Gene TaNAE capable of improving disease resistance of wheat scab and application of gene TaNAE

Abstract

The invention discloses a gene TaNAE capable of improving the disease resistance of wheat scab and application of the gene TaNAE, and the gene TaNAE is a gene specifically expressed by a disease-resistant variety Sumai 3. The gene is introduced into a popularization variety Fielder by constructing an overexpression vector and by means of an agrobacterium infection method to obtain a stable transgenic plant, and the disease resistance of the gibberellic disease is remarkably improved in the obtained three transgenic lines. The invention has important production significance for improving the resistance of wheat scab, and provides a new gene resource for cultivating a new wheat variety with high yield, stable yield and strong eurytopic adaptability.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a gene TaNAE capable of improving the disease resistance of wheat fusarium head blight and an application thereof. Background Art

[0002] Fusarium head blight (FHB) is a fungal disease caused by Fusarium graminearum invading wheat ears. It can cause wheat ears to wither, grains to shrivel, and grains to accumulate a large amount of deoxynivalenol toxins, resulting in a significant reduction in wheat yield and excessive grain toxins. TaNAE (Neprosin activation endoprotease) protein is a selective proline endopeptidase belonging to the glutamate protease family G3 family. In cells, proline endopeptidases participate in protein quality control and maintain cell homeostasis by degrading abnormal or damaged proteins. Proline endopeptidases also play an important role in host defense against pathogens. Proline endopeptidases secreted by certain microorganisms have antibacterial activity and can degrade the protein components of pathogens, thereby inhibiting their growth and infection. Proline endopeptidases can effectively kill or inhibit pathogens by specifically degrading the cell wall or other key proteins of pathogens. Therefore, this type of enzyme can enhance the host's immune response and can work in synergy with other immune components to improve anti-infection ability. Summary of the invention

[0003] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0004] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0005] In order to solve the above technical problems, the present invention provides the following technical solution: a gene TaNAE, characterized in that: the nucleotide sequence of the gene is shown as SEQ ID No.1.

[0006] Another object of the present invention is to overcome the deficiencies in the prior art and provide a TaNAE protein encoded by the gene TaNAE as claimed in claim 1.

[0007] The protein is as shown in any one of (a) to (d):

[0008] (a) a protein having an amino acid sequence of SEQ ID NO.2;

[0009] (b) a protein derived from SEQ ID NO.1 having the same function as SEQ ID NO.2, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0010] (c) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the amino acid sequence defined in any one of (a) and (b) and having the same function;

[0011] (d) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a protein defined in any one of (a) to (c).

[0012] As a preferred embodiment of the TaNAE gene of the present invention, the length of the TaNAE gene is 1242 bp, and the number of amino acids encoded in the TaNAE gene is 413 aa.

[0013] Another object of the present invention is to overcome the deficiencies in the prior art and provide a recombinant vector of the TaNAE gene.

[0014] The nucleotide sequence of the recombinant vector is shown in SEQ ID No. 3, which is obtained by inserting the nucleotide sequence of SEQ ID No. 1 between the restriction endonucleases HindIII and BamHI in the multiple cloning site of the pCambia3300 backbone vector.

[0015] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method of overexpressing TaNAE as a preferred solution of the TaNAE gene of the present invention, comprising: overexpressing the TaNAE gene.

[0016] The overexpression of the TaNAE gene is used to improve the resistance of wheat to ergot disease.

[0017] The last object of the present invention is to overcome the deficiencies in the prior art and provide a method for cultivating plant varieties with improved resistance to wheat fusarium head blight.

[0018] A nucleic acid molecule capable of expressing TaNAE protein is introduced into a recipient plant by using an Agrobacterium-mediated stable genetic transformation method to obtain a transgenic plant; the transgenic plant has a higher resistance to fusarium scabiei than the recipient plant;

[0019] The recipient plant is a grass plant.

[0020] The introduction of the nucleic acid molecule expressing the TaNAE protein into the recipient plant is achieved by introducing a recombinant expression vector containing the nucleic acid molecule capable of expressing the TaNAE protein into the recipient plant.

[0021] Beneficial effects of the present invention:

[0022] The present invention can significantly improve the resistance of wheat to ergot by overexpressing the TaNAE gene in wheat. This can ensure high-quality and stable wheat yields and increase farmers' economic income in areas with a high incidence of ergot. Therefore, the invention has important significance and application prospects for ensuring the quality and safety of grain. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. The drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0024] Figure 1 This is a comparison diagram of the nucleic acid sequences of Sumai No. 3 and TaNAE in Chinese Spring in Example 1 of the present invention.

[0025] Figure 2 The expression and tissue-specific expression of TaNAE in resistant and susceptible varieties in Example 1 of the present invention ( Figure 2 A indicates that TaNAE is specifically expressed in Sumai 3. Figure 2 (B) The expression pattern of TaNAE in different tissues of Sumai 3.

[0026] Figure 3 This is a simplified diagram of the vector construction in Example 1 of the present invention.

[0027] Figure 4 This is a positive identification diagram of transgenic in Example 1 of the present invention. The band in the figure is the band of the BAR gene.

[0028] Figure 5 This is the expression detection diagram of the positive strain in Example 1 of the present invention.

[0029] Figure 6 This is a diagram of the Fusarium fusarium phenotype of the TaNAE overexpressing transgenic material in Example 1 of the present invention.

[0030] Figure 7 These are the statistical results of the diseased ear rate of the Fusarium fusarium phenotype of the TaNAE overexpressing transgenic material in Example 1 of the present invention. DETAILED DESCRIPTION

[0031] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0032] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0033] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0034] Unless otherwise specified, the raw materials used in the examples of the present invention are commercially available.

[0035] Using the genome of wheat variety Chinese Spring as a reference, the TaNAE gene is located on wheat chromosome 5A, but there are multiple allelic variations in the nucleic acid sequence of the gene that can cause amino acid changes (sequence alignment see Figure 1 ). This gene is specifically expressed in the fusarium resistant variety Sumai 3. We sampled different tissues of Sumai 3 and performed semi-quantitative analysis. We found that TaNAE was expressed in the glume, inner glume, stem and leaves of wheat ( Figure 2 ), these tissues are all tissues infected and expanded by Fusarium graminearum. Therefore, we extracted RNA from Sumai No. 3 and reverse transcribed it to obtain cDNA, amplified the CDS sequence of TaNAE, and carried out vector construction, genetic transformation and phenotypic identification of Fusarium graminearum. The nucleotide sequence of TaNAE gene is shown in SEQ ID NO:1 in the sequence table, and its protein amino acid sequence is shown in SEQ ID NO:2.

[0036] Example 1

[0037] (1) Wheat RNA extraction and reverse transcription:

[0038] Ⅰ. RNA extraction:

[0039] ① Preparation: sample, 2mL / 1.5mL enzyme-free centrifuge tube, enzyme-free pipette tip, 75% alcohol (prepared with DEPC-treated water), isopropanol, centrifuge precooled at 4°C.

[0040] ② Use liquid nitrogen to pre-cool the mortar and pestle, quickly take the sample into the mortar, grind it into powder, take an appropriate amount of powder into a 2mL enzyme-free centrifuge tube, put the centrifuge tube on ice, add 1mL Trizol, and then place it on an oscillator, shake it thoroughly for 30s to fully lyse it, then add 400μL of chloroform, place it on an oscillator and shake it thoroughly for 15s, let it stand for 3min, put it in a centrifuge, set it at 4℃, 12000rpm, and centrifuge it for 15min;

[0041] ③ Pipette 400 μL of supernatant into a 1.5 mL enzyme-free centrifuge tube, add isopropanol at a ratio of 1:1, flip upside down 5-10 times to mix, and place in a -20°C refrigerator for 30 minutes to precipitate RNA. After precipitation, place in a centrifuge, set at 4°C, 12,000 rpm, and centrifuge for 15 minutes;

[0042] ④ Take out the centrifuge tube, discard the supernatant, add 1 mL of 75% alcohol (prepared with DEPC-treated water), wash the RNA precipitate, put it into the centrifuge, set it to 4°C, 12000 rpm, centrifuge for 5 minutes, discard the supernatant, centrifuge for 10-20 seconds, and use an enzyme-free pipette to absorb the residual alcohol;

[0043] ⑤Put the centrifuge tube in a clean bench and blow it for 15-20 minutes until it becomes transparent. Add preheated DEPC water at 70°C and dissolve it for 5 minutes.

[0044] ⑥Store the extracted RNA in a -80℃ refrigerator.

[0045] Ⅱ. Reverse transcription of cDNA using a reverse transcription kit (Novozyme, Nanjing):

[0046] ①Removal of genomic DNA:

[0047] Table 1

[0048]

[0049] PCR program: 42°C, 2 min.

[0050] ②Reverse transcription of cDNA:

[0051] Table 2

[0052]

[0053] PCR program: 50℃15min; 85℃2min. The reverse transcription product was stored at -20℃.

[0054] (2) Real-time fluorescence quantitative PCR and semi-quantitative PCR:

[0055] ① Based on the genome of wheat variety Chinese Spring as the reference genome, primers for quantitative and semi-quantitative analysis were designed. The sequences are as follows:

[0056] The forward primer was: GGGGTTCCTACGAAGGCAATG (SEQ ID NO: 4);

[0057] The reverse primer is: CCACCAGTTGCCCTCCTTTG (SEQ ID NO: 5);

[0058] ② Real-time fluorescence quantitative PCR: Prepare 10 μL of quantitative PCR system as follows:

[0059] Table 3

[0060]

[0061] PCR program: pre-denaturation: 95°C for 30 s; cycle reaction: 95°C for 5 s, 60°C for 34 s, 40 cycles; melting curve: 95°C for 15 s, 60°C for 60 s, 95°C for 15 s.

[0062] ③Semi-quantitative PCR: Prepare 10 μL of quantitative PCR system as follows:

[0063] Table 4

[0064]

[0065]

[0066] PCR program: pre-denaturation: 95°C for 30 s; cycle reaction: 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; post-extension: 72°C for 5 min. After semi-quantification, the product size was identified using 2% agarose gel.

[0067] (3) Construction of transgenic vector:

[0068] Primer premier 5 primer design software was used to design primers for constructing the transgenic overexpression vector. The primer sequences were as follows: forward primer: CCAAGCTTATGGCCGCCACCCGAGC (SEQ ID NO: 6) and reverse primer: CGGGATCCTGGGCAGTTAGAGTTCTTCCC (SEQ ID NO: 7). The primers were synthesized by Nanjing GenScript Co., Ltd.

[0069] The TaNAECDS sequence was amplified using SM cDNA as a template, and the reaction system was as follows:

[0070] Table 5

[0071]

[0072] PCR program: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 68°C for 4 min, 30 cycles; 68°C for 10 min; the product was stored at 4°C.

[0073] Agarose gel purification of PCR products:

[0074] ① Prepare 2% agarose gel with TAE electrophoresis buffer solution and add 1% volume of 0.5 mg / mL EB during gel preparation;

[0075] ② Add 5 μL 10× loading buffer to the PCR product, load all samples into the gel wells, spot Trans2kDNA Marker in the empty wells, and perform electrophoresis at 130V for 15 minutes;

[0076] ③ Under ultraviolet light (Bio-RAD), cut the gel block with a clean blade (the size of the band matches the size of the target fragment) and put it into a 2.0 mL centrifuge tube;

[0077] ④ Recover the target fragment according to the instructions of the gel recovery kit (Sangon, China).

[0078] Ligation cloning vector pEASY-Blunt3:

[0079] Preparation system:

[0080] Table 6

[0081]

[0082] PCR program: 25℃30min

[0083] Transform the ligation product into competent E. coli cells:

[0084] ①Take out the Fast-T1 competent cell suspension and thaw it on ice, then pipette 50 μL of competent cells and mix with all the products in the previous step, pipette and beat to mix, and place on ice for 30 min;

[0085] ② Place it in a metal bath for heat shock at 42°C for 1 min 30 s. After the heat shock is completed, quickly place it in an ice bath for 3-5 min. Then add 1 mL of LB liquid culture medium, pipette and mix well, place it in a shaker, set it at 37°C, 150 rpm, and culture it for 1 h.

[0086] ③After the culture is completed, centrifuge at 5000rpm for 5 minutes, discard the supernatant, use a pipette to gently mix the precipitate with the remaining liquid culture medium in the tube, and then apply it to the LB solid culture medium with Amp resistance. When there is no obvious water stain on the plate, seal the plate with a sealing film, and invert the plate and place it in a 37℃ incubator overnight;

[0087] ④ On the second day, 10 bacterial spots were randomly selected from the LB solid culture medium and positive strains were detected by PCR;

[0088] The PCR reaction system is as follows:

[0089] Table 7

[0090]

[0091] PCR program: 95°C, 3 min; 95°C, 30 s, 58°C, 30 s, 72°C, 2 min, 28 cycles; 72°C, 5 min;

[0092] ⑤ Identify with 2% agarose gel. Observe with UV light of gel imaging system (Bio-RAD), select positive clones and put them into LB liquid culture medium (containing ampicillin), place them on a shaker at 180 rpm and culture them at 37°C overnight.

[0093] ⑥ After the positive strains were identified, the bacterial culture was sent to Genewise (Suzhou, China) for sequencing.

[0094] ⑦Comparison analysis of sequencing results: use DNAMAN software to compare and verify the sequencing results with the target sequence.

[0095] The strain with the correct sequencing results was selected and the plasmid was extracted and digested according to the instructions of the plasmid DNA small-scale extraction kit (Sanggong, China).

[0096] Prepare 50 μL of enzyme digestion reaction system, the components are as follows:

[0097] Table 8

[0098]

[0099] PCR program: 37℃ 2h

[0100] The PCR product was purified by agarose gel and the target fragment was recovered according to the instructions of the gel recovery kit (Sangon, China).

[0101] Ligation of pCambia3300 vector:

[0102] Prepare 10 μL of ligation system, the components are as follows:

[0103] Table 9

[0104]

[0105]

[0106] The PCR program was 25°C, 2h.

[0107] The ligation product was transformed into E. coli Fast-T1 competent cells. After plating overnight, 20 single clones were selected from each bacterial plate for PCR to detect positive strains. After the plasmid was extracted from the positive strains, it was transferred into Agrobacterium EHA105 for the creation of transgenic materials. The constructed vector diagram is shown in the figure below. Figure 3The nucleotide sequence of the recombinant vector is shown in SEQ ID NO: 3, wherein CaMV35S represents the strong promoter of tobacco mosaic virus 35S, and the BAR gene can confer herbicide resistance to plants.

[0108] (4) Genetic transformation: The creation of transgenic materials was completed by Tianjin Jinuowo Biotechnology Co., Ltd.

[0109] (5) Positive identification of transgenic genes:

[0110] DNA level identification:

[0111] Extraction of transgenic wheat DNA:

[0112] ① Grind wheat leaves in a mortar with liquid nitrogen, transfer the fully ground powder to a 1.5 mL centrifuge tube; add 650 mL CTAB extraction solution (100 mM, Tris-HCl (pH 8.0), 4 mol / L NaCl, 20 mmol / L EDTA (pH 8.0), 2% CTAB, add 2 mL / 100 mL β-mercaptoethanol before use) and mix well;

[0113] ②65℃ water bath for 30min, gently shaking several times in between;

[0114] ③ Place on ice for 5 minutes;

[0115] ④Add 400 μL of chloroform and mix gently;

[0116] ⑤Stand at room temperature for 10 minutes, centrifuge at 12000rpm for 15 minutes, and take the supernatant;

[0117] ⑥ Add 2 times the volume of ice ethanol, mix well, and let stand at -20℃ for 30min;

[0118] ⑦ Centrifuge and discharge the supernatant;

[0119] ⑧ Rinse twice with 1 mL of 70% ethanol and dry;

[0120] ⑨ Dissolve in 100 μL sterile water for later use.

[0121] BAR gene detection: BAR gene detection primers are as follows:

[0122] Forward primer: CTACATCGAGACAAGCACGGTCAA (SEQ ID NO: 8)

[0123] Reverse primer: AGAAACCCACGTCATGCCAGTTC (SEQ ID NO: 9)

[0124] The following PCR procedure was used for detection. The PCR reaction system is as follows:

[0125] Table 10

[0126]

[0127]

[0128] PCR program: 95°C, 3 min; 95°C, 30 s, 58°C, 30 s, 72°C, 30 s, 35 cycles; 72°C, 5 min;

[0129] The PCR products were identified using 2% agarose gel. Figure 4 As shown. Among them, the detected gene is BAR gene. #28, #39 and #46 represent three transformed strains respectively.

[0130] The expression level identification results are as follows Figure 5 shown.

[0131] Phenotypic analysis of Fusarium fusarium:

[0132] Experimental strains and bacterial solution preparation:

[0133] The Fusarium graminearum used in this experiment is the sequenced strain PH-1, provided by Dr. Li Bing of Zhengzhou University. The steps for preparing the strain and bacterial solution are as follows:

[0134] ① Activate the strain on PDA solid culture medium and place the culture medium in a constant temperature incubator at 25°C for 5 days to ensure the growth and reproduction of the strain.

[0135] ②After the culture is completed, use a sterilized cork puncher to take 4 bacterial blocks from the culture medium, transfer the obtained bacterial blocks to 50mL mung bean soup liquid culture medium, set the shaking temperature and speed to 25℃ and 150r / min respectively, and culture for 3-5 days.

[0136] ③After the culture is completed, take 1 μL of spore solution and drop it on the blood cell counting plate. Use a microscope to observe and count the spores to determine the spore concentration. When the spore concentration reaches 1×10 5 When the spore solution is 1.5×10 / mL, it can be used for inoculation experiments.

[0137] Fusarium scab inoculation and phenotypic identification:

[0138] During the flowering period of wheat, the bacterial solution was injected between the inner and outer lemmas of the florets on both sides of the fifth spikelet of wheat using the double flower drip method, and a label was attached to the spike axis of the inoculated spikelet to indicate the inoculation date. Fusarium fusarium disease identification was performed 14 days after inoculation. Calculation method of diseased spikelet rate: diseased spikelet rate = diseased spikelet / total number of spikelets. Phenotypic identification and statistical results are shown in Figure 6 , 7 shown.

[0139] Figure 1 This is a comparison of the nucleic acid sequences of TaNAE in Sumai No. 3 and Chinese Spring, where SM represents Sumai No. 3, CS represents Chinese Spring, and the color difference parts indicate the nucleotide variation sites. Figure 2 The expression and tissue-specific expression of TaNAE in resistant and susceptible varieties, where "CSM" represents the control sample of Chinese Spring, "CSI" represents the inoculated sample of Chinese Spring, "SMM" represents the control sample of Sumai No. 3, and "SMI" represents the inoculated sample of Sumai No. 3. "Actin" is an internal reference gene. Figure 2 B is the expression pattern of TaNAE in different tissues of Sumai 3, "Glume" represents guard glume, "Lemma" represents outer glume, "Palea" represents inner glume, "Rachis" represents spike, "Seeds" represents seeds, "Flower" represents flowers, "Leaves" represents leaves, "Stem" represents stem, and "Root" represents roots. Figure 5 It is the expression detection of positive strains, among which Fielder is the transgenic recipient variety, EV represents the negative strain in the transformation process, and #28, #39 and #46 represent three transformed strains respectively. Figure 6 Fielder in the middle is the transgenic recipient variety, EV represents the negative strain in the transformation process, #28, #39 and #46 represent three transformed strains. The scale is 1 cm. The upper and lower parts of the figure are the front and side photos of the same ear, respectively. Figure 7 "PSS" stands for the percentage of symptom spikelets. The number of spikelets inoculated and statistically phenotyped for each transgenic line was greater than or equal to 7. The statistical analysis was performed using Student-t test. ns represents p>0.05, and *** represents p<0.001. Overexpression of the TaNAE gene can reduce the percentage of fusarium head blight from 70% to about 45%.

[0140] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the present invention.

[0141] Sequence Listing:

[0142] SEQ ID NO: 1:

[0143]

[0144] SEQ ID NO:2:

[0145] MAATRACLVVLVVALTFVCFDGRAAAAPATAGSLAQRRQEVQSLLRRLNKPALATIQSPDGDVIDCVHISKQPAFDHPLLKNHTIQMRPSYHPGGMYHNSNIATHPITQTWHQNGKCPKNTIPIRRTNEDDVLRASSVDRYGKKRPGSIPNISSINDPDTSNISSGHQYAIASSNVDKCHGTKATFNLWQPTIGRANDFSLTQLWIVGGSYEGNDLNTIEAGWQVYPNFYKDNNPRLFIYWTRDAYKSTGCYNLKCSGFVQTNNQIAIGGTLSPVSTYDGAQYDFDILVWKDPKEGNWWLQMGSDYVGYWPSSIFTYLADSASTIQWGGEIASSDLGQTSTDMGSGHFPEEGFGKASHVKNIQVVDSSNILKPPSDVTTIAGQRSCYNVHNGISDNLGTYIFYGGPGKNSNCP

[0146] SEQ ID NO:3:

[0147]

Claims

1. A gene TaNAE, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. A TaNAE protein encoded by the gene TaNAE as claimed in claim 1.

3. The TaNAE protein according to claim 2, characterized in that: The protein is as shown in any one of (a) to (d): (a) a protein having an amino acid sequence of SEQ ID NO.2; (b) a protein derived from SEQ ID NO.1 having the same function as SEQ ID NO.2, wherein one or more amino acid residues are substituted and / or deleted and / or added; (c) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the amino acid sequence defined in any one of (a) and (b) and having the same function; (d) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a protein defined in any one of (a) to (c).

4. The TaNAE gene according to claim 1, characterized in that: The TaNAE gene is 1242 bp in length, and the number of amino acids encoded in the TaNAE gene is 413 aa.

5. A recombinant vector containing the TaNAE gene according to claim 1.

6. The recombinant vector according to claim 5, characterized in that: The nucleotide sequence of the recombinant vector is shown in SEQ ID No. 3, which is obtained by inserting the nucleotide sequence of SEQ ID No. 1 between the restriction endonucleases HindIII and BamHI in the multiple cloning site of the pCambia3300 backbone vector.

7. An application for overexpressing TaNAE gene, characterized in that: The TaNAE gene was overexpressed.

8. The use according to claim 7, characterized in that: The overexpression of the TaNAE gene is used to significantly improve wheat resistance to fusarium head blight.

9. A method for cultivating plant varieties with improved resistance to wheat scab, characterized in that: The method comprises: using an Agrobacterium-mediated stable genetic transformation method to introduce a nucleic acid molecule capable of expressing TaNAE protein into a recipient plant to obtain a transgenic plant; the transgenic plant has a higher resistance to fusarium scabiei than the recipient plant; The recipient plant is a grass plant.

10. The method according to claim 9, characterized in that: The introduction of the nucleic acid molecule expressing the TaNAE protein into the recipient plant is achieved by introducing a recombinant expression vector containing the nucleic acid molecule capable of expressing the TaNAE protein into the recipient plant.

Images