MgSO4·7H2O0.5-0.9 g / L.

8. The method according to claim 6 or 7, characterized in that: The aerobic-anaerobic two-stage fermentation is first fermented under an aerobic environment until the glucose in the fermentation medium is exhausted and the OD 600 When the temperature reaches 40-55%, it switches to anaerobic fermentation.

9. The method according to claim 8, characterized in that During the anaerobic stage, the glucose concentration was controlled not to exceed 5 g / L.

10. Use of the recombinant Escherichia coli according to any one of claims 1 to 5 or the method according to any one of claims 6 to 9 in producing succinic acid or a product containing succinic acid.

Images