Molecular marker for high-throughput identification of wheat scab site Qfhb7EL and application thereof

Abstract

The invention discloses a molecular marker for high-throughput identification of a wheat scab site Qfhb7EL and application of the molecular marker. The nucleotide sequences of primers of the molecular marker are as shown in SEQ ID No. 1 to SEQ ID No. 4. Specific primers are designed according to the homologous sequence of the Fhb7 gene in the triticum elongatum, the specific primers and the Actin gene of wheat form a primer pair, population typing is achieved under recognition of different fluorescence, and the reliability of the marker is verified through molecular experiments. Results show that the identification of the wheat scab-resistant site Qfhb7EL in the wheat background can be quickly and accurately realized in a high-throughput manner, and the method has a very high application value for auxiliary selection of new wheat scab-resistant varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of wheat genetic breeding, and in particular, relates to a method for high-throughput identification of wheat scab sites. QUR Molecular markers and their applications. Background Art

[0002] Fusarium head blight (FHB) is a fungal disease that can cause yield reductions in crops such as wheat, corn, and barley, and can also contaminate food, feed, and other products, posing a huge threat to food safety. Wheat Fusarium head blight resistance is controlled by multiple genes. Currently, more than 600 QTLs related to Fusarium head blight resistance have been located in wheat and its closely related species. 77 high-confidence QTLs were obtained through Meta-QTL analysis, but most of the QTLs have minor effects, and only 8 QTLs have been officially named internationally. Fb1 - F8 However, the only widely used method in wheat scab resistance breeding is Fb1 .

[0003] Fusarium fusarium resistance gene Fb7 , was cloned by Professor Kong Lingrang's team from the decaploid Elymus longipedus, and revealed that the GST encoded by it can catalyze DON and GSH to form a GSH-DON conjugate, thereby reducing the toxicity of DON and improving wheat resistance to Fusarium head blight. Fb7 The 7el2L chromosome fragment was introduced into wheat, which can improve wheat resistance to Fusarium head blight. Fb7 The 7el2L chromosome fragment has potential value in breeding for resistance to wheat fusarium ergot. Previously, studies have also found that the 7EL chromosome from the diploid Elymus elongatus also carries genes for resistance to wheat fusarium ergot, and that the introduction of the 7EL chromosome fragment into common wheat can also provide resistance to fusarium ergot, indicating that the 7EL chromosome fragment of the diploid Elymus elongatus also has potential value in breeding for resistance to wheat fusarium ergot.

[0004] Previously, the identification of 7EL was done by agarose gel electrophoresis, which is an electrophoresis technique commonly used in molecular biology research. Its principle is to separate and identify DNA by using the difference in the migration speed of charged molecules under the action of an electric field. Although agarose gel electrophoresis is simple to operate, it is particularly time-consuming when identifying thousands of materials. Therefore, the development of a method that can quickly and high-throughput identify the target gene is of great significance for the identification of 7EL. Summary of the invention

[0005] In view of the problem that the above-mentioned agarose electrophoresis method for identifying wheat 7EL chromosome fragments is time-consuming and labor-intensive, the present invention provides a method for high-throughput identification of wheat fusarium sites. QUR The molecular marker and its application can quickly identify the 7EL chromosome fragment with high throughput, providing a new molecular detection tool with practical value for breeding high-yield and high-quality wheat varieties and accelerating the breeding process.

[0006] In order to achieve the above object, the present invention provides a method for high-throughput identification of wheat scab sites. QUR The nucleotide sequences of the primers are shown in SEQ ID No.1-SEQ ID No.4.

[0007] SEQ ID No.1 (PARMS-Actin-HEX): GAAGGTCGGAGTCAACGGATTCAACTTGGCCTGACCTCATGT SEQ ID No.2 (PARMS-Actin-Common): GGCTACCTAACGATCAATCAGC SEQ ID No.3 (PARMS-Fhb7-FAM): GAAGGTGACCAAGTTCATGCTCTACACAACCACCTGGGTCAAG SEQ ID No.4 (PARMS-Fhb7-Common): GACGCTGCTGATGTCTGGC.

[0008] The present invention utilizes diploid Elytium longipedum Fb7 The homologous sequence of the gene was used to design specific primers, which were used to form primer pairs with the wheat Actin gene. The population typing was achieved under the recognition of different fluorescence, and the reliability of the marker was verified by molecular experiments. The results showed that the method proposed in the present invention can quickly, accurately and high-throughput realize the identification of wheat scab resistance loci in wheat background. QUR The identification of this pathogen has high application value in assisting the selection of new varieties resistant to wheat fusarium rust.

[0009] This molecular marker is tightly linked to the functional locus and has the advantages of high resolution and precise typing. It is very suitable for the efficient detection of excellent genotypes of large-scale genetic lines in breeding practice. It can also assist in the aggregation of multiple loci / genotypes of resistance to ergot and other excellent traits, and accelerate the selection of new wheat varieties with excellent comprehensive traits.

[0010] The second aspect of the present invention provides the use of the above-mentioned molecular markers in wheat scab resistance breeding.

[0011] The third aspect of the present invention provides a method for high-throughput identification of diploid Elytrigia elongata resistance to wheat scab QUR The method uses the above primers to perform PCR amplification on the DNA of the wheat material to be tested. If the wheat material to be tested has a fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer set, but does not contain the fluorescent group signal of the forward competitive primer PARMS-Fhb7-FAM, it is considered that the DNA extracted from the wheat material to be tested does not contain a site for resistance to fusarium head blight. QUR If the tested wheat material shows the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer set and the fluorescent group signal of the forward competitive primer PARMS-Fhb7-FAM, it is considered that the DNA extracted from the tested wheat material contains the site for resistance to fusarium head blight. QUR .

[0012] Specifically, the wheat material to be tested shows the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer set, but does not contain the signal value of the fluorescent group signal of the forward competitive primer PARMS-Fhb7-FAM, which is aggregated close to the Y-axis and displayed in green; the wheat material to be tested shows the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer set, and also shows the signal value of the fluorescent group signal of the forward competitive primer PARMS-Fhb7-FAM, which is aggregated close to the diagonal of the X-axis and the Y-axis and displayed in red.

[0013] Specifically, the PCR amplification reaction system includes: 5 μL of 2×PARMS master mix, 0.15 μL of 10 μM primer PARMS-Fhb7-FAM, 0.2 μL of 10 μM primer PARMS-Fhb7-Common, 0.15 μL of 10 μM primer PARMS-Actin-HEX, 0.2 μL of 10 μM primer PARMS-Actin -Common, 10-100 ng of genomic DNA, and finally supplemented to 10 μL with ddH2O.

[0014] Specifically, the PCR amplification program included: thermal activation at 94°C for 20 min; denaturation at 94°C for 20 s, annealing and extension at 65-57°C for 1 min, 10 touch-down cycles, with the temperature decreasing by 0.8°C each cycle; denaturation at 94°C for 20 s, annealing at 57°C for 1 min, and 32 cycles.

[0015] Through the above technical solution, the present invention achieves the following beneficial effects: The scab-resistant site provided by the present invention QURLocated at the end of chromosome 7EL of diploid Elymus elongatus, introducing this site into wheat can significantly improve wheat resistance to Fusarium head blight. The homologous sequence of the Fhb7 gene at this site was used to develop a marker suitable for the PARM system for identifying sites of Fusarium head blight resistance. QUR The developed markers have the characteristics of stable amplification, convenient and fast detection, and accurate and reliable results. They can be used for auxiliary breeding of wheat scab resistance, meet the needs of efficient detection of excellent genotypes of large-scale genetic lines in breeding practice, and are not limited by the growth and development cycle of crops, saving breeding costs and improving breeding efficiency. At the same time, they can also be used for the aggregation of multiple sites / genes for scab resistance to accelerate the selection and breeding of new varieties resistant to wheat scab. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The scab resistance site in Example 1 QUR The physical location of A: QUR Physical location of the site, B: QUR the molecular markers present in the locus; Figure 2 The diploid Elytium longipedum in Example 2 Fb7 Homologous sequence analysis; Figure 3 is the genotyping diagram of the PARMS primer set in Example 4, wherein A: the genotyping diagram of the PARMS primer set of the hybrid F3 generation of Yangmai 24 / Yangnongmai 158, B: the genotyping diagram of the PARMS primer set of the hybrid F3 generation of Yangmai 25 / Yangnongmai 158, C: the genotyping diagram of the PARMS primer set of the hybrid F3 generation of Yangmai 29 / Yangnongmai 158, D: the genotyping diagram of the PARMS primer set of the hybrid F3 generation of Yangmai 30 / Yangnongmai 158, E: the genotyping diagram of the PARMS primer set of the hybrid F3 generation of Yangmai 158 / Yangnongmai 158, F: the genotyping diagram of the PARMS primer set of the hybrid F3 generation of Ningmai 13 / Yangnongmai 158; Figure 4 It is Yangmai 24 / Yangnongmai 158 in Example 4 Fb7 Electrophoresis results of primer identification, where M: Marker; 1: 22-1; 2: 22-2; 3: 22-3; 4: 22-4; 5: 22-5; 6: 22-6; 7: 22-7; 8: 22-8; 9: 22-9; 10: 22-10; 11: Yangnongmai 158; 12: Yangmai 24; Figure 5The analysis of the resistance to fusarium head blight of the hybrid F3 of Yangmai 24 / Yangnongmai 158 in Example 4, wherein A: Statistical analysis of the diseased spikelet rate of the hybrid F3 of Yangmai 24 / Yangnongmai 158; B: phenotype of ear disease of the hybrid F3 of Yangmai 24 / Yangnongmai 158; C: Statistical analysis of the diseased spikelet rate of the hybrid F3 of Yangmai 25 / Yangnongmai 158; D: phenotype of ear disease of the hybrid F3 of Yangmai 25 / Yangnongmai 158; E: Statistical analysis of the diseased spikelet rate of the hybrid F3 of Yangmai 29 / Yangnongmai 158; F: phenotype of ear disease of the hybrid F3 of Yangmai 29 / Yangnongmai 158; G: Statistical analysis of the diseased spikelet rate of the hybrid F3 of Yangmai 30 / Yangnongmai 158; H: phenotype of ear disease of the hybrid F3 of Yangmai 30 / Yangnongmai 158; I: Statistical analysis of diseased spikelet rate in the F3 generation of Yangmai 158 / Yangnongmai 158 hybrid; J: ear disease phenotype in the F3 generation of Yangmai 158 / Yangnongmai 158 hybrid; K: Statistical analysis of diseased spikelet rate in the F3 generation of Ningmai 13 / Yangnongmai 158 hybrid; L: ear disease phenotype in the F3 generation of Ningmai 13 / Yangnongmai 158 hybrid. DETAILED DESCRIPTION

[0017] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0018] Example 1 Resistance to wheat scab QUR Positioning The applicant identified the resistance to fusarium scaber in the small translocation line carrying the 7EL chromosome of the diploid Elymus elongatum, and physically located the fusarium scaber resistance site by combining the 7EL chromosome-specific molecular markers developed by the research team. The results showed that there was a fusarium scaber resistance site at the end of the 7EL chromosome. QUR ( Figure 1 ). Molecular marker identification showed that there was Fb7 Location.

[0019] Example 2 Fb7 Amplification of homologous sequences DNA of the translocation line Yangnongmai 158 carrying the 7EL chromosome fragment of the diploid Elymus elongatus was extracted and cloned from it using the high-fidelity enzyme 2×Phanta Master Mix (Nanjing Novozyme Biotech Co., Ltd., Nanjing, China). Fb7 Gene, after sequencing and comparison, it was found that the amplified sequence was Fb7 Homologous sequences ( Figure 2 ).

[0020] Example 3 Design and identification of primers in PARMS For the amplified Fb7The homologous sequences of Actin gene and the sequence of Actin gene that can be stably expressed in wheat were selected, and multiple sets of amplification primers were designed using Primer Premier5, and the size of PCR products was controlled at about 100bp. The quality of the designed primers was evaluated using DNAMAN, and the primer specificity was further detected using the Ensembl Plants wheat genome database. Finally, the 5' end of the primer sequence that can specifically bind and meet the requirements of PCR amplification principles after screening was added with the fluorophore FAM and HEX sequences, and the primers were named PARMS-Fhb7-FAM / Common and PARMS-Actin-HEX / Common.

[0021] Example 4 Identification of 7EL chromosome fragments Utilizing loci carrying resistance to Fusarium head blight QUR The wheat-diploid Elymus longissima 7EL small fragment translocation line Yangnongmai 158 was prepared with common wheat Yangmai 24, Yangmai 25, Yangmai 29, Yangmai 30, Yangmai 159 and Ningmai 13 of different genetic backgrounds to construct hybrid combinations and segregating populations. In 2021, the F1 seeds of each combination were mixed and harvested. In 2022, 100 ears of each combination were randomly selected from the F2 generation and sown in the autumn of 2022. Each ear was planted in one row, with a row length of 1 meter and a row spacing of 0.3 meters. Sampling was carried out after emergence, with 12 plants per row, 1200 plants per combination, and a total of 7200 plants. Place leaves with a length and width of about 1 cm in a deep-well plate (96 wells, 1.2 mL); add 100 µL of 0.3 M sodium hydroxide and grind completely on a tissue grinder; after grinding, centrifuge at 3000 rpm for 1 min and boil in water for 2 min; add 200 µL of 0.2 M Tris-HCl (pH 6.8-7.0) and mix well, and boil in water for 2 min again; after the water bath, centrifuge at 3000 rpm for 1 min, take the supernatant and dilute it 20 times as a template for subsequent PCR amplification.

[0022] The PCR amplification reaction system was configured as required, and the ratio of each reagent was as follows: the total reaction volume was 10 μL, including: 5 μL of 2×PARMS master mix, 0.15 μL of 10 μM primer PARMS-Fhb7-FAM, 0.2 μL of 10 μM primer PARMS-Fhb7-Common, 0.15 μL of 10 μM primer PARMS-Actin-HEX, 0.2 μL of 10 μM primer PARMS-Actin -Common, 10-100 ng of genomic DNA, and finally made up to 10 μL with ddH2O. The prepared PCR system was placed in a PCR instrument for amplification. The specific procedure was as follows: 94°C heat activation for 20 min; 94°C denaturation for 20 s, 65-57°C annealing and extension for 1 min (10 touch-down cycles, 0.8°C lowered each cycle); 94°C denaturation for 20 s, 57°C renaturation for 1 min, 32 cycles. After PCR was completed, the fluorescence signal was read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results were output according to different colors.

[0023] If the tested wheat material has the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer set (the fluorescent signal value is aggregated close to the Y axis and the sample is displayed in green), but does not contain the fluorescent group signal of the forward competitive primer PARMS-Fhb7-FAM, it is considered that the DNA extracted from the tested wheat material has no problem with the quality and does not contain the site of resistance to Fusarium head blight. QUR If the tested wheat material shows the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer set, and also shows the fluorescent group signal of the forward competitive primer PARMS-Fhb7-FAM (the fluorescent signal value is aggregated close to the diagonal of the X-axis and the Y-axis, and the sample is displayed in red), it is considered that the DNA extracted from the tested wheat material has no problem with the quality and contains the site of resistance to ergot. QUR ( Figure 3 ).

[0024] In order to confirm the accuracy of the developed PARMS primer set, 10 materials were randomly selected from all samples and the primers were analyzed using the published Fb7 The results showed that the results of agarose gel electrophoresis were consistent with those of the developed PARMS primer set ( Figure 4and Table 1 ), further demonstrating that the PARMS primer set was accurate and not affected by the wheat background.

[0025] Table 1 PARMS primer sets and Fb7 Molecular marker results statistics

[0026] In order to clearly identify the resistance of the material to Fusarium head blight, the single flower drip method was used to identify the resistance of the sampled material to Fusarium head blight. Figure 5 As shown, the genes carrying resistance to Fusarium head blight in different wheat genetic backgrounds QUR The spikelet rate of wheat materials with disease was significantly lower than that of wheat materials without disease QUR The PARMS primer set developed by the present invention has the characteristics of stable amplification, convenient and fast detection with high throughput, accurate and reliable results, and is not affected by wheat genetic background, and can be used for auxiliary breeding of wheat scab resistance.

[0027] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0028] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0029] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for high-throughput identification of wheat fusarium scaly loci QUR A molecular marker characterized in that The nucleotide sequences of the primers are shown in SEQ ID No.1-SEQ ID No.

4.

2. Use of the molecular marker described in claim 1 in wheat breeding for resistance to ergot.

3. Used for high-throughput identification of loci of diploid Elytrigia elongata resistance to wheat fusarium scabra QUR The method is characterized in that include: The primers described in claim 1 are used to perform PCR amplification on the DNA of the wheat material to be tested. If the fluorescent group signal value of the wheat material to be tested is aggregated close to the Y axis and displays green, it is considered that the DNA extracted from the wheat material to be tested does not contain a site for resistance to ergot disease. QUR If the fluorescent group signal value of the wheat material to be tested is aggregated near the diagonal line of the X-axis and the Y-axis and displays red, it is considered that the DNA extracted from the wheat material to be tested contains a site for resistance to scab QUR .

4. The method according to claim 3, characterized in that The PCR amplification reaction system includes: 5 μL of 2×PARMS master mix, 0.15 μL of 10 μM primer PARMS-Fhb7-FAM, 0.2 μL of 10 μM primer PARMS-Fhb7-Common, 0.15 μL of 10 μM primer PARMS-Actin-HEX, 0.2 μL of 10 μM primer PARMS-Actin -Common, 10-100 ng of genomic DNA, and finally supplemented to 10 μL with ddH2O.

5. The method according to claim 3, characterized in that The PCR amplification program included: thermal activation at 94°C for 20 min; denaturation at 94°C for 20 s, annealing and extension at 65-57°C for 1 min, 10 touch-down cycles, with the temperature decreasing by 0.8°C each cycle; denaturation at 94°C for 20 s, annealing at 57°C for 1 min, and 32 cycles.

Images