Methods of improving resistance to scab in wheat using qfhb-2dl and qfhb-3bl, molecular markers, primers

By utilizing QFhb-2DL and QFhb-3BL molecular markers, combined with molecular design and precise phenotypic identification, the problem of poor resistance to Fusarium head blight in wheat varieties in the upper reaches of the Yangtze River was solved, enabling the efficient breeding of high-yielding wheat varieties with high resistance to Fusarium head blight. This also solved the problem of agronomic trait linkage burden in the breeding process, improving breeding efficiency and disease resistance.

CN119955941BActive Publication Date: 2026-06-23JIANGSU LIXIAHE REGION AGRI RES INST +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU LIXIAHE REGION AGRI RES INST
Filing Date
2024-10-28
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Wheat varieties in the upper reaches of the Yangtze River have poor resistance to Fusarium head blight. Existing Fusarium head blight resistance genes have low utilization efficiency and are difficult to apply effectively in breeding. Furthermore, the linkage of agronomic traits during the breeding process is redundant, making it difficult to promote resistant varieties on a large scale.

Method used

Using molecular markers of two Fusarium head blight resistance genes, QFhb-2DL and QFhb-3BL, high-yielding wheat varieties with high resistance to Fusarium head blight were bred through precise phenotypic identification and molecular design. Molecular marker-assisted selection was used to rapidly introduce disease-resistant genotypes. Combined with screening for tillering ability, lodging resistance, and stripe rust resistance, dcaps and KASP markers were developed for genotyping.

Benefits of technology

It significantly improved breeding efficiency and the accuracy of trait improvement, enhanced wheat variety resistance to Fusarium head blight, stabilized stripe rust resistance and short-stemmed, large-eared, multi-ear characteristics, reduced field workload, and improved the accuracy of Fusarium head blight resistance prediction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955941B_ABST
    Figure CN119955941B_ABST
Patent Text Reader

Abstract

The application discloses a method for improving resistance to wheat scab QFhb-2DL and QFhb- 3BL The application discloses a method for improving resistance to wheat scab, a molecular marker, a primer, the molecular marker comprising a dCAPS marker of QFhb-2DL and / or a KASP marker of QFhb-3BL . The application first develops a molecular marker closely linked to QFhb-2DL and a molecular marker closely linked to QFhb-3BL . Under the premise of stabilizing the resistance to stripe rust, dwarf, large spike and multiple spike characteristics of a wheat variety in the upper reaches of the Yangtze River, the application realizes molecular design breeding by using the developed new marker closely linked to the locus, and quickly introduces the disease-resistant genotypes of QFhb-2DL and QFhb-3BL into the wheat variety in the upper reaches of the Yangtze River, breeds a strain which is resistant to scab and has a yield significantly higher than that of a control, and realizes a breakthrough in the resistance to scab in the upper reaches of the Yangtze River.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of wheat molecular breeding technology, specifically, it relates to a method utilizing... QFhb-2DL and QFhb-3BL Methods, molecular markers, and primers for improving wheat resistance to Fusarium head blight. Background Technology

[0002] The wheat-growing region of the middle and lower reaches of the Yangtze River was one of the earliest areas in China to carry out genetic improvement work on wheat resistance to Fusarium head blight. In the 1860s and 1870s, the highly resistant variety Sumai 3 was bred. However, Sumai 3's plant height reached 130-150 cm, making it unsuitable for large-scale application. Subsequently, China conducted breeding work on Fusarium head blight resistance sources using Sumai 3, Wangshuibai, and closely related wheat species. Although some resistant germplasm was selected, its agronomic traits did not meet the requirements for large-scale application, and it failed to be widely adopted in production. Later, this wheat-growing region focused on the overall high yield and mild Fusarium head blight resistance of the parents. The offspring were primarily selected based on overall high yield, while also considering disease resistance and stress tolerance. This led to the development of a number of moderately resistant, high-yielding wheat varieties suitable for large-scale cultivation, such as Yangmai 158 and Yangmai 16, significantly improving the overall Fusarium head blight resistance level of wheat in the middle and lower reaches of the Yangtze River and even in China. Wheat stripe rust is a frequent disease outbreak in the wheat-growing region of the upper Yangtze River. Most wheat varieties possess multiple stripe rust resistance genes, exhibiting good resistance to the disease. However, breeding for resistance to Fusarium head blight in this region started relatively late, and resistance to Fusarium head blight was not a requirement in variety approval processes, resulting in very poor resistance in wheat varieties, which have consistently remained at a highly susceptible to susceptible level. In recent years, due to the high temperatures and heavy rainfall during the wheat flowering period, Fusarium head blight has also frequently occurred in the upper Yangtze River region, posing a significant threat to food security. Preliminary testing has revealed that most wheat varieties in the upper Yangtze River region do not carry any known Fusarium head blight resistance genes / locus. Therefore, developing Fusarium head blight-resistant varieties is urgently needed in wheat breeding for this region.

[0003] Unlike quality traits such as resistance to stripe rust, leaf rust, and powdery mildew, wheat resistance to Fusarium head blight is one of the most complex quantitative traits in crops, controlled by multiple genes. Numerous QTLs for Fusarium head blight resistance have been mapped both domestically and internationally, but few have been validated; only major genes for wheat resistance to Fusarium head blight have been identified. Fhb1 and Fhb7 Cloning. The molecular regulatory network involved in wheat resistance genes / QTLs is complex, and they are often lost during breeding due to the linkage burden with agronomic traits. As a result, the utilization efficiency of known resistance genes is not high, and even fewer can be applied to wheat breeding in the upper reaches of the Yangtze River.

[0004] Given the above research background, there is an urgent need to explore and utilize new key sites for resistance to Fusarium head blight, develop corresponding molecular markers, and apply them to the breeding of wheat with resistance to Fusarium head blight in the upper reaches of the Yangtze River. Summary of the Invention

[0005] To address the problem of poor resistance to Fusarium head blight in wheat in the upper reaches of the Yangtze River, this invention provides a method utilizing... QFhb-2DL and QFhb-3BL Methods, molecular markers, and primers for improving wheat resistance to Fusarium head blight, utilizing QFhb-2DL and QFhb-3BL Linked markers can be used to breed high-yielding wheat varieties (lines) with high resistance to Fusarium head blight and high yield through molecular design and precise phenotypic identification of traits, greatly improving breeding efficiency and the precision of trait improvement.

[0006] To achieve the above objectives, a first aspect of the present invention provides a molecular marker associated with wheat scab resistance, the molecular marker comprising: QFhb-2DL dcaps tags and / or QFhb-3BL The KASP tag, the QFhb-2DL The dcaps marker has a flanking sequence as shown in SEQ ID NO.1, the QFhb-3BL The KASP tag has differential SNP flanking sequences in the coding region as shown in SEQ ID NO.4 and differential SNP flanking sequences in the promoter region as shown in SEQ ID NO.8.

[0007] Furthermore, the differential SNPs in the coding region are of the G base type for resistant varieties and the A base type for susceptible varieties; the differential SNPs in the promoter region are of the T base type for resistant varieties and the C base type for susceptible varieties.

[0008] A second aspect of the present invention provides a primer set for use with the above-described molecular markers, wherein... QFhb-2DL The sequences of the primer sets used for the dcaps markers are shown in SEQ ID NO.2 and SEQ ID NO.3;

[0009] The QFhb-3BL The primer sets used for the KASP marker include the KASP.3B.1 primer set or the KASP.3B.2 primer set, the sequences of which are shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, and the sequences of which are shown in SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO.11.

[0010] The third aspect of the present invention provides a method for utilizing QFhb-2DL and QFhb-3BL A method for improving wheat resistance to Fusarium head blight includes the following steps:

[0011] Step S1, Select carrier sites QFhb-2DL and QFhb-3BLWheat varieties or lines with disease-resistant allelic variants are used as donors, and wheat varieties with stripe rust resistance, short stalks, large ears, and multiple ears are used as recipients. The two parents are crossed to obtain F0. F0 is planted and crossed with the recipient when it flowers to harvest BC1F1 seeds.

[0012] Step S2: Plant BC1F1 seedlings. Once seedlings emerge, extract DNA from the leaves and use it for… QFhb-2DL and QFhb-3BL Linkage marker detection was performed, and BC1F1 single plants that were positive for both genes / locus (heterozygous or homozygous) were selected to harvest BC1F2.

[0013] Step S3, select BC1F2 in the planting, and use... QFhb-2DL and QFhb-3BL The linkage marker detection was used to select BC1F2 single plants that were positive (heterozygous or homozygous) for both genes / locus. The plants were then screened for tillering ability, lodging resistance, stripe rust resistance, and Fusarium head blight resistance. BC1F3 seeds were selected from the harvest.

[0014] Step S4, plant BC1F3, and utilize QFhb-2DL and QFhb-3BL Linkage marker detection was performed, and BC1F3 single plants with positive (heterozygous or homozygous) genes / locus were selected. During the wheat flowering period, single plants were sprayed with Fusarium spore liquid. Single plants with Fusarium spore infection rate ≥25% and diseased spikelet rate greater than control were eliminated. Single plants with poor stem elasticity, easy lodging, and plant height greater than 90cm were also eliminated. BC1F4 single plant seeds were selected during harvest.

[0015] Step S5: Plant BC1F4 seedlings and extract leaf DNA during the seedling stage. QFhb-2DL and QFhb-3BL Linkage markers were used to detect mixed samples of BC1F4 plants. For mixed samples that were heterozygous, gene testing was performed on individual plants to determine the genotype of BC1F4 plants at two gene / locus sites. During the flowering period, BC1F4 plants were inoculated with Fusarium head blight pathogen by drip inoculation. 21 days after inoculation, the genotype of individual BC1F4 plants and the results of Fusarium head blight resistance spread were comprehensively analyzed. Individual plants or plants with the identification result of "high resistance-resistant" were retained. Then, the comprehensive agronomic traits of the selected plants or plants were comprehensively examined, and superior plants and plants were selected. After harvest, grain weight and yield were identified, and BC1F5 seeds with higher grain weight and yield levels than the control were selected.

[0016] Step S6: Plant BC1F5 to cultivate a complete lineage, and utilize... QFhb-2DL and QFhb-3BLLinkage marker detection was used to sample BC1F5 lines. Lines with homozygous positive results for both genes were selected. During the flowering period, individual flowers of the lines were inoculated with Fusarium head blight pathogens. Lines with identification results of "high resistance-resistant" were retained. The comprehensive agronomic traits of the selected lines were comprehensively evaluated. The selected lines were harvested together. After harvest, grain weight and yield were identified. BC1F6 lines with higher grain weight and yield levels than the control were selected.

[0017] Step S7: Plant BC1F6 in plots, examine the comprehensive agronomic traits of the cultivars in the plots, harvest the superior plots and conduct yield assessment, select the plots with a yield level 5% higher than the control and proceed to the next generation of multi-point yield assessment.

[0018] in, QFhb-2DL The chain mark is as described in the first aspect of the present invention. QFhb-2DL The dcaps tag, QFhb-3BL The chain mark is as described in the first aspect of the present invention. QFhb-3BL The KASP marker used is the primer set described in the second aspect of this invention.

[0019] Preferably, in step S1, the donor is Yangmai 16, Yangmai 17, Yangmai 14, Yangmai 14-197 or Yangmai 39, and the recipient parent is Chuanmai 98, Chuanmai 93, Chuanmai 42 or Chuanmai 104.

[0020] Specifically, in step S3, the screening methods for disease resistance, tillering and lodging resistance of the BC1F2 generation are as follows: for disease resistance, Chuanong 32 is used as the standard, and single plants with disease resistance worse than Chuanong 32 are eliminated; for tillering, Chuanong 32 is used as the control, and single plants with fewer tillers per plant than Chuanong 32 are eliminated; for lodging resistance, plant height, stem elasticity and lodging resistance are examined, and single plants that are prone to lodging, have poor elasticity and are taller than 90cm are eliminated.

[0021] Preferably, in step S4, the concentration of the Fusarium spore solution is 2 × 10⁻⁶. 5 ~3×10 5 Spores / mL.

[0022] Specifically, in steps S5 and S6, the process of drip-inoculating individual flowers of the labeled rows with Fusarium head blight pathogens during the flowering period and retaining rows with identification results of "highly resistant-resistant" involves: preparing a Fusarium head blight spore suspension of 4×10⁻⁶. 5 ~5×10 5Spores / mL, in the field, during the wheat flowering period, the single-flower drip inoculation method was used. 20 ears were randomly selected from each row or line, and inoculated at the open florets in the middle of each ear, and marked. After inoculation, water was sprayed on the inoculated ears every 2 hours from 8:30 to 17:30 every day, spraying evenly and thoroughly onto the wheat ears for 10 minutes each time. Watering was stopped immediately 20 days after the wheat flowering. 21 days after inoculation, the disease incidence of the inoculated ears was investigated, counting the number of diseased spikelets per ear and the total number of spikelets. Rows or lines with a Fusarium head blight severity PSS ≤ 15% and a level close to the "high resistance-resistance" level of Sumai 3 were retained. Sumai 3 and Anong 8455 were used as resistant and susceptible controls, respectively, Yangmai 25 as a moderately resistant control, and Yangmai 13 as a moderately susceptible control.

[0023] Specifically, in steps S5, S6 and S7, the comprehensive agronomic traits of the selected plants, strains and varieties are examined as follows: plant height less than 90cm, good lodging resistance, number of ears per plant greater than or equal to 5, and number of grains per ear greater than or equal to 48.

[0024] Specifically, in steps S5, S6, and S7, the control is Chuan Nong 32.

[0025] Through the above technical solution, the present invention achieves the following beneficial effects:

[0026] 1. This invention is based on using genetic populations to locate Fusarium head blight resistance loci, followed by fine-tuning to further narrow down the physical interval of the target locus, eliminating linkage redundancy caused by a large initial localization interval. It is the first to develop a method that... QFhb-2DL Closely linked molecular markers QFhb-2D-dcaps and QFhb-3BL Tightly linked molecular markers KASP.3B.1 and KASP.3B.2 can accelerate the development of disease resistance sites. QFhb-2DL and QFhb-3BL Its application in wheat disease resistance breeding, and it can also be used for QFhb- 2DL and QFhb-3BL Gene cloning.

[0027] 2. The breeding method of this invention utilizes a Fusarium head blight resistant donor gene source. QFhb-2DL and QFhb-3BL It is different from known resistance sources such as Sumai 3 and Wangshuibai. Fhb1 The resistance genotypes are derived from the donor varieties Yangmai 4 and Yangmai 16, which have excellent agronomic traits. Studies have shown that combining the resistance genotypes of the two varieties can significantly improve resistance to Fusarium head blight. Therefore, using these two Fusarium head blight resistance loci can effectively improve the Fusarium head blight resistance of recipient wheat varieties from the upper reaches of the Yangtze River.

[0028] 3. This invention, while stabilizing the stripe rust resistance, short stalks, large ears, and multiple ears characteristics of wheat varieties from the upper reaches of the Yangtze River, utilizes molecular marker-assisted selection to rapidly identify Fusarium head blight resistance loci. QFhb-2DL and QFhb-3BL The disease-resistant genotype was introduced into wheat varieties from the upper reaches of the Yangtze River. Molecular marker detection methods are simple and rapid, allowing identification at the seedling stage, greatly reducing field work and improving the accuracy of Fusarium head blight resistance prediction.

[0029] Wheat varieties bred using the method of this invention can achieve a breakthrough in resistance to Fusarium head blight in the upper reaches of the Yangtze River, which is expected to overcome the problem of frequent Fusarium head blight and prevent the recurrence of the disease. Attached Figure Description

[0030] Figure 1 This is in Embodiment 1 of the present invention QFhb-2DL A schematic diagram of the amplification results of site-tightly linked molecular markers in candidate parents and offspring, with the arrows pointing to the positive bands of Fusarium head blight resistance genes;

[0031] Figure 2 This is in Embodiment 2 of the present invention TaFhb-3B Expression of the parental lines (Yangmai 16 and Zhongmai 85 as a comparison) and in the resistant-susceptible mixed pool without inoculation (0h), at 24h, 48h and 72h after inoculation;

[0032] Figure 3 This is in Embodiment 2 of the present invention QFhb-3BL A schematic diagram of the fine positioning results;

[0033] Figure 4 In Example 2 QFhb-3BL Genotyping map of tightly linked molecular markers developed after fine site localization;

[0034] Figure 5 This is a flowchart of the breeding method in Embodiment 3 of the present invention. Detailed Implementation

[0035] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0036] Example 1: Molecular marker-assisted selection of Fusarium head blight resistance sites QFhb-2DL Method establishment

[0037] The applicant used the Yangmai 4 / Yanzhan 1 and Yangmai 5 / Yanzhan 1 populations to discover Fusarium head blight resistance loci originating from both Yangmai 4 and Yangmai 5. QFhb-2DL The phenotypic contribution rate reached 11.14-37.39%. Using whole-genome sequencing results (BSA-seq) of the parental and RIL populations' resistance and susceptibility pools, and 30× resequencing results of 130 wheat varieties with significant differences in resistance and susceptibility, we explored... QFhb-2DL The study identified polymorphic sites in the QTL region and developed novel KASP markers based on flanking sequences. Using Yangmai 4 as the donor and Yanzhan 1 as the recipient, a backcross was performed to BC3F3. Molecular marker screening was used to eliminate interference from other Fusarium head blight resistance sites in the background varieties Yanzhan 1 and Yangmai 4, creating a fine-mapping population of 3409 individual plants. The novel KASP markers were used to screen for homozygotes and key recombinants in this population, identifying 10 key recombinants. Combined with two years of Fusarium head blight resistance phenotype identification results, [the study concluded that...]. QFhb-2DL The target region was narrowed down to 1108.70 kb. Five molecular markers (2D-8 to 2D-12) from the candidate region were then used to scan the Yangmai 4 / Yanzhan 1 RIL population. Combined with identification of Fusarium head blight resistance phenotypes from six environments, the analysis was repeated. QFhb-2DL Genetic linkage maps were constructed and mapped to locate new Fusarium head blight resistance loci closer to the target gene. The flanking sequences of the linkage markers at these loci, SEQ ID NO.1: TGGGTGGGGCTAAATGTGTAGAGTGSCTTTTCCAGGATCCACCGTGAGAATTAGCACTTTTTAGTGTCCGGACCAAAATAGTTGGTCTGGCCTTCTCTTTTTTTTTTTTTTCTTTGGATCCAACTCCCTCCGTCCCCTAAGGGCATGAGCAATGGGGGCAGCGGTAGCTGCCGCCCCCGATGCATCCAGCTAGGTATGGGAAAATTGATTTCT (S being C or G polymorphism), were used for dcaps marker development. Literature review and comparison with the wheat reference genome revealed newly developed... QFhb- The 2D-dcaps marker is unlike any previously reported molecular marker for resistance to Fusarium head blight. The specific primer sequence for QFhb-2D-dcaps is shown in Table 1.

[0038] Table 1. QFhb-2D-dcaps marker primer sequence information

[0039]

[0040] QFhb-2D-dcaps were detected by PCR amplification. The PCR amplification method was as follows: the PCR amplification system contained 5 μL of pure water + 5 μL of 2XTaq Mix + 0.2 μL each of upstream and downstream primers + 1 μL of DNA. The first step of the PCR amplification program was as follows: (1) 94℃ pre-denaturation for 3 min; (2) 94℃ denaturation for 30 s, 60℃ annealing for 45 s, 72℃ extension for 30 s, for a total of 34 cycles; (3) 72℃ extension for 10 min, and storage at 4℃. The second step was enzyme digestion of a 10 μL system containing 7.8 μL of pure water + 2 μL of buffer + 0.2 μL of enzyme, reacted at 37°C for 30 min. The fourth step was agarose gel: 3% agarose gel + 500 bp marker + 200V voltage and 220V current for 30 min. The target genotype was a band that could be digested by enzymes, identical to that of Yangmai 16, Yangmai 17, Yangmai 14, Yangmai 14-197, and Yangmai 39, and was selected as the chosen material. The susceptible genotype was not digestible by enzymes and was identical to that of Chuanmai 98. The effectiveness of the QFhb-2D-dcaps marker was subsequently verified. Table 2 shows the genotypic results of the breeding materials from the bio-breeding project and the results of the Fusarium head blight resistance phenotype identification for that year using QFhb-2D-dcaps. Table 3 shows the t-test results of the corresponding phenotypic values.

[0041] Table 2. Identification results of QFhb-2D-dcaps genotype and Fusarium head blight resistance phenotype of breeding materials.

[0042]

[0043] Note: R represents the disease-resistant genotype, namely Yangmai 4 genotype, and S represents the disease-susceptible genotype, namely Yanzhan 1 genotype.

[0044] Table 3. t-test results of phenotypic values ​​corresponding to QFhb-2D-dcaps

[0045]

[0046] Note: R represents the disease-resistant genotype, namely Yangmai 4 genotype, and S represents the disease-susceptible genotype, namely Yanzhan 1 genotype.

[0047] As shown in Tables 2 and 3, after QFhb-2D-dcaps marker testing, 29 varieties (lines) did not carry disease resistance allelic variation, while 22 varieties (lines) carried disease resistance allelic variation. The average disease incidence of spikelets with disease resistance allelic variation was 58.78% lower in the varieties (lines) carrying disease resistance allelic variation than in those without. p<0.01), which clearly distinguishes between resistant and susceptible materials. This indicates that the QFhb-2D-dcaps primer set and genotype detection system can be applied to molecular marker-assisted breeding of wheat for resistance to Fusarium head blight, and can be further used for the detection and screening of breeding materials.

[0048] Genomic DNA was extracted from candidate parental materials, single plant leaves, or mixed plant leaves involved in Example 3 using the CTAB method. The DNA was diluted to obtain a template solution with a concentration of approximately 30 ng / μL, and the wheat resistance loci were detected. QFhb- 2D-dcaps tags.

[0049] Figure 1 for QFhb-2DL A schematic diagram of the amplification results of tightly linked molecular markers in parents and offspring. The arrows indicate bands that can be cleaved by enzymes, representing disease-resistant genotypes, while the bands that cannot be cleaved by enzymes are consistent with the band of Chuanmai 98, representing disease-susceptible genotypes.

[0050] Example 2: Group Localization Using Fine Positioning QFhb-3BL And verify

[0051] The applicant used BSA-seq and BSR-seq (24h, 48h, and 72h post-inoculation) call SNPs from the RIL population of Yangmai 16 / Zhongmai 895 in a mixed pool of resistant and susceptible individuals, combined with 120K SNPs from the RIL population and three additional environmental phenotypes of resistance to Fusarium head blight, to clarify the target region for resistance to Fusarium head blight to 708.26-767.22 Mb, with flanking molecular markers SNP.708263716-SNP.767220336, a LOD value of 5.9, and a phenotypic contribution rate of 11.50%. This physical location is inconsistent with previously reported Fusarium head blight resistance loci and represents a new Fusarium head blight resistance region (as shown in Tables 4 and 5).

[0052] Table 4 QFhb-3BL Differentially expressed genes and SNP-enriched regions

[0053]

[0054] Table 5 QFhb-3BL Location results

[0055]

[0056] Then, using 30× resequencing of 56 wheat varieties and 660K SNPs from a natural population of 390 wheat varieties, we mined... QFhb-3BLEleven polymorphic loci were identified in the target region. These eleven polymorphic loci were developed into new KASP markers, named 3B-1 to 3B-11. Simultaneously, using Zhongmai 895 as the recipient and Yangmai 16 as the donor, a backcross was performed to BC2F2, constructing a fine-mapping population of 4310 individual plants. These 4310 individual plants and their parents were planted in the Fusarium head blight identification nursery of the Wanfu Experimental Base of the Jiangsu Lixiahe Agricultural Science Research Institute (Yangzhou, Jiangsu). The wheat sowing date in Yangzhou that year was set to October 20th. A randomized block design was used, with two rows and two replicates, 30 seeds per row, a row length of 1.5 m, and a row spacing of 0.23 m. Field fertilization and management followed local field cultivation practices. Genomic DNA was extracted using the CTAB method, and the fine-mapping population was analyzed, yielding 12 types of recombinants. During the wheat flowering period, 12 types of recombinant wheat and parent wheat were inoculated with Fusarium head blight pathogens via drip inoculation on individual flowers. Five ears per plant were inoculated, with the inoculation occurring at the open florets in the middle of each ear, and marked. From 8:30 AM to 5:30 PM daily, the inoculated ears were sprayed with water every two hours, evenly covering the wheat ears, for 10 minutes each time. Spraying was stopped immediately after 20 days of flowering. Twenty-one days after inoculation, the disease incidence was investigated in the inoculated ears, counting the number of diseased spikelets per ear and the total number of spikelets. The Fusarium head blight severity (PSS) was calculated as (number of diseased spikelets / total number of spikelets) × 100%. The parent wheat varieties Yangmai 16 and Zhongmai 895 were used as resistant and susceptible controls, respectively. The results showed that... QFhb- 3BL The interval was narrowed down to the 3B-8 to 3B-9 range, spanning physical locations from 748.33 to 754.72 Mb (e.g. Figure 2 (As shown). Validation using BSR-seq and RT at around 754.72 Mb in uninoculated and 24h, 48h, and 72h post-inoculation mixed pools of DH populations revealed a gene whose expression level significantly increased after inoculation with Fusarium graminearum. TaFhb-3B (like Figure 3As shown in the figure, after resequencing the Call SNPs at 30× and BSR-seq, PCR first-generation sequencing revealed differences in the promoter and coding regions of this gene between resistant and susceptible varieties. The flanking sequence of the differential SNP in the coding region is SEQ ID NO.4: CAAATTGTTGGCAGCAAAACTGTACGGTCGAAGCCCAGTTRAGGTAACAAGAAGACAACCCTTTTT (complementary sequence, R is G or A polymorphism). The resistant variety has the G base type, and the susceptible variety has the A base type. The flanking sequence of the differential SNP in the promoter region is SEQ ID NO.8 CCCAATCCGTCACCGAAAAAAGAAGAGAAAACGGAGAAACYAAGATAATCAGGTGAGTTGATCAGATAATTGTAGTCTGTAATTTTGGTCAACACTAAAAACGATTTTCTACCAAAGATTATCGTCCCATCAACT (Y is T or C polymorphism). The resistant variety has the T base type, and the susceptible variety has the C base type. Therefore, the KASP molecular marker primer sets for KASP.3B.1 and KASP.3B.2 were developed, and the information is shown in Table 6.

[0057] Table 6 QFhb-3BL KASP.3B.1 and KASP.3B.2 molecular markers in the region

[0058]

[0059] Note: Lowercase parts are adapter sequences. SEQ ID NO.5 and SEQ ID NO.6 are two competing forward primers of KASP.3B.1, and SEQ ID NO.7 is a reverse primer of KASP.3B.1. SEQ ID NO.9 and SEQ ID NO.10 are two competing forward primers of KASP.3B.2, and SEQ ID NO.11 is a reverse primer of KASP.3B.2.

[0060] Preparation of KASP-labeled primer working solution: Take 30 μL (100 μM) of upstream primer and 12 μL (100 μM) of downstream primer, respectively, and make up to 100 μL with sterile ultrapure water. Mix thoroughly to prepare the KASP-labeled primer working solution for later use.

[0061] PCR amplification reaction system: 2.2 μL of wheat DNA template to be tested (approximately 30 ng / μL), 0.06 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC Corporation, KBS-1016-002), and added to a final volume of 5 μL with sterile ultrapure water;

[0062] PCR reaction procedure: (1) Pre-denaturation at 95℃ for 10 min; (2) Denaturation at 95℃ for 20 s, followed by 45 s at 61-55℃ (decreasing by 0.6℃ per cycle), for a total of 10 cycles; (3) Denaturation at 95℃ for 20 s, followed by annealing at 55℃ for 45 s, for a total of 34 cycles; store at 20℃. A blank control (NTC) without template DNA was also included in the reaction system. One or more blank controls were set up for each plate.

[0063] Wheat seedlings were collected, and genomic DNA of the wheat was extracted using the CTAB method.

[0064] Using wheat genomic DNA as a template, PCR amplification was performed using the KASP primer set and PCR reagents described above to obtain PCR amplification products. The PCR reaction was performed on an ABI Veriti 384 PCR instrument (Thermo Fisher), and the fluorescence values ​​of the PCR amplification products were scanned and read using an Omega F SNP genotyping instrument (LGC Genomics Ltd, KBS-0024-002). The excitation wavelength for FAM was 485 nm, and the emission wavelength for VIC was 535 nm, and the emission wavelength for the system reference fluorescence ROX was 575 nm, and the emission wavelength for ROX was 610 nm. Genotyping was performed using Kluster Caller™ (KBioscience), and the results were used to determine the genotype. QFhb-3BL Genotype at the locus. A portion of the "Yangmai 16 × Zhongmai 895 DH line" along with two parents was amplified using the method described above. The fluorescence signal data of the amplified products, analyzed using Kluster Caller software, clustered near the X-axis (blue) in the fluorescence signal coordinate system of the genotyping results. This clustering was identical to that of Yangmai 16, indicating that the genotype of these wheat lines at the 41st base (SNP site) of the KASP-labeled flanking nucleotide sequences (original flanking sequences SEQ ID NO.4 and SEQ ID NO.8) was G (complementary) (SEQ ID NO.4) or T (SEQ ID NO.8). Conversely, the fluorescence signal data of the amplified products, analyzed using Kluster Caller software, clustered near the Y-axis (red) in the coordinate system, differing from the genotype of Yangmai 16. This indicates that the genotypes of these families at this SNP site were A (complementary) or C, respectively. Subsequently, the KASP.3B.1 and KASP.3B.2 markers were detected in 103 wheat varieties (lines), and the effectiveness of this fine-mapping region and the two developed markers was analyzed in conjunction with the Fusarium head blight resistance spread phenotype of the 103 wheat varieties (lines). The results are shown in Table 7.

[0065] Table 7. Genotypic and Fusarium head blight resistance phenotype identification results of KASP.3B.1 and KASP.3B.2 of 103 wheat varieties (lines).

[0066]

[0067] Note: R represents the disease-resistant genotype, namely Yangmai 16 genotype, and S represents the disease-susceptible genotype, namely Zhongmai 895 genotype.

[0068] Table 8. t-test results of phenotypic values ​​corresponding to different genotypes carrying KASP.3B.1 or KASP.3B.2.

[0069]

[0070] Note: R represents the disease-resistant genotype, namely Yangmai 16 genotype, and S represents the disease-susceptible genotype, namely Zhongmai 895 genotype.

[0071] As shown in Table 8, after testing with KASP.3B.1 or KASP.3B.2 markers, 65 varieties (lines) did not carry the resistance allelic variations of KASP.3B.1 or KASP.3B.2, while 38 varieties (lines) carried both KASP.3B.1 and KASP.3B.2 resistance allelic variations. The results indicate that KASP.3B.1 and KASP.3B.2 are highly linked, which is related to the fact that these two differentially expressed SNPs are located in the promoter and coding regions of the same gene. Varieties (lines) carrying both KASP.3B.1 and KASP.3B.2 resistance allelic variations had an average scab disease incidence rate 38.87% lower than those without KASP.3B.1 or KASP.3B.2 resistance allelic variations. p <0.001). This indicates that the primer sets and genotype detection system of KASP.3B.1 and KASP.3B.2 can be applied to molecular marker-assisted breeding of wheat resistance to Fusarium head blight, and can be further used for the detection and screening of breeding materials.

[0072] Figure 4 for QFhb-3BL A genotyping map of KASP.3B.1 or KASP.3B.2 markers developed after fine-mapping of the loci.

[0073] Example 3: Utilizing the major site of resistance to Fusarium head blight QFhb-2DL and QFhb-3BL Molecular breeding methods for improving wheat varieties in the upper reaches of the Yangtze River to resist Fusarium head blight

[0074] according to Figure 5 The process shown includes the following steps:

[0075] 1) Step S1, Parental lines: 390 wheat varieties from across the country were selected as research subjects. DNA was extracted from seeds or seedling leaves using the CTAB method, and molecular markers were used to screen for those carrying resistance loci to Fusarium head blight. QFhb-2DL and QFhb-3BL The disease-resistant allelic variant wheat varieties (lines) Yangmai 16 and Yang14-197 were selected, and Chuanmai 98, a short-stalked, large-eared, multi-eared wheat variety resistant to stripe rust from the upper reaches of the Yangtze River, was also selected. The selected parents were planted in an artificial climate chamber for hybridization, and F0 generation hybrids were harvested. The F0 generation hybrids were then planted in an artificial climate chamber to harvest F1, and F1 was then crossed with Chuanmai 98 to harvest BC1F1 seeds.

[0076] 2) Step S2: BC1F1 was planted in a greenhouse in Pixian County, Chengdu, Sichuan Province. Once seedlings emerged, they were tagged, leaves were taken, and DNA was extracted. QFhb-2DL and QFhb-3BL Linkage marker detection was performed, and BC1F1 single plants that were positive for both genes / locus (heterozygous or homozygous) were selected to harvest BC1F2.

[0077] 3) Step S3: Select BC1F2 in greenhouse cultivation in Pixian County, Chengdu, Sichuan Province, and utilize... QFhb-2DL and QFhb-3BL The linkage marker detection was used to select BC1F2 single plants that were positive (heterozygous or homozygous) for both genes / locus. The plants were then screened for tillering ability, lodging resistance, stripe rust resistance, and Fusarium head blight resistance. BC1F3 seeds were selected from the harvest.

[0078] 4) Step S4: Plant BC1F3 in fields in Pixian County, Chengdu, Sichuan Province, in rows. Each individual plant from the previous generation is planted in 5 rows, with a row length of 1.6m and a row spacing of 0.23m, containing 40 seeds per row. During the seedling stage, leaves from 10 individual plants per row are randomly selected, mixed, and DNA is extracted. QFhb-2DL and QFhb-3BL For linkage marker detection, BC1F3 single plants that are positive for both genes / locuses (heterozygous or homozygous) are selected and tagged. A Fusarium spore suspension of 2×10⁻⁶ is prepared. 5 ~3×10 5 Spores / mL: Fusarium head blight resistance was assessed by spraying marked individual plants with Fusarium head blight spore solution during the wheat flowering stage. Screening for disease resistance, tillering, and lodging resistance was conducted, specifically: using Chuanong 32 as a stripe rust control, plants with poorer stripe rust resistance at the seedling stage than Chuanong 32 were eliminated; using Yangmai 25 as a Fusarium head blight control, plants with a diseased ear rate ≥25% and a higher rate of diseased spikelets than Yangmai 25 were eliminated; plants with fewer tillers per plant than the control Chuanong 32 were also eliminated; plant height, stem elasticity, and lodging resistance were assessed, eliminating plants taller than 90cm, with poor elasticity, and prone to lodging. Seeds from the BC1F4 single plant were selected during harvest.

[0079] 5) Step S5: BC1F4 was planted in the field in Pixian County, Chengdu, Sichuan Province. Each plant was planted in 5 rows, with a row length of 1.6m and a row spacing of 0.23m, and 40 seeds per row. During the seedling stage, leaves from 10 individual plants per row were randomly selected, mixed, and DNA was extracted. QFhb-2DL and QFhb-3BL Linkage markers were used to detect BC1F4 plants in mixed samples. For plants with heterozygous mixed samples, further gene testing was performed on individual plants to determine the genotype of each BC1F4 plant at two gene / locus sites. A 4×10⁻⁶ gibberellic acid spore suspension was prepared. 5 ~5×10 5 Spores / mL. During the flowering stage of wheat, BC1F4 plants were individually inoculated with Fusarium head blight pathogen via drip inoculation. For plants with homozygous genotypes, 20 ears per row were inoculated; for plants with inconsistent genotypes, 20 ears of each genotype were inoculated. Inoculation was performed at the open florets in the middle of each ear, and the inoculated ears were marked. From 8:30 AM to 5:30 PM daily, the inoculated ears were sprayed with water every 2 hours, evenly covering the wheat ears, for 10 minutes each time. Spraying was stopped immediately 20 days after wheat flowering. Twenty-one days after inoculation, the disease incidence was investigated in the inoculated ears, counting the number of diseased spikelets per ear and the total number of spikelets. The Fusarium head blight severity (PSS) was calculated as (number of diseased spikelets / total number of spikelets) × 100%. Sumai 3 and Anong 8455 were used as resistant and susceptible controls, respectively. A comprehensive analysis of the individual plant genotypes of BC1F4 and the results of Fusarium head blight resistance spread was conducted to clarify the effect of gene combinations and to identify those carrying... QFhb-2DL and QFhb-3BL Disease-resistant allelic variations can reduce the average disease incidence rate of spikelets by 34.88% ( p <0.01) and 34.01% ( p <0.01), while carrying QFhb-2DL and QFhb- 3BL Disease-resistant allelic variation can reduce the average disease incidence rate of spikelets by 57.54% ( p <0.01 (as shown in Tables 9 and 10). Based on the identification of the plant rows, retain the individual plants or plant rows with the identification result of "resistant" (average disease spikelet rate ≤25%). Then, according to the breeding objectives, comprehensively examine the comprehensive agronomic traits and disease resistance of the selected plant rows or individual plants. Among the yield factors, the standard for excellence is that the number of spikes per plant is greater than or equal to 5 and the number of grains per spike is greater than or equal to 48. Select excellent plant rows (harvest 5-6 individual plants with consistent traits from plant rows with high homozygosity) and individual plants. After harvest, conduct grain weight and yield identification and select BC1F5 seeds with grain weight and yield levels higher than the control Chuan Nong 32.

[0080] Table 9 shows the genotype and phenotype results of some BC1F4 plants.

[0081]

[0082] Note: R represents the disease-resistant genotype, and S represents the disease-susceptible genotype.

[0083] Table 10 Breeding materials QFhb-2DL and QFhb-3BL Effect on the spread of Fusarium head blight

[0084]

[0085] Note: The lowercase letter after the average diseased spikelet rate indicates that a t-test was performed between the sample values; different lowercase letters indicate that... p It is significant at the <0.01 level.

[0086] 6) Step S6: Plant BC1F5 in the field in Pixian County, Chengdu, Sichuan Province, and cultivate it into mature plant lines. QFhb-2DL and QFhb-3BL Linkage marker detection was used to sample BC1F5 lines. Lines with homozygous positive results for both genes were selected and tagged. During the flowering period, individual flowers of the tagged lines were drip-inoculated with Fusarium head blight pathogens. Each line was inoculated with 15-20 panicles. Lines with the identification result of "resistant" (average diseased panicle rate ≤25%) were retained. The comprehensive agronomic traits and disease resistance of the selected lines were comprehensively evaluated. Among the yield factors, the number of panicles per plant greater than or equal to 5 and the number of grains per panicle greater than or equal to 48 were the criteria for excellence. Three excellent lines were selected. The selected lines were mixed and harvested. After harvest, grain weight and yield were evaluated. One BC1F6 line with grain weight and yield levels higher than the control Chuan Nong 32 was selected.

[0087] 7) Step S7: Plant BC1F6 in 2-centimeter plots in the field. Based on the breeding objectives, comprehensively examine the agronomic traits of the varieties in the plots. Among the yield factors, the standard for excellence is that the number of ears per plant is greater than or equal to 5 and the number of grains per ear is greater than or equal to 48. After harvesting the excellent plots, conduct yield evaluation. Select the variety whose yield level is 5.5% higher than that of the control Chuan Nong 32 and name it Chuan 23 Pin 3. Then proceed to the next generation of multi-point yield evaluation.

[0088] In a six-replicated assay in Yangzhou, the single-flower drip irrigation resistance of the Chuan 23 variety was evaluated to assess its resistance to Fusarium head blight spread. The results showed that the average diseased spikelet percentage of the recipient variety, Chuanmai 98, was 63.9%, while the average diseased spikelet percentage of Chuan 23 variety in the six replicates was 21.77%, a decrease of 18.68% compared to the control variety, Yangmai 25. p <0.05%, which reduced the average incidence of scab spikelets by scab by 65.93% compared to the recipient variety, Chuanmai 98. p <0.01 (Table 11).

[0089] The high-yielding wheat line Chuan 23 Pin 3, bred using the above methods, carries disease resistance and yield-enhancing genes / locus. Its resistance to Fusarium head blight is stable at the "resistant" level, and its yield is significantly higher than the control. These varieties (lines) and breeding technologies can reduce the use of pesticides for disease control during production, ensure the safety of grain production, and achieve green and efficient wheat yield increase.

[0090] Table 11. Fusarium head blight resistance performance of the new strain Chuan 23 (variety 3) in 6 replicates at the Yangzhou identification site.

[0091]

[0092] It can be seen that, utilizing QFhb-2DL and QFhb-3BL Linked markers can be used to breed high-yielding wheat varieties (lines) with high resistance to Fusarium head blight and high yield through molecular design and precise phenotypic identification of traits, greatly improving breeding efficiency and the precision of trait improvement.

[0093] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0094] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0095] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A molecular marker associated with wheat scab resistance, characterized in that, The molecular markers include QFhb-2DL dcaps tags and / or QFhb-3BL The KASP tag, the QFhb-2DL The sequence of the dcaps marker is shown in SEQ ID NO.1, and a G / C mutation exists at position 26 of SEQ ID NO.

1. QFhb-3BL The KASP marker consists of KASP.3B.1 and KASP.3B.2, wherein the sequence of KASP.3B.1 is shown in SEQ ID NO.4, and a G / A mutation exists at position 41 of SEQ ID NO.4; and the sequence of KASP.3B.2 is shown in SEQ ID NO.8, and a T / C mutation exists at position 41 of SEQ ID NO.

8.

2. The claim 1 QFhb-3BL The primer set used for the KASP marker is characterized by, It includes the KASP.3B.1 primer set and the KASP.3B.2 primer set, the sequences of which are shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, and the sequences of which are shown in SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO.

11.

3. The claim 1 QFhb-2DL The primer set used by the dcaps tag and QFhb-3BL The primer set used for the KASP marker is characterized by, The QFhb-2DL The sequences of the primer sets used for the dcaps markers are shown in SEQ ID NO.2 and SEQ ID NO.3; The QFhb-3BL The primer sets used for the KASP marker include the KASP.3B.1 primer set and the KASP.3B.2 primer set. The sequences of the KASP.3B.1 primer set are shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, and the sequences of the KASP.3B.2 primer set are shown in SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO.

11.

4. A method of utilizing QFhb-2DL and QFhb-3BL A method for improving wheat resistance to Fusarium head blight, characterized in that, Includes the following steps: Step S1, Select carrier sites QFhb-2DL Wheat varieties or lines with disease-resistant allelic variants and carriers QFhb-3BL Wheat varieties or lines with disease-resistant allelic variants are used as donors, and wheat varieties with stripe rust resistance, short stalks, large ears, and multiple ears are used as recipients. The two donor parents are crossed to obtain F0. F0 is planted and crossed with the recipient when it flowers to harvest BC1F1 seeds. Step S2: Plant BC1F1 seedlings. Once seedlings emerge, extract DNA from the leaves and use it for… QFhb-2DL and QFhb-3BL Linkage marker detection was performed, and BC1F1 plants that were positive at both sites were selected, and BC1F2 plants were harvested. Step S3, select BC1F2 in the planting, and use... QFhb-2DL and QFhb-3BL The linkage marker detection was used to select BC1F2 single plants that were positive at both sites for screening of tillering ability, lodging resistance, stripe rust resistance, and Fusarium head blight resistance. BC1F3 seeds were selected from the harvest. Step S4, plant BC1F3, and utilize QFhb-2DL and QFhb-3BL The linkage marker detection was performed, and BC1F3 single plants that were positive at both sites were selected. During the wheat flowering period, the single plants were sprayed with Fusarium spore liquid. Single plants with Fusarium spore disease rate ≥25% and disease spikelet rate greater than the control were eliminated. Single plants with poor stem elasticity, easy lodging, and plant height greater than 90cm were also eliminated. BC1F4 single plant seeds were selected during harvest. Step S5: Plant BC1F4 seedlings and extract leaf DNA during the seedling stage. QFhb-2DL and QFhb-3BL Linkage markers were used to detect mixed samples of BC1F4 plants. For plants that were heterozygous in the mixed samples, gene testing was performed on individual plants to determine the genotype of BC1F4 plants at two loci. During the flowering period, BC1F4 plants were inoculated with Fusarium head blight pathogen by drip inoculation. 21 days after inoculation, the genotype of individual BC1F4 plants and the results of Fusarium head blight resistance expansion were comprehensively analyzed. Individual plants or plants with the identification result of "high resistance-resistant" were retained. Then, the comprehensive agronomic traits of the selected plants or plants were comprehensively examined, and superior plants and plants were selected. After harvest, grain weight and yield were identified, and BC1F5 seeds with higher grain weight and yield levels than the control were selected. Step S6: Plant BC1F5 to cultivate a complete lineage, and utilize... QFhb-2DL and QFhb-3BL Linkage marker detection was used to sample BC1F5 lines. Lines with homozygous positive results at both loci were selected. During the flowering period, individual flowers of the lines were inoculated with Fusarium head blight pathogens. Lines with identification results of "high resistance-resistant" were retained. The comprehensive agronomic traits of the selected lines were comprehensively evaluated. The selected lines were harvested together. After harvest, grain weight and yield were identified. BC1F6 lines with higher grain weight and yield levels than the control were selected. Step S7: Plant BC1F6 in plots, examine the comprehensive agronomic traits of the cultivars in the plots, harvest the superior plots and conduct yield assessment, select the plots with a yield level 5% higher than the control and proceed to the next generation of multi-point yield assessment. in, QFhb-2DL The chain mark is as described in claim 1 or 2. QFhb-2DL The dcaps tag, QFhb-3BL The chain mark is as described in claim 1 or 2. QFhb-3BL The KASP marker is used, and the primer set is the primer set described in claim 3.

5. The method according to claim 4, characterized in that, In step S1, the donor is selected from Yangmai 16, Yangmai 17, Yangmai 14, Yangmai 4 and Yangmai 39, and the recipient is selected from Chuanmai 98, Chuanmai 93, Chuanmai 42 and Chuanmai 104.

6. The method according to claim 4, characterized in that, In step S3, the screening methods for disease resistance, tillering and lodging resistance of the BC1F2 generation are as follows: for disease resistance, Chuanong 32 is used as the standard, and single plants with worse disease resistance than Chuanong 32 are eliminated; for tillering, Chuanong 32 is used as the control, and single plants with fewer tillers per plant than Chuanong 32 are eliminated; for lodging resistance, plant height, stem elasticity and lodging resistance are examined, and single plants that are prone to lodging, have poor elasticity and are taller than 90cm are eliminated.

7. The method according to claim 4, characterized in that, In step S4, the concentration of the Fusarium wilt spore solution is 2 × 10⁻⁶. 5 ~3×10 5 Spores / mL.

8. The method according to claim 4, characterized in that, In steps S5 and S6, the specific steps for retaining plants that show "highly resistant to resistant" results after single-flower drip inoculation with the Fusarium head blight pathogen during the flowering period are as follows: Prepare a Fusarium head blight spore suspension of 4×10⁻⁶. 5 ~5×10 5 Spores / mL, in the field, during the wheat flowering period, the single-flower drip inoculation method was used. 20 ears were randomly selected from each row or line, and inoculated at the open florets in the middle of each ear, and marked. After inoculation, water was sprayed on the inoculated ears every 2 hours from 8:30 to 17:30 every day, spraying evenly and thoroughly onto the wheat ears for 10 minutes each time. Watering was stopped immediately 20 days after the wheat flowering. 21 days after inoculation, the disease incidence of the inoculated ears was investigated, counting the number of diseased spikelets per ear and the total number of spikelets. Rows or lines with a Fusarium head blight severity PSS ≤ 15% and a level close to the "high resistance-resistance" level of Sumai 3 were retained. Sumai 3 and Anong 8455 were used as resistant and susceptible controls, respectively, Yangmai 25 as a moderately resistant control, and Yangmai 13 as a moderately susceptible control.

9. The method according to claim 4, characterized in that, In steps S5, S6 and S7, the comprehensive agronomic traits of the selected plants, strains and varieties are comprehensively examined, specifically: plant height less than 90cm, good lodging resistance, number of ears per plant greater than or equal to 5, and number of grains per ear greater than or equal to 48.

10. The method according to claim 4, characterized in that, In steps S5, S6, and S7, the control is Chuan Nong 32.

Citation Information

Patent Citations

  • CN107988411A