Primers, kits and applications of MicroRNA markers for primary liver cancer

Abstract

The present invention relates to the field of medical testing technology, specifically to primers, kits and applications of MicroRNA markers for primary liver cancer, wherein the markers are miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921. The present invention assists in staging diagnosis of primary liver cancer by detecting the content of a specific combination of MicroRNA markers, and has the characteristics of non-invasiveness, accurate quantification, good sensitivity and specificity, etc.

Description

Technical Field

[0001] The present invention relates to the field of medical testing technology, in particular to primers, a kit and applications of MicroRNA markers for primary liver cancer. Background Art

[0002] Primary liver cancer is a serious public health problem. Clinically, liver cancer is usually divided into four stages (I-IV), corresponding to the very early stage, early stage, advanced stage and terminal late stage. If the patient can be actively treated in the very early and early stages, such as surgical resection or local ablation therapy, the patient's prognosis is good, and the five-year survival rate can usually reach 80% to 90%. This is because small liver cancers usually do not invade blood vessels or have distant metastases, so the treatment effect is better. However, for mid- and late-stage liver cancer, especially when the cancer has spread to parts outside the liver or there are multiple tumors, the possibility of cure is greatly reduced, and the five-year survival rate of advanced liver cancer is usually less than 10%, or even lower. Therefore, accurate early diagnosis of liver cancer is particularly important.

[0003] In China, many patients are already in the middle or late stages of liver cancer when they are diagnosed. It is estimated that only about 20% to 30% of liver cancer patients can be detected in the early stages of the disease. On the one hand, this is because liver cancer often lacks obvious symptoms in the early stages, and patients only have mild discomfort, such as fatigue, loss of appetite and other non-specific symptoms, which are easily ignored or mistaken for other milder health problems. On the other hand, the main means currently used for liver cancer screening, such as ultrasound examination and alpha-fetoprotein (AFP) detection in the blood, still have major technical defects. AFP is a classic liver cancer tumor marker, but about 30% of liver cancer patients have normal AFP levels, and 18% of liver cancer patients have low-level elevated AFP, so the specificity and sensitivity are not high. The detection rate of liver cancer by ultrasound examination is affected by the operator's experience and the quality of the equipment, and these examinations usually require a sufficiently large tumor to be found on the liver to detect it. Therefore, there is an urgent need for an innovative method that can completely replace or assist the above traditional methods for liver cancer screening and staging diagnosis. Summary of the invention

[0004] In order to solve the defects in the prior art, the present invention provides a primer, a kit and an application of a MicroRNA marker for primary liver cancer, which assists in the staging diagnosis of primary liver cancer by detecting the content of a specific combination of MicroRNA markers (miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921), and has the characteristics of being non-invasive, accurate in quantification, and having good sensitivity and specificity.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides a use of a MicroRNA marker for primary liver cancer in the preparation of a reagent or a detection tool for detecting primary liver cancer, wherein the marker is miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921.

[0007] Preferably, the reagent or detection tool determines the extent of liver cancer in the subject by detecting the content of the marker in the biological sample of the subject.

[0008] Preferably, the marker is derived from exosomes.

[0009] Preferably, the exosomes are derived from peripheral blood serum or plasma.

[0010] In a second aspect, the present invention provides a use of primers for detecting the MicroRNA marker in preparing a reagent or a detection tool for detecting primary liver cancer.

[0011] In a third aspect, the present invention provides a reverse transcription primer and a detection primer for detecting MicroRNA markers for primary liver cancer, wherein the markers are miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921;

[0012] The reverse transcription primers are:

[0013] The reverse transcription primer sequence (5′-3′) of miR-323a-5p is shown in SEQ ID NO. 1, and the sequence is GTCGTATCCAGTGCCACACGTCCTCGAGGCTTAAGCACTGGATACGACGCGAACGC;

[0014] The reverse transcription primer sequence (5′-3′) of miR-2276-5p is shown in SEQ ID NO. 2, and the sequence is GTCGTATCCAGTGCGAGCCGTTGAGACCGCAAGTGCACTGGATACGACCGTCTGCAA;

[0015] The reverse transcription primer sequence (5′-3′) of miR-4295 is shown in SEQ ID NO. 3, and the sequence is GTCGTATCCAGTGCGAGCCGTTGAGACCGCAAGTGCACTGGATACGACAAGGAAAA;

[0016] The reverse transcription primer sequence (5′-3′) of miR-2467-3p is shown in SEQ ID NO. 4, and the sequence is GTCGTATCCAGTGCCACACGTCCTCGAGGCTTAAGCACTGGATACGACCCTGAGCC;

[0017] The reverse transcription primer sequence (5′-3′) of miR-921 is shown in SEQ ID NO. 5, and the sequence is GTCGTATCCAGTGCAGTGTCAGAGGTAGTCGCACTGGATACGACGAATCCTG;

[0018] The detection primers are:

[0019] The forward primer sequence (5 '-3 ') of miR-323a-5p is shown in SEQ ID NO. 6, and the sequence is AGACAGGTGGTCCGTGGC;

[0020] The reverse primer sequence (5′-3′) of miR-323a-5p is shown in SEQ ID NO. 7, and the sequence is GTATCCAGTGCCACACGTCCTC;

[0021] The forward primer sequence (5 '-3 ') of miR-2276-5p is shown in SEQ ID NO. 8, and the sequence is AATGCGCCCTCTGTCACC;

[0022] The reverse primer sequence (5′-3′) of miR-2276-5p is shown in SEQ ID NO. 9, and the sequence is ATCCAGTGCGAGCCGTTG;

[0023] The forward primer sequence (5′-3′) of miR-4295 is shown in SEQ ID NO. 10, and the sequence is AAGCCAGTGCAATGT;

[0024] The reverse primer sequence (5′-3′) of miR-4295 is shown in SEQ ID NO. 11, and the sequence is ATCCAGTGCGAGCCGTTG;

[0025] The forward primer sequence (5′-3′) of miR-2467-3p is shown in SEQ ID NO. 12, and the sequence is TCTATAGCAGAGGCAGAGA;

[0026] The reverse primer sequence (5′-3′) of miR-2467-3p is shown in SEQ ID NO. 13, and the sequence is GTATCCAGTGCCACACGTCCTC;

[0027] The forward primer sequence (5′-3′) of miR-921 is shown in SEQ ID NO. 14, and the sequence is ATTGCCTAGTGAGGGACAGAAC;

[0028] The reverse primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.15, and the sequence is CAGTGCAGTGTCAGAGGTAGTCG.

[0029] In a fourth aspect, the present invention provides a use of the reverse transcription primer and the detection primer in the preparation of a reagent or a detection tool for detecting primary liver cancer.

[0030] In a fifth aspect, the present invention provides a diagnostic kit for primary liver cancer, the kit comprising reagents for detecting the expression levels of the markers miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921.

[0031] Preferably, the diagnostic kit comprises a reverse transcription primer and a detection primer for the marker, and the reverse transcription primer is:

[0032] The reverse transcription primer sequence (5 '-3 ') of miR-323a-5p is shown in SEQ ID NO.1;

[0033] The reverse transcription primer sequence (5 '-3 ') of miR-2276-5p is shown in SEQ ID NO.2;

[0034] The reverse transcription primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.3;

[0035] The reverse transcription primer sequence (5'-3') of miR-2467-3p is shown in SEQ ID NO.4;

[0036] The reverse transcription primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.5;

[0037] The detection primers are:

[0038] The forward primer sequence (5'-3') of miR-323a-5p is shown in SEQ ID NO.6;

[0039] The reverse primer sequence (5 '-3 ') of miR-323a-5p is shown in SEQ ID NO.7;

[0040] The forward primer sequence (5'-3') of miR-2276-5p is shown in SEQ ID NO.8;

[0041] The reverse primer sequence (5'-3') of miR-2276-5p is shown in SEQ ID NO.9;

[0042] The forward primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.10;

[0043] The reverse primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.11;

[0044] The forward primer sequence (5'-3') of miR-2467-3p is shown in SEQ ID NO.12;

[0045] The reverse primer sequence (5′-3′) of miR-2467-3p is shown in SEQ ID NO.13;

[0046] The forward primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.14;

[0047] The reverse primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.15.

[0048] Preferably, the diagnostic kit further comprises a PCR reaction reagent.

[0049] The beneficial effects of the present invention are:

[0050] The present invention adopts the MicroRNA markers of miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921 to perform staging diagnosis of primary liver cancer, which is non-invasive, easy to detect, and quantitatively accurate, thereby improving the sensitivity and specificity of primary liver cancer diagnosis.

[0051] The markers of the present invention are derived from exosomes in peripheral blood serum or plasma. Since the miRNA in the exosomes has a phospholipid bilayer membrane structure, the miRNA is not affected by the external environment and has better stability during detection. Therefore, the present invention has good application prospects in the diagnosis of liver cancer.

[0052] The present invention utilizes reverse transcription primers and detection primers of miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921 markers to detect the content of primary liver cancer MicroRNA markers, and adopts a formula to evaluate the staging grade of primary liver cancer of the subject with high accuracy and strong specificity.

[0053] The kit of the present invention is a kit based on a digital PCR platform, which can timely, accurately and specifically assist in the diagnosis and staging of liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 ROC curves for the diagnosis of healthy subjects and patients with stage I-IV liver cancer using markers;

[0055] Figure 2 Figure 2 is the ROC curve for using markers to diagnose patients with stage I-II and stage III-IV liver cancer. DETAILED DESCRIPTION

[0056] In order to enable those skilled in the art to better understand the technical solution of the invention, the present invention is further described in detail below in conjunction with specific implementation methods.

[0057] Example 1

[0058] This embodiment provides a diagnostic kit for primary liver cancer, the kit is used to detect the content of MicroRNA markers in exosomes of peripheral blood serum / plasma; the markers are miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921; the kit includes reverse transcription primers and detection primers of the markers;

[0059] The reverse transcription primers are:

[0060] The reverse transcription primer sequence (5 '-3 ') of miR-323a-5p is shown in SEQ ID NO.1;

[0061] The reverse transcription primer sequence (5 '-3 ') of miR-2276-5p is shown in SEQ ID NO.2;

[0062] The reverse transcription primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.3;

[0063] The reverse transcription primer sequence (5'-3') of miR-2467-3p is shown in SEQ ID NO.4;

[0064] The reverse transcription primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.5;

[0065] The detection primers are:

[0066] The forward primer sequence (5'-3') of miR-323a-5p is shown in SEQ ID NO.6;

[0067] The reverse primer sequence (5 '-3 ') of miR-323a-5p is shown in SEQ ID NO.7;

[0068] The forward primer sequence (5'-3') of miR-2276-5p is shown in SEQ ID NO.8;

[0069] The reverse primer sequence (5'-3') of miR-2276-5p is shown in SEQ ID NO.9;

[0070] The forward primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.10;

[0071] The reverse primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.11;

[0072] The forward primer sequence (5'-3') of miR-2467-3p is shown in SEQ ID NO.12;

[0073] The reverse primer sequence (5′-3′) of miR-2467-3p is shown in SEQ ID NO.13;

[0074] The forward primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.14;

[0075] The reverse primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.15.

[0076] Example 2

[0077] (1) Collect plasma, separate and purify exosomes, and extract total miRNA

[0078] About 3 ml of venous blood was collected and centrifuged at 2000 g for 10 min at 4°C to separate the upper plasma part, and then centrifuged at 12000 g for 20 min at 4°C to collect the upper plasma sample;

[0079] Take 1 ml of plasma and use MCE's Exosome Isolation and Purification Kit (from plasma and serum) to extract and purify exosomes;

[0080] About 200ul of exosome sample was taken and miRNA was extracted using QIAGEN's exoRNeasy Kits. Note that 10ul of quality control product should be added before extraction. After extraction, the concentration was measured and the total extracted miRNA concentration was adjusted to 20~40ng / ul.

[0081] (2) Using the obtained miRNA and reverse transcription primers to configure a reverse transcription reaction system, and performing a reverse transcription reaction to obtain a miRNA reverse transcription sample.

[0082] The miRNA reverse transcription reaction system is shown in Table 1 (a separate tube is configured for each detection of miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921).

[0083] Table 1. Reverse transcription reaction system of miRNA and quality control products

[0084]

[0085] In Table 1, the five miRNA reverse transcription primers are:

[0086] The reverse transcription primer sequence (5 '-3 ') of miR-323a-5p is shown in SEQ ID NO.1;

[0087] The reverse transcription primer sequence (5 '-3 ') of miR-2276-5p is shown in SEQ ID NO.2;

[0088] The reverse transcription primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.3;

[0089] The reverse transcription primer sequence (5'-3') of miR-2467-3p is shown in SEQ ID NO.4;

[0090] The reverse transcription primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.5.

[0091] The quality control products in Table 1 are: 5×10 4The sequence (5'-3') of cel-miRNA-39 at 10 copies / ul is shown in SEQ ID NO.16, which is UCACCGGGUGUAAAUCAGCUUG; the reverse transcription primer sequence (5'-3') of the quality control product is shown in SEQ ID NO.17, which is: GTCGTATCCAGTGCAGTGTCAGAGGTAGTCGCACTGGATACGACCAAGCTGA.

[0092] The reverse transcription reaction was carried out according to the conditions in Table 2, and 4°C indicated completion of the reaction.

[0093] Table 2. Reverse transcription reaction conditions for miRNA and quality control products

[0094]

[0095] (3) Using the obtained miRNA reverse transcription sample and detection primers to configure a miRNA digital PCR detection reaction system, prepare digital PCR reaction droplets, and perform a digital PCR reaction.

[0096] The miRNA digital PCR detection reaction system is shown in Table 3 (a separate tube is configured for each detection of miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921).

[0097] Table 3. miRNA digital PCR detection reaction system

[0098]

[0099] The detection primers for the five miRNAs in Table 3 are:

[0100] The forward primer sequence (5'-3') of miR-323a-5p is shown in SEQ ID NO.6;

[0101] The reverse primer sequence (5 '-3 ') of miR-323a-5p is shown in SEQ ID NO.7;

[0102] The forward primer sequence (5'-3') of miR-2276-5p is shown in SEQ ID NO.8;

[0103] The reverse primer sequence (5'-3') of miR-2276-5p is shown in SEQ ID NO.9;

[0104] The forward primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.10;

[0105] The reverse primer sequence (5'-3') of miR-4295 is shown in SEQ ID NO.11;

[0106] The forward primer sequence (5'-3') of miR-2467-3p is shown in SEQ ID NO.12;

[0107] The reverse primer sequence (5′-3′) of miR-2467-3p is shown in SEQ ID NO.13;

[0108] The forward primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.14;

[0109] The reverse primer sequence (5'-3') of miR-921 is shown in SEQ ID NO.15.

[0110] The detection primers for the quality control products in Table 3 are:

[0111] The forward primer sequence (5'-3') is shown in SEQ ID NO. 18, which is AGGCTCACCGGGTGTAAAT;

[0112] The reverse primer sequence (5'-3') is shown in SEQ ID NO. 19, which is GCAGTGCAGTGTCAGAGGTAGTC.

[0113] The configured reaction system was used to prepare digital PCR reaction droplets, which were then transferred to a 96-well plate for PCR reaction. The reaction conditions are shown in Table 4.

[0114] Table 4. Digital PCR reaction conditions

[0115]

[0116] After the reaction, transfer the 96-well plate to the QX200™ digital PCR reader to read the results.

[0117] (4) Calculation of results

[0118] 1) Calculation of quality control products: Assuming that the total RNA sample dissolution volume after extraction is A μL, and the Bio-rad QX200 digital PCR test result is B copies / μL, the concentration of the quality control product (X copies / μL) is calculated according to the following formula (1):

[0119] X copy number / μL = (B×20 / 3×15 / 3×A) / 10 = 10 / 3×A×B (1)

[0120] 2) The test results of quality control products should meet the following requirements: 4×10 4~5×10 4 copies / ul, if the value is met, the miRNA detection result of the sample is valid, otherwise the experiment is invalid and needs to be re-extracted for detection.

[0121] 3) If the quality control product results are qualified, the concentration of the target miRNA in the plasma sample (Y copies / μL) is calculated according to the following formula (2):

[0122] Y copy number / μL=(B×20 / 3×15 / 3×A) / 200=1 / 6×A×B(2)

[0123] (5) Risk assessment

[0124] First, calculate the P1 value according to the following formulas (3) and (4):

[0125] P1=e s1 / (1+e s1 )(3)

[0126] S1=5.21+0.025×m1-0.016×m2+0.017×m3-0.033×m4+0.054×m5 (4)

[0127] Among them, m1 is the content of miR-323a-5p in the sample; m2 is the content of miR-2276-5p in the sample; m3 is the content of miR-4295 in the sample; m4 is the content of miR-2467-3p in the sample; and m5 is the content of miR-921 in the sample.

[0128] When P1<0.419, it means that the subject has a low risk of liver cancer; when P1>0.419, it means that the subject has a certain risk of liver cancer.

[0129] Patients who are rated as having a certain risk of liver cancer can be further evaluated for their risk of very early and early (stage I-stage II) or advanced and terminal (stage III-stage IV) stages, and the P2 value can be calculated according to formulas (5) and (6):

[0130] P2=e s2 / (1+e s2 )(5)

[0131] S2=1.627+0.071×m1-0.037×m2+0.052×m3-0.042×m4+0.084×m5 (6)

[0132] Among them, m1 is the content of miR-323a-5p in the sample; m2 is the content of miR-2276-5p in the sample; m3 is the content of miR-4295 in the sample; m4 is the content of miR-2467-3p in the sample; and m5 is the content of miR-921 in the sample.

[0133] When P2<0.402, it means that the subject has a high risk of developing very early and early stages (stage I-stage II); when P2>0.402, it means that the subject has a high risk of developing progressive and terminal late stages (stage III-stage IV).

[0134] Example 3

[0135] 104 healthy people without liver cancer, 10 patients with stage I, 35 patients with stage II, 41 patients with stage III, and 19 patients with stage IV liver cancer were included. Their plasma was collected according to the method of Example 2, and the exosomes were separated and purified. The total miRNA in the exosomes was extracted and digital PCR reaction was performed. After the reaction, the P1 or P2 value was calculated according to the risk assessment steps, and then the data was analyzed.

[0136] Effect data: GraphPad Prism software was used for analysis to obtain the ROC curve of the test control, see Figure 1 and Figure 2 . Figure 1 AUC = 0.89, sensitivity = 96.2%, specificity = 62.5% for distinguishing healthy subjects from patients with stage I-IV HCC; Figure 2 The AUC for distinguishing patients in stages I-II from those in stages III-IV was 0.84, with a sensitivity of 81.7% and a specificity of 71.1%.

[0137] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Use of a MicroRNA marker for primary liver cancer in the preparation of a reagent or a detection tool for detecting primary liver cancer, characterized in that: The marker is a combination of miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921, and the marker is derived from exosomes.

2. The use according to claim 1, characterized in that: The exosomes are derived from peripheral blood serum or plasma.

3. The use according to any one of claims 1 to 2, characterized in that: The reagent or detection tool determines the degree of liver cancer in the subject by detecting the content of the marker in the biological sample of the subject.

4. Use of a primer for detecting the MicroRNA marker according to claim 1 in preparing a reagent or a detection tool for detecting primary liver cancer.

5. A reverse transcription primer and a detection primer for detecting a MicroRNA marker for primary liver cancer, characterized in that: The marker is a combination of miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921; The reverse transcription primers are: The sequence of the reverse transcription primer of miR-323a-5p from the 5' end to the 3' end is shown in SEQ ID NO.1; The sequence of the reverse transcription primer of miR-2276-5p from the 5' end to the 3' end is shown in SEQ ID NO.2; The sequence of the reverse transcription primer of miR-4295 from the 5' end to the 3' end is shown in SEQ ID NO. 3; The sequence of the reverse transcription primer of miR-2467-3p from the 5' end to the 3' end is shown in SEQ ID NO.4; The sequence of the reverse transcription primer of miR-921 from the 5' end to the 3' end is shown in SEQ ID NO.5; The detection primers are: The sequence of the forward primer of miR-323a-5p from the 5' end to the 3' end is shown in SEQ ID NO.6; The sequence of the reverse primer of miR-323a-5p from the 5' end to the 3' end is shown in SEQ ID NO.7; The sequence of the forward primer of miR-2276-5p from the 5' end to the 3' end is shown in SEQ ID NO.8; The sequence of the reverse primer of miR-2276-5p from the 5' end to the 3' end is shown in SEQ ID NO.9; The sequence of the forward primer of miR-4295 from the 5' end to the 3' end is shown in SEQ ID NO. 10; The sequence of the reverse primer of miR-4295 from the 5' end to the 3' end is shown in SEQ ID NO.11; The sequence of the forward primer of miR-2467-3p from the 5' end to the 3' end is shown in SEQ ID NO.12; The sequence of the reverse primer of miR-2467-3p from the 5' end to the 3' end is shown in SEQ ID NO. 13; The sequence of the forward primer of miR-921 from the 5' end to the 3' end is shown in SEQ ID NO. 14; The sequence of the reverse primer of miR-921 from the 5' end to the 3' end is shown in SEQ ID NO.

15.

6. Use of the reverse transcription primer and detection primer according to claim 5 in preparing a reagent or a detection tool for detecting primary liver cancer.

7. A diagnostic kit for primary liver cancer, characterized in that: The kit includes reagents for detecting the expression levels of the markers miR-323a-5p, miR-2276-5p, miR-4295, miR-2467-3p and miR-921; the kit includes reverse transcription primers and detection primers for the markers, and the reverse transcription primers are: The sequence of the reverse transcription primer of miR-323a-5p from the 5' end to the 3' end is shown in SEQ ID NO.1; The sequence of the reverse transcription primer of miR-2276-5p from the 5' end to the 3' end is shown in SEQ ID NO.2; The sequence of the reverse transcription primer of miR-4295 from the 5' end to the 3' end is shown in SEQ ID NO. 3; The sequence of the reverse transcription primer of miR-2467-3p from the 5' end to the 3' end is shown in SEQ ID NO.4; The sequence of the reverse transcription primer of miR-921 from the 5' end to the 3' end is shown in SEQ ID NO.5; The detection primers are: The sequence of the forward primer of miR-323a-5p from the 5' end to the 3' end is shown in SEQ ID NO.6; The sequence of the reverse primer of miR-323a-5p from the 5' end to the 3' end is shown in SEQ ID NO.7; The sequence of the forward primer of miR-2276-5p from the 5' end to the 3' end is shown in SEQ ID NO.8; The sequence of the reverse primer of miR-2276-5p from the 5' end to the 3' end is shown in SEQ ID NO.9; The sequence of the forward primer of miR-4295 from the 5' end to the 3' end is shown in SEQ ID NO. 10; The sequence of the reverse primer of miR-4295 from the 5' end to the 3' end is shown in SEQ ID NO.11; The sequence of the forward primer of miR-2467-3p from the 5' end to the 3' end is shown in SEQ ID NO.12; The sequence of the reverse primer of miR-2467-3p from the 5' end to the 3' end is shown in SEQ ID NO. 13; The sequence of the forward primer of miR-921 from the 5' end to the 3' end is shown in SEQ ID NO. 14; The sequence of the reverse primer of miR-921 from the 5' end to the 3' end is shown in SEQ ID NO.

15.

8. The diagnostic kit according to claim 7, characterized in that The kit also includes PCR reaction reagents.

Images