Novel oligonucleotides

Oligonucleotides targeting the 3' UTR of HNRNPD mRNA disrupt the autoregulatory feedback loop between HNRNPD and miR-141-3p/miR-146b-5p, effectively reducing senescence and associated markers in cells, offering a safer and more specific treatment for age-related diseases.

WO2025202340A2PCT designated stage Publication Date: 2025-10-02SENISCA LTD
View PDF 61 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/058355
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-26
Filing Date
2025-03-26
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Existing treatments for cellular senescence, such as those targeting miR-141-3p, are non-specific and risk off-target effects, failing to address the interaction between HNRNPD and its upstream regulators, which contributes to senescence and age-related diseases.

Method used

Oligonucleotides specifically target the 3' untranslated region (UTR) of HNRNPD mRNA to block inhibitory miRNA binding sites, disrupting the autoregulatory feedback loop between HNRNPD and miR-141-3p/miR-146b-5p, thereby regulating HNRNPD expression within physiological limits.

Benefits of technology

This targeted approach reduces senescence and associated markers in various cell types, including primary lung fibroblasts and retinal endothelial cells, with efficacy comparable to standard drugs like nintedanib and pirfenidone, while minimizing off-target effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000058_0001
    Figure IMGF000058_0001
  • Figure IMGF000059_0001
    Figure IMGF000059_0001
  • Figure IMGF000059_0002
    Figure IMGF000059_0002
Patent Text Reader

Abstract

The invention relates to novel oligonucleotides and their use in inhibiting or reducing senescence. The oligonucleotides target specific sequences in the 3' untranslated region (UTR) of heterogeneous nuclear ribonucleoprotein D (HNRNPD) mRNA and blocks one or more inhibitory microRNA (miRNA) binding sites. This promotes the physiologically regulated expression of HNRNPD and reduces senescence.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] NOVEL OLIGONUCLEOTIDES

[0002] TECHNICAL FIELD

[0003] The invention relates to novel oligonucleotides and their use in inhibiting or reducing senescence. The oligonucleotides target specific sequences in the 3' untranslated region (UTR) of heterogeneous nuclear ribonucleoprotein D HNRNPD') mRNA and blocks one or more inhibitory microRNA (miRNA) binding sites. This promotes the physiologically regulated expression of HNRNPD and reduces senescence.

[0004] BACKGROUND

[0005] Senescent cells are viable and metabolically active but have lost the ability to proliferate. They have been shown to accumulate during the ageing process in multiple tissues and in multiple species. Senescent cells release a cocktail of pro-inflammatory cytokines and remodelling proteins termed the senescence-associated secretory phenotype (SASP), which triggers the establishment of senescence in neighbouring cells in a paracrine manner and acts to further stimulate inflammation in surrounding tissues. Mounting evidence suggests that the increased senescent cell load contributes directly to organismal ageing and age- related diseases and conditions. Understanding the fundamental biology of cellular senescence, and importantly the factors that contribute to it, is thus of key importance. Once such factors are identified, it is possible to develop novel inhibitors that may be used in the treatment and prevention of diseases associated with senescence, as well as antiageing treatments.

[0006] HNRNPD (also known as AU-rich element RNA-binding protein 1, AUF1) encodes heterogeneous nuclear ribonucleoprotein particle D, and usually but not exclusively inhibits splice site usage. It also has roles in RNA export, degradation of target transcripts (including proinflammatory cytokines) via its binding to A rich elements of target genes, and telomere maintenance. Vyavahare et al. have shown that miR-141-3p (a miRNA) promotes inflammation and senescence. Direct inhibition of miR-141-3p reduces premature senescence in C2C12 cells when measured using the senescence markers pl6, p21 and senescence-associated beta galactosidase (SA-p-Gal) staining. Inhibition of miR-141-3p also improves musculoskeletal health in mice when inhibited in vivo ("Inhibiting MicroRNA-141- 3p Improves Musculoskeletal Health in Aged Mice." Aging and Disease, Vol. 14 ,6 2303- 2316. 21 Apr. 2023, doi: 10.14336 / AD.2023.0310-1). The same study identified HNRNPD (AU Fl) as one of 1090 bioinformatically-predicted targets of miR-141-3p and showed that a miR-141-3p mimic decreased the expression of HNRNPD (also known as AUF1). Inhibition of HNRNPD (AUF1) using siRNA induced senescence (again measured using SA-p-Gal, pl6 and p21). However, the study did not confirm that inhibiting miR-141-3p had its antisenescence effect directly via HNRNPD (AUF1) since microRNAs act by binding to short degenerate sequences in the 3' untranslated region of their target genes and as such have thousands of predicted targets. The interaction between HNRNPD (AUF1) and miR-141-3p was not validated empirically and miR-141-3p has over 1000 such targets (https: / / mirdb.orq / ) of which HNRNPD AUF1) is just one. The inhibitor of miR-141-3p used in the study was therefore not specific to HNRNPD AU Fl in the sense it inactivates the activity of miR-141-3p in its entirety and thus regulates all of its target genes.

[0007] SUMMARY OF THE INVENTION

[0008] The inventors have surprisingly shown that oligonucleotides that specifically target the 3' untranslated region (UTR) of HNRNPD mRNA and block at least one inhibitory miRNA binding site are able to reduce senescence. The oligonucleotides do not bind the inhibitory miRNA itself and specifically target certain sequences in the 3' UTR of HNRNPD, i.e., do not block inhibitory miRNA binding sites on other genes, or the binding of miRNAs other than miR-141-3p or miR-146b-5p to HNRNPD. As a result, the oligonucleotides of the invention specifically target the interaction between HNRNPD and its upstream regulators miR-141-3p and miR-146b-5p and do not influence the effect of the inhibitory miRNA on other genes. This greatly avoids the risk of off-target side effects and potentially increases the safety of the oligonucleotides of the invention. This is also a key difference from the approach described by Vyavahare et al. ("Inhibiting MicroRNA-141-3p Improves Musculoskeletal Health in Aged Mice." Aging and Disease, Vol. 14 ,6 2303-2316. 21 Apr. 2023, doi: 10.14336 / AD.2023.0310-1), where the authors target miR-141-3p itself.

[0009] Without wishing to be bound by theory, the inventors believe the HNRNPD gene is held in a homeostatic autoregulated feedback loop consisting of HNRNPD itself and miR-141-3p and / or miR-146b-5p which becomes activated during ageing. Blocking the interaction between the HNRNPD transcript and its upstream inhibitory miRNA regulators restores the physiological and regulated expression of HNRNPD within its normal homeostatic limits and relieves aspects of cellular senescence. The oligonucleotides of the invention interrupt the autoregulatory feedback loop and allow HNRNPD expression to resume its normal physiological regulated expression. This is summarised in Figure 27.

[0010] Another advantage of the specific targeting of the invention is that it is not necessary to introduce supraphysiological levels of the HNRNPD target because its expression remains governed by the usual regulatory controls of the cell. It is important to maintain the endogenous regulation of HNRNPD to avoid it becoming an oncogene.

[0011] It is important to note that it is extremely difficult to demonstrate directionality of effect on HNRNPD expression levels following manipulation in vitro because naturally-regulated HNRNPD expression is labile and responsive to multiple stimuli. Expression of HNRNPD mRNA in accordance with the invention is predicted on the basis of the removal of the inhibitor influence of miR-141-3p and / or miR-146b-5p. Reduced senescence can be measured as described below and shown in the Examples. The role HNRNPD plays in senescence is demonstrated by the fact the oligonucleotides of the invention, which specifically target HNRNPD, are capable of reducing senescence.

[0012] The inventors have also surprisingly shown the oligonucleotides of the invention are capable of attenuating or reducing senescence and reducing disease markers in multiple cell types including primary dermal fibroblasts, primary lung fibroblasts, primary bronchial epithelial cells, primary articular chondrocytes, primary retinal endothelial cells, primary pigmented retinal epithelia, and primary lung fibroblasts from patients with idiopathic pulmonary fibrosis (IPF). The performance of the oligonucleotides in IPF donor fibroblasts is similar to that seen with the state-of-the art drugs nintedanib and pirfenidone (see Figure 9).

[0013] The invention provides a method of reducing senescence in a cell, comprising contacting the cell with an oligonucleotide which specifically hybridises to a target portion of the 3' untranslated region (UTR) of heterogeneous nuclear riboprotein particle D HNRNPD) mRNA and blocks at least one inhibitory microRNA (miRNA) binding site and thereby reducing senescence.

[0014] The invention also provides: an oligonucleotide which specifically hybridises to a portion of the 3' UTR of HNRNPD mRNA and blocks at least one inhibitory miRNA binding site for use in a method of reducing senescence in a cell in a subject; an oligonucleotide which specifically hybridises to a portion of the 3' UTR of HNRNPD mRNA and blocks at least one inhibitory miRNA binding site for use in a method of treating or preventing one or more signs of ageing in a subject; an oligonucleotide of about 50 or fewer nucleotides and comprising or consisting of any one of the sequences shown in SEQ ID NOs: 1-28, 33-50, and 55-74; and a pharmaceutical composition comprising an oligonucleotide of the invention and a pharmaceutically acceptable carrier and / or diluent.

[0015] DESCRIPTION OF THE FIGURES

[0016] Figure 1 : SOLOOl, SOL002 or SOL003 causes a reduction in CDKN2A (pl6) expression in senescent primary lung fibroblasts. SOLOOl, SOL002 and SOL003 were initial designs to HNRNPD, designed to block an autoregulatory feedback loop that exists between HNRNPD and its upstream regulators miR-141-3p and / or miR-146b-5p. These were morpholino oligonucleotides (PMOs), introduced to senescent human primary lung fibroblast cells at different concentrations using lipofectamine. Both oligos produced a reduction in senescent cell load under these conditions at multiple concentrations as measured by pl6 expression. Figure 2: SOL002 or SOL003 caused a reduction in CDKN2A (pl6) expression in senescent primary bronchial epithelial cells. SOL002 and SOL003 PMOs delivered by oligofectamine were then evaluated in senescent human primary lung epithelial cells delivered by lipofectamine. Again, both oligos produced a reduction in senescent cell load at multiple concentrations as measured by pl6 expression.

[0017] Figure 3: SOL044, SOL045 or SOL046 caused a reduction in SA-p-Gal activity, a reduction in pl6 expression and a decrease in DNA damage load in senescent primary lung fibroblasts. SOL044 SOL045 and SOL046 were 2'-O-(2-Methoxyethyl)-oligoribonucleotides (2'-MOE) equivalents of SOLOOl, SOL002 and SOL003, delivered to senescent lung fibroblasts by lipofectamine delivery. These had a different chemistry but brought about a marked reduction in senescence as assessed by SA-p-Gal staining, a reduction in DNA damage load and a small effect on proliferation for SOL046.

[0018] Figure 4: SOL044, SOL045 or SOL046 caused decreases in markers of fibrosis and increased expression of markers protective against fibrosis in senescent primary human lung cells. The primary aim was to design and validate a portfolio of oligonucleotide drugs for idiopathic pulmonary fibrosis (IPF). Here the inventors sought to determine whether SOL044, SOL045 and SOL046 could impact on fibrotic phenotypes in senescent primary human lung fibroblasts assessed by SA-p-Gal staining. Oligonucleotides were delivered to cells by lipofectamine. All three oligonucleotides were able to reduce markers of fibrosis and increase protective anti-fibrotic markers.

[0019] Figure 5: SOL044, SOL045 or SOL046 cause a decrease in markers of senescence in human primary dermal fibroblasts when delivered via gymnosis. Gymnosis is the delivery of naked oligonucleotides into cells without a lipid nanoparticle carrier. These data show it was possible to deliver the oligonucleotides to human cells in vitro in this fashion, and still observe efficacy. (A) Senescent dermal fibroblasts exposed to a 2'-MOE oligonucleotide tagged with a fluorochrome for 48 hours show dose-dependent uptake and retention of oligonucleotide. (B) Untagged SOL044, SOL045 and SOL046 delivered to senescent primary human lung fibroblasts by gymnosis caused a reduction in senescence as by SA-p-Gal staining.

[0020] Figure 6: SOL044, SOL045 or SOL046 delivered by gymnosis caused a decrease in markers of senescence in human primary lung fibroblasts. SOL044, SOL045 and SOL046 maintain their effect on SA-p-Gal activity in senescent primary human lung fibroblasts when delivered by gymnosis.

[0021] Figure 7: SOL045 or SOL046 caused a decrease in markers of senescence and inflammation in human primary lung fibroblasts from patients with idiopathic pulmonary fibrosis. SOL045 and SOL046 oligonucleotides delivered by lipofectamine reduced senescent cell load, caused cells to re-enter cell cycle and reduced DNA damage burden. SOL045 also attenuated the expression of LIF and IL6 in human primary lung fibroblasts from a 55yr old male patient with IPF. Senescence was assessed by SA-p-Gal staining.

[0022] Figure 8: SOL045 or SOL046 delivered by oligofectamine caused a decrease in markers of senescence that lasts at least 10 days in primary lung fibroblasts from patients with idiopathic pulmonary fibrosis. Fibroblasts from a 55-yr old male IPF patient maintained effects on senescence phenotypes at 5-days and 10-days post treatment, after treatment with SOL045 or SOL046 delivered by lipofectamine. Senescence was assessed by SA-p-Gal staining.

[0023] Figure 9: SOL044, SOL045 or SOL046 delivered by gymnosis caused a decrease in fibrotic markers compared to standard IPF treatments in primary fibroblasts from IPF patient cells. Pir = pirfenidone Nin = nintedanib (1) oSMA, (2) Collagen 1. DMSO = DMSO carrier. Primary fibroblasts from a 55yr old male IPF patient were treated with the gold standard clinical IPF treatments, pirfenidone and nintedanib or with SOL044 - SOL046, delivered by gymnosis. The stains shown are for protein expression of either (1) oSMA, a marker of fibroblast to myofibroblast transdifferentiation or (2) Collagen 1, an important marker of fibrosis. The oligonucleotides had at least comparable effects on fibrotic markers as the state-of-the-art drugs in our hands.

[0024] Figure 10: SOL045 delivered by gymnosis reduces the protein expression of MMP7 and GREMLIN1 as measured by ELISA. MMP7 is an important predictive and prognostic marker of IPF, whereas GREMLIN 1 is the initiating factor in the fibrotic cascade.

[0025] Figure 11: SOL045 caused a decrease in senescence, an increase in ACAN (a marker of cartilage health) and a decrease in MMP13, a marker of cartilage remodelling in senescent articular chondrocytes from a patient with osteoarthritis. SOL044, SOL045 and SOL046 delivered by oligofectamine reduced senescent cell load in senescent primary human chondrocytes. This was accompanied by an increase in markers of cartilage health (ACAN) and a decrease in markers of cartilage destruction (MMP13).

[0026] Figure 12: SOL044, SOL045 or SOL046 caused a reduction of markers of senescence in senescent primary human retinal endothelial cells. SOL044, SOL045 and SOL046 reduced senescent cell load in senescent primary human retinal endothelial cells. A reduction in DNA damage was also noted, although the wide variability in these readings means that this was not statistically significant.

[0027] Figure 13: SOL044, SOL045 or SOL046 caused a reduction of markers of senescence in senescent primary human pigmented retinal epithelial cells. 2'-MOE oligonucleotides SOL044, SOL045 and SOL046 reduced senescent cell load in senescent primary human retinal endothelial cells. A reduction in DNA damage was also noted, although the wide variability in these readings means that this was not statistically significant.

[0028] Figure 14: SOL045, SOL068 and SOL002 (variants of the same oligonucleotide sequence) delivered intratracheally to C57BL6 / J mice using a single dose of lOmg / kg at Day 0, showed chemistry-dependent pharmacokinetic profiles. (A) Full MOE-PS oligonucleotide SOL045 showed the most favourable PK profile, with a characteristic slow accumulation in the lungs up to 48h, followed by a drop at 72h and a second slow accumulation to 168h. (B) Alternating MOE / DNA-PS oligonucleotide SOL068 was rapidly released from lungs after 24h. (C) Morpholino oligonucleotide SOL002 was also rapidly released from lungs but remained detectable at low levels up to 168h. Relatively low levels of all oligos were found in plasma, kidney and liver tissues at all timepoints.

[0029] Figure 15: SOL044-4, SOL045+5, SOL045+8 and scrambled control (SCR) oligonucleotides delivered intratracheally to C57BL6 / J mice using a single dose of lOmg / kg at Day 0, showed favourable pharmacokinetic profiles. (A) SOL044-4 oligonucleotide was cleared from the lungs over the timecourse, but remained detectable at low levels 168h post-dose. (B) SOL045+5 oligonucleotide was cleared from the lungs over the timecourse, but remained detectable at reasonable levels 168h post-dose. (C) SOL045+8 oligonucleotide was cleared from the lungs from 8h to 48h, but thereafter remained at stable levels until 168h postdose. (D) Scrambled oligonucleotide was cleared from the lungs over the timecourse, but remained detectable at reasonable levels 168h post-dose. (E) No significant differences were observed in animal body weight from the point of dosing to termination of the study. (F) No significant differences were observed in animal organ weights at termination 168h post-dose.

[0030] Figure 16: A subset of SOL044 oligonucleotide panel delivered gymnotically at a dose of 300nM using a low-throughput methodology confirmed that SOL044 series oligonucleotides have significant effect on markers of senescence in human primary lung fibroblasts from an IPF patient, showing a reduction in senescent cell load of up to ~44%. (Key - SCR: scrambled control oligonucleotide)

[0031] Figure 17: A subset of SOL045 oligonucleotide panel delivered gymnotically at a dose of 300nM using a low-throughput methodology confirmed that SOL045 series oligonucleotides have significant effect on markers of senescence in human primary lung fibroblasts from an IPF patient, showing reductions in senescent cell load of up to ~45%. (Key - SCR: scrambled control oligonucleotide)

[0032] Figure 18: SOL045 oligonucleotide delivered gymnotically at doses of 200nM and 400nM has a significant effect of up to ~54% reduction in markers of senescence in human Precision- Cut Lung Slices (PCLS) from a patient with Chronic Obstructive Pulmonary Disease (COPD). (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0033] Figure 19: SOL045 oligonucleotide delivered gymnotically at a dose of 400nM has a significant effect on reduction of oSMA (a marker of fibroblast-to-myofibroblast transdifferentiation) in human Precision-Cut Lung Slices (PCLS) from a patient with Chronic Obstructive Pulmonary Disease (COPD). (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0034] Figure 20: SOL045 oligonucleotide delivered gymnotically at a dose of 200nM has a significant effect of up to -44% reduction in MMP7 (a marker of pathological tissue remodelling) in human Precision-Cut Lung Slices (PCLS) from a patient with Chronic Obstructive Pulmonary Disease (COPD) at both Day 11 (A) and Day 14 (B) in culture. (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0035] Figure 21: SOL045 oligonucleotide delivered gymnotically at a dose of 400nM has a significant effect of up to -80% reduction in markers of senescence in human Precision-Cut Lung Slices (PCLS) from a patient with non-IPF Interstitial Lung Fibrosis (ILF). (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0036] Figure 22: SOL045 oligonucleotide delivered gymnotically at a dose of 400nM has a significant effect of up to -74% reduction in markers of senescence in human Precision-Cut Lung Slices (PCLS) from a patient with Idiopathic Pulmonary Fibrosis (IPF). (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0037] Figure 23: Lead oligonucleotides SOL044-4, SOL045+5 and SOL045+8 delivered gymnotically at a dose of 400nM have significant effects of up to -55% reduction in markers of senescence in human Precision-Cut Lung Slices (PCLS) from a patient with Chronic Obstructive Pulmonary Disease (COPD). (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0038] Figure 24: Lead oligonucleotides SOL044-4, SOL045+5 and SOL045+8 delivered gymnotically at a dose of 400nM have significant effects of up to -59% reduction in MMP7 (a marker of pathological tissue remodelling) in human Precision-Cut Lung Slices (PCLS) from a patient with Chronic Obstructive Pulmonary Disease (COPD) at both Day 11 (A) and Day 14 (B) in culture. (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0039] Figure 25: Lead oligonucleotides SOL044-4, SOL045+5 and SOL045+8 delivered gymnotically at a dose of 400nM have significant effects of up to -60% reduction in MMP9 (a marker of pathological tissue remodelling) in human Precision-Cut Lung Slices (PCLS) from a patient with Chronic Obstructive Pulmonary Disease (COPD) at both Day 11 (A) and Day 14 (B) in culture. (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0040] Figure 26: Lead oligonucleotides SOL044-4, SOL045+5 and SOL045+8 delivered gymnotically at a dose of 400nM have significant effects of up to ~64% reduction in GM- CSF (a marker of fibrogenesis) in human Precision-Cut Lung Slices (PCLS) from a patient with Chronic Obstructive Pulmonary Disease (COPD) at both Day 11 (A) and Day 14 (B) in culture. (Key - UTR: Untreated, HV: Healthy Volunteer, SCR: scrambled control oligonucleotide)

[0041] Figure 27: An autoregulatory feedback loop exists in human cells involving pl6, HNRNPD and miR-141. (A) In old cells, the pl6-miR141 axis is active, which imposes a negative regulatory pressure on the target gene HNRNPD. (B) Upon treatment, steric blockade of the miR-141 binding site in the 3' untranslated region of HNRNPD using an antisense oligonucleotide deactivates the pl6-miR-141 axis, restores the expression of HNRNPD within its natural homeostatic limits, imposed by the negative autoregulation of HNRNPD itself and imposes a negative expression pressure on the CDKN2A RNA transcript thatencodes pl6.

[0042] DESCRIPTION OF THE SEQUENCE LISTING

[0043] SEQ ID NOs: 1-78 are the oligonucleotide sequences designed and tested by the inventors. They are shown in Tables 1-6 in the Example.

[0044] SEQ ID NO: 79 shows the sequence of 3' UTR of human HNRNPD mRNA.

[0045] SEQ ID NOs: 80-82 show the sequence of the mature form of human miR-141-3p and its two preferred binding sites respectively.

[0046] SEQ ID NOs: 83-85 show the sequence of the mature form of human miR-146-5p and its two preferred binding sites respectively.

[0047] DETAILED DESCRIPTION

[0048] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material. The present invention is described with respect to particular embodiments and with reference to certain Figures but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. Of course, it is to be understood that not necessarily all aspects or advantages may be achieved in accordance with any particular embodiment of the invention. Thus, for example those skilled in the art will recognize that the invention may be embodied or carried out in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other aspects or advantages as may be taught or suggested herein.

[0049] The invention, both as to organisation and method of operation, together with features and advantages thereof, may best be understood by reference to the following detailed description when read in conjunction with the accompanying Figures. The aspects and advantages of the invention will be apparent from and elucidated with reference to the embodiment(s) described hereinafter. Reference throughout this specification to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may do so. Similarly, it should be appreciated that in the description of exemplary embodiments of the invention, various features of the invention are sometimes grouped together in a single embodiment, or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of one or more of the various inventive aspects. This method of disclosure, however, is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment.

[0050] In addition, as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "an oligonucleotide" includes two or more oligonucleotides, reference to "a cell" includes two or more cells, reference to "a subject" includes two or more such subjects, reference to "a target portion" includes two or more such portions, and the like.

[0051] In all instances herein, "heterogeneous nuclear ribonucleoprotein particle D" is interchangeable with "heterogeneous nuclear ribonucleoprotein D".

[0052] In all instances herein, "target portion" is interchangeable with "target part" or "target region". The method of the invention involves reducing senescence. "Reducing" is interchangeable with "inhibiting", "reversing" or "attenuating".

[0053] The method of the invention involves promoting expression of HNRNPD. "Promoting" is interchangeable with "increasing".

[0054] In all instances herein, "HNRNPD" is interchangeable with "AUF1".

[0055] The term "subject" is interchangeable with "patient".

[0056] In all of the discussion herein, the standard one letter codes for nucleosides and nucleotides are used. These are of course A, T, U, G and C. These are discussed in more detail and defined below.

[0057] For any oligonucleotide disclosed herein comprising U, the invention also comprises an oligonucleotide in which U is replaced by T. For any oligonucleotide disclosed herein comprising T, the invention also comprises an oligonucleotide in which T is replaced by U.

[0058] Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 4thed., Cold Spring Harbor Press, Plainsview, New York (2012); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 114), John Wiley & Sons, New York (2016), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

[0059] "About" as used herein when referring to a measurable value such as an amount, a percentage, and the like, is meant to encompass variations of ± 20 % or ± 10 %, more preferably ± 5 %, even more preferably ± 1 %, and still more preferably ± 0.1 % from the specified value, as such variations are appropriate to perform the disclosed invention. Any statement herein including the term "about" includes the same feature without the term.

[0060] For instance, a variant of SEQ ID NO: 1 having at least "about" 90% identity or homology to the sequence of SEQ ID NO: 1 over its entire length includes a variant of SEQ ID NO: 1 having at least 80% identity or homology to the sequence of SEQ ID NO: 1 over its entire length.

[0061] Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", mean "including but not limited to", and do not exclude other components, integers, or steps. Any instance of the term "comprise" can be replaced with "consisting essentially of" or "consisting of". Preferred features of each aspect of the invention may be as described in connection with any of the other aspects. Within the scope of this application, it is expressly intended that the various aspects, embodiments, examples, and alternatives set out in the following paragraphs, in the claims and / or in the following description and drawings, and particularly the individual features thereof, may be taken independently or in any combination. That is, all embodiments and / or features of any embodiment can be combined in any way and / or combination, unless such features are incompatible.

[0062] Methods of the invention

[0063] Senescence

[0064] The invention provides a method of reducing senescence in a cell. Senescence is associated with a variety of general traits, including cell cycle arrest and the senescence-associated secretory phenotype (SASP), an enlarged and flattened morphology, expanded lysosomal compartment and particular chromatin and epigenetic alterations. Senescence can be measured using routine methods in the art, including those described in Gonzalez-Gualda, Estela et al. "A guide to assessing cellular senescence in vitro and in vivo." The FEBS journal vol. 288,1 (2021): 56-80 (doi: 10.1111 / febs.15570).

[0065] A reduction in senescence in the cell can be measured in a variety of ways including, but not limited to, re-entry to the cell cycle, structural changes, a reduction in pro-survival pathways, a reduction in the SASP and plasma membrane protein expression. A reduction in senescence in the cell can be measured in a variety of ways including, but not limited to, reentry to the cell cycle, structural changes, a reduction in pro-survival pathways, a reduction in the number of cells staining positive for the senescence-associated biochemical marker senescence-associated beta galactosidase (SA-p-Gal, or SAB), a reduction in the SASP and plasma membrane protein expression.

[0066] Re-entry to the cell cycle can be identified by measuring DNA synthesis, for instance by measuring increased BrdU and EdU, an increased proliferation, for instance by measuring increased Ki67, an inhibition of the pl6-pRB axis, for instance by measuring decreased pl6INK4a and pRB and increased phospho-pRb, an inhibition of the p53-p21 axis, for instance by measuring decreased p21, p53, phospho-p53, DECI (BHLHB2) and PPP1A.

[0067] Structural changes associated with reduced senescence include, reversal of the enlarged, flattened shape, decreased lysosomal compartment and activity, for instance by measuring decreased SA-p-galactosidase, SA-o-Fucosidase and Lipofuscin, reversal of DNA damage, for instance by measuring decreased yH2AX, 53BPI, Rad 17, ATR, ATM, MDC1 and TIF, reduced reactive oxygen species (ROS), increased telomere length, a reduction in senescence-associated heterochromatic foci (SAHFs), for instance by measuring decreased DAPI / Hoechst 33342, HIRA, H3K9-methylation, PML bodies and HPl-gamma, and increased Lamin Bl in the nuclear membrane.

[0068] A reduction in pro-survival pathways can be measured by the presence of Annexin V, cleaved poly (ADP-ribose) polymerase (PARP), cleaved caspase 2 / 3 / 9 and TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labelling) staining.

[0069] A reduction in the SASP can be measured by measuring a decrease in a number of cytokines, including interleukin-6 (IL-6), IL-8, CXC motif chemokine receptor 2 (CXCR2), insulin-like growth factor 2 (IGF2), insulin-like growth factor-binding protein 3 (IGFBP3), IGFBP5, IGFBP7, stanniocalcin-1 (STC1), growth differentiation factor (GDF15) and serine protease inhibitors (SERPINs).

[0070] A reduction in the SASP can be measured by measuring a decrease in a number of cytokines. These cytokines may, for example, include interleukin-6 (IL-6), interleukin-8 (IL- 8), interleukin-1 alpha (IL-lo), interleukin-1 beta (IL-1B or IL-ip), interleukin-2 (IL-2), CXC motif chemokine receptor 2 (CXCR2), CXC motif ligand 1 (CXCL1), insulin-like growth factor 2 (IGF2), insulin-like growth factor-binding protein 2 (IGFBP2), insulin-like growth factorbinding protein 3 (IGFBP3), insulin-like growth factor-binding protein 4 (IGFBP4), insulinlike growth factor-binding protein 5 (IGFBP5), insulin-like growth factor-binding protein 6 (IGFBP6), insulin-like growth factor-binding protein 7 (IGFBP7), stanniocalcin-1 (STC1), growth differentiation factor (GDF15), matrix metalloproteinase-1 (MMP1), matrix metalloproteinase-2 (MMP2), matrix metalloproteinase-3 (MMP3), tissue inhibitor of metalloproteinases 1 (TIMP1), tissue inhibitor of metalloproteinases 2 (TIMP2), thrombospondin 1 (THBS1), serine protease inhibitors (SERPINs), SERPINE1, granulocytemacrophage colony-stimulating factor (GM-CSF), and / or tumor necrosis factor alpha (TNFa or TNF-o).

[0071] A reduction in senescence can also be identified by measuring a reduction in the expression of one or more of intercellular adhesion molecule 1 (ICAM-1), DEP1, beta 2 microglobulin (B2MG), NOTCH3 and decoy receptor 2 (DcR2).

[0072] Routine methods can be used to measure any of these traits and markers, including immunofluorescence, immunohistochemistry, western blotting, quantitative polymerase chain reaction (qPCR), reporter assays, enzyme-linked immunosorbent assay (ELISA), microscopy, flow cytometry, enzymatic staining, dye incorporation, chemiluminescent oxygen detection reagents, fluorometry, fluorescence in situ hybridization (FISH) and SASP- responsive alkaline phosphatase assay.

[0073] The reduction in senescence is preferably identified as described in the Example. The reduction in senescence is preferably identified by measuring a reduction in pl6 expression. This is shown in Figures 1 and 2. The reduction in senescence is preferably identified by measuring a reduction in SA-p-Gal staining. This is shown in Figures 3-7.

[0074] The reduction in senescence is preferably identified by measuring a reduction in expression of one or more of pl6, p21 and p53, such as a reduction in expression of pl6, a reduction in expression of p21, a reduction in expression of p53, a reduction in expression of pl6 and p21, a reduction in expression of p21 and p53, a reduction in expression of pl6 and p53, or a reduction in expression of pl6, p21 and p53.

[0075] The reduction in senescence is preferably identified by measuring a reduction in SA-p-Gal (SAB) staining, alone or in combination with an assessment of morphology, for example cell size, nuclear size and / or granularity.

[0076] Reducing senescence

[0077] Contacting the cell with the oligonucleotide in accordance with the invention reduces senescence. The senescence may be reduced by any amount. The senescence is preferably reduced by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100%. Senescence can be measured as discussed above.

[0078] The amount of senescence is typically reduced in the method of the invention compared with the amount of senescence in the cell before it is contacted with the oligonucleotide. The cell used in the method of the invention preferably comprises increased senescence before it is contacted with the oligonucleotide. The invention provides a method of reducing senescence in a cell which comprises increased senescence or an increased amount of senescence. Senescence is typically increased compared with a normal or healthy cell of the same type. The association of an increases in senescence with diseases or conditions are discussed in more detail below.

[0079] Contacting the cell with the oligonucleotide in accordance with the invention preferably promotes the physiologically regulated expression of HNRNPD. The expression of HNRNPD may increase. The expression of HNRNPD may decrease. The expression of HNRNPD may remain about the same. As explained above, it is extremely difficult to demonstrate a directional effect on HNRNPD expression levels following treatment in vitro because natural regulated HNRNPD expression is labile and responsive to multiple stimuli. Contacting the cell with the oligonucleotide in accordance with the invention preferably promotes the physiologically regulated expression of HNRNPD and thereby reduces senescence.

[0080] Cell

[0081] The cell may be any type of cell. The cell is typically a eukaryotic cell. The cell may be a protozoan, algal, fungal, plant or animal cell. The cell is preferably mammalian. The cell is preferably a human, dog, cat, primate, horse, murine, rat, rodent, bovine, murine, porcine, or ovine cell. The cell is preferably a human cell. The cells may be a plant cell, such as a cereal, legume, fruit, or vegetable cells. Examples include, but are not limited to, wheat, barley, oat, canola, maize, soya, rice, banana, apple, tomato, potato, grape, tobacco, bean, lentil, sugar cane, cocoa, cotton, tea, or coffee cell.

[0082] The animal or mammalian cell may be derived from the ectoderm, endoderm, or mesoderm. The cell may be an endothelium cell. The cell may be an epithelium cell. The cell may be derived from immune system, heart, brain, vasculature, skin, intestine, lung, thyroid, reproductive organ, bladder, kidney, pancreas, oral mucosal, eye or liver. The cell may be a stem cell, such as an embryonic stem cell, induced pluripotent stem cell or mesenchymal stem cell, bone cell, such as an osteoclast, osteoblast or osteocyte, tendon cell, such as a tenoblast or tenocyte, chondrocyte, synovial cell, vascular cell, connective tissue cell, such as a fibroblast, blood cell, such as a red blood cell, immune cell, platelet, neutrophil or basophil, muscle cells, such as a skeletal muscle cell, cardiac muscle cell or smooth muscle cell, reproductive cell, such as a sperm, oocyte, duct cell or epididymal cell, secretory cell, adipocyte, liver lipocyte, epithelial cell, odontoblast, cementoblast, hormone-secreting cell, barrier cell, exocrine secretory epithelial cell, nerve cell, astrocyte, oligodendrocyte, or neuron.

[0083] The immune cell may be a neutrophil granulocyte and precursor, such as a myeloblast, promyelocyte, myelocyte, or metamyelocyte, eosinophil granulocyte and precursor, basophil granulocyte and precursor, mast cell, leukocyte, lymphocyte, helper T cell, regulatory T cell, cytotoxic T cell, natural killer T cell, natural killer cell, innate lymphoid cell (ILC), B cell, macrophage, dendritic cell, plasma cell, neutrophils, or monocytes.

[0084] The cell is preferably a lung cell, brain cell, retinal cell, chondrocyte, or skin cell. The cell is preferably a lung cell. The cell is preferably a chondrocyte. The cell is preferably a retinal cell. The cell is preferably a skin cell. The cell is preferably a brain cell. The lung cell is preferably a lung fibroblast or a lung epithelial cell. The lung cell is preferably a lung fibroblast, lung myofibroblast, lung small airway epithelial (ATI or AT2) cell, or a bronchial epithelial cell. The skin cell is preferably a skin fibroblast, a keratinocyte, a melanocyte, or a dermal papilla cell. The retinal cell is preferably a retinal endothelial cell or a pigmented retinal epithelial cell. The brain cell is preferably an astrocyte, a neuron, or a microglial cell.

[0085] The cell is preferably a hair follicle cell. The hair follicle cell is preferably a dermal papilla (DP) cell, a dermal sheath (DS) cell or a hair follicle stem cell.

[0086] The cell is preferably a nail cell or a nail matrix cell.

[0087] The method is preferably for reducing senescence in two or more cells. In this embodiment, the method comprises contacting the two or more cells with the oligonucleotide. The method may reduce senescence in any number of two or more cells, such as at least about 5 x 103cells, at least about 1 x 104cells, at least about 5 xlO4cells, at least about 1 xlO5cells, at least about 5 xlO5cells, at least about IxlO6cells, at least about 5 xlO6cells, at least about IxlO7cells, at least about 5xl07cells, at least about IxlO8cells, at least about 5xl08cells, at least about IxlO9cells, at least about 5xl09cells, at least about IxlO10cells, at least about 5xl010cells, at least about IxlO11cells, at least about IxlO12cells, at least about IxlO13cells, at least about IxlO14cells, at least about IxlO15cells, at least about IxlO16cells, at least about IxlO17cells, at least about IxlO18cells, at least about IxlO19cells, at least about IxlO20cells, at least about IxlO25cells, at least about IxlO30cells, at least about IxlO35cells, at least about IxlO40cells, at least about IxlO45cells, at least about IxlO50cells, at least about IxlO60cells, at least about IxlO70cells, at least about IxlO80cells, at least about IxlO90cells, or at least about IxlO100cells.

[0088] The method of the invention comprises contacting the cell or two or more cells with an oligonucleotide which specifically hybridises to a target portion of the 3' untranslated region (UTR) of heterogeneous nuclear riboprotein particle D HNRNPD) mRNA.

[0089] The cell or two or more cells may be in vivo as discussed below. The cell or two or more cells are preferably in vitro or ex vivo.

[0090] Oligonucleotide

[0091] An oligonucleotide is a polymer comprising two or more nucleotides. The nucleotides can be naturally occurring or artificial. A nucleotide typically contains a nucleobase, a sugar and at least one linking group, such as a phosphodiester, phosphoramidate, phosphorodiamidate, methylphosphonate or phosphorothioate group. The linking groups form internucleoside linkages. These are discussed in more detail below.

[0092] The naturally occurring nucleobase is typically heterocyclic. Nucleobases include, but are not limited to, purines and pyrimidines and more specifically adenine (A), guanine (G), thymine (T), uracil (U) and cytosine (C). The sugar is typically a pentose sugar. Nucleotide sugars include, but are not limited to, ribose and deoxyribose. The sugar and the nucleobase together form a nucleoside. Preferred nucleosides include, but are not limited to, adenosine, guanosine, 5-methyluridine, uridine, cytidine, 5-methyl cytidine, deoxyadenosine, deoxyguanosine, thymidine, deoxyuridine and deoxycytidine. The nucleosides are preferably adenosine, guanosine, thymidine, and 5-methyl cytidine.

[0093] The nucleotides are typically ribonucleotides or deoxyribonucleotides. The nucleotides are preferably deoxyribonucleotides. The nucleotides typically contain a monophosphate, diphosphate, or triphosphate. Phosphates may be attached on the 5' or 3' side of a nucleotide.

[0094] The nucleotides may contain additional modifications. In particular, suitable modified nucleotides include, but are not limited to, 2'-amino pyrimidines (such as 2'-amino cytidine and 2'-amino uridine), 2'-hydroxy purines (such as 2'-hydroxy adenosine or 2'-hydroxy guanosine), 2'-fluoro pyrimidines (such as 2'-fluoro cytidine and 2'fluoro uridine), 2'- hydroxyl pyrimidines (such as 5'-o-P-borano uridine), 2'-O-methyl nucleotides (such as 2'- O-methyl adenosine, 2'-O-methyl guanosine, 2'-O-methyl cytidine and 2'-O-methyl uridine), 4'-thio pyrimidines (such as 4'-thio uridine and 4'-thio cytidine) and nucleotides have modifications of the nucleobase (such as 5-pentynyl-2'-deoxy uridine, 5-(3-aminopropyl)- uridine and l,6-diaminohexyl-N-5-carbamoylmethyl uridine).

[0095] The nucleotides in the polynucleotide may be attached to each other in any manner. The nucleotides may be linked by phosphodiester, phosphoramidate, phosphorodiamidate, methylphosphonate or phosphorothioate linkages. The nucleotides are typically attached by their sugar and phosphate groups as in nucleic acids. The nucleotides may be connected via their nucleobases as in pyrimidine dimers.

[0096] The oligonucleotide may be ribonucleic acid (RIMA) or deoxyribonucleic acid (DNA). The oligonucleotide may be modified in any of the ways discussed below. The oligonucleotide may be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), morpholino nucleic acid or other synthetic polymers with nucleotide side chains.

[0097] Modified oligonucleotides

[0098] The oligonucleotide is preferably modified to (a) increase its binding affinity for the 3' UTR, (b) increase its resistance to one or more nucleases, (c) alter its pharmacokinetics and / or pharmacodynamics, (d) alter its tissue distribution, (e) increase its stability, (f) improve its toxicity, (g) increase its uptake and / or retention by a cell, (h) reduce its immunogenicity, (i) reduce its off-target effects, (j) alter its charge and / or hydrophobicity, (k) alter its protein binding, or any combination thereof. In (f), the oligonucleotide is typically modified to reduce or lessen its toxicity. The one or more nucleases may be one or more RNAses or DNAses. The increases in affinity and / or resistance may be measured using routine methods. The altered pharmacokinetics and / or tissue distribution may be measured using routine methods. Affinity is also discussed below in the context of hybridisation. Suitable modifications are described in, for example, US 20210079391A1 and US8183363B2. In the context of the invention, references to "modification" or "modified" or the like typically refer to modified versions of RNA nucleotides, RNA, DNA nucleotides or DNA. The oligonucleotide may comprise any of the modifications discussed above or below.

[0099] Modified nucleosides

[0100] The oligonucleotide preferably comprises one or more modified nucleosides. Modified nucleosides may include a modified sugar and / or a modified nucleobase. Incorporation of such modified nucleosides typically results in one or more of (a)-(k) as set out above and especially an increased affinity for a target nucleic acid, increased stability, increased resistance to nuclease degradation, improved toxicity, and increased uptake of the modified oligonucleotide.

[0101] Modified sugars and sugar surrogates

[0102] The oligonucleotide preferably comprises one or more modified sugars. As explained above, the nucleotides in the oligonucleotide each comprise at least one sugar. The one or more sugars are typically modified compared with the sugar in RNA or DNA. The inclusion of one or more modified sugars typically increases the nuclease resistance and / or the binding affinity of the oligonucleotide. The one or more modified sugars may also provide the oligonucleotide with one or more additional beneficial biological properties as set out in (a)- (k) above. The term "sugar" is interchangeable with "sugar moiety". The oligonucleotide may comprise one type of modified sugar. The oligonucleotide may comprise two or more different types of modified sugars. Every nucleotide in the oligonucleotide may comprise one or more modified sugars.

[0103] The one or more modified sugars may be substituted sugars. The one or more modified sugars may be bicyclic or tricyclic sugars. The one or more modified sugars may be one or more sugar surrogates. The one or more modified sugars may have a replacement of the ribosyl ring oxygen atom with S, N(R), or C(RI)(R2) (R=H, C1-C12 alkyl or protecting groups) and combinations of these. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugars.

[0104] Modified sugars are substituted sugars comprising one or more substituents including, but not limited to, substituents at the 2', 3' and 5' positions, such as the 2' position, the 3' position, the 5' position, the 2' and 3' positions, the 2' and 5' positions, the 3' and 5' positions and the 2', 3' and 5' positions. Examples of nucleosides having modified sugar moiety include without limitations nucleosides comprising 5-vinyl, 5-methyl, 4'-S, 2'-F, 2'-OCH3(OMe or O-methyl), and 2'- O(CH2)2OCH3(2'-MOE) substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-Ci-Cw alkyl, OCF3, O(CH2)2SCH3, O(CH2)2- O-N(Rm)(Rn) and O-CH2-C(=O)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl. Other examples of sugar substituents can be found in US 20210079391A1 and WO 2008 / 101157.

[0105] Certain modified sugars comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar. In certain such embodiments, the bicyclic sugar comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' sugar substituents can be found in US 20210079391A1, US 7,399,845, WO 2009 / 006478, WO 2008 / 150729, US 2004 / 0171570, US 7,427,672, Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134 and WO 2008 / 154401.

[0106] Nucleotides comprising bicyclic sugars are referred to as bicyclic nucleotides or BNAs. Bicyclic nucleotides include, but are not limited to, a-L-Methyleneoxy (4'-CH2-O-2') BNA, [3- D-Methyleneoxy (4'-CH2-O-2') BNA (also referred to as locked nucleic acid or LNA), Ethyleneoxy (4'-(CH2)2-O-2') BNA, Aminooxy (4'-CH2-O-N(R)-2') BNA, Oxyamino (4'-CH2- N(R)-O-2') BNA, Methyl(methyleneoxy) (4'-CH(CH3)-O-2') BNA (also referred to as constrained ethyl or cEt), methylene-thio (4'-CH2-S-2') BNA, methylene-amino (4'-CH2- N(R)-2') BNA, methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA, and propylene carbocyclic (4'- (CH2)3-2') BNA. The structures of these sugars are shown in US 20210079391A1.

[0107] Additional bicyclic sugars are known in the art, including in Singh et al. (Chem. Commun., 1998, 4, 455-456), Koshkin et al. (Tetrahedron, 1998, 54, 3607-3630), Wahlestedt et al. (Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638), Kumar et al. (Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222), Singh et al. (J. Org. Chem., 1998, 63, 10035-10039), Srivastava et al. (J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007)), Elayadi et al. (Curr. Opinion Invens. Drugs, 2001, 2, 558-561), Braasch et al., Chem. Biol., 2001, 8, 1-7), Orum et al. (Curr. Opinion Mol. Then, 2001, 3, 239-243), US 7,053,207, US 6,268,490, US 6,770,748, US 6,794,499, US 7,034,133, US 6,525,191, US 6,670,461, and US 7,399,845; WO 2004 / 106356, WO 1994 / 14226, WO 2005 / 021570, WO 2007 / 134181, US 2004 / 0171570, US 2007 / 0287831, US 2008 / 0039618, US 12 / 129,154, US 60 / 989,574, US 61 / 026,995, US 61 / 026,998, US 61 / 056,564, US 61 / 086,231, US 61 / 097,787, US 61 / 099,844, PCT / US2008 / 064591, PCT / US2008 / 066154, and PCT / US2008 / 068922.

[0108] Bicyclic sugars and nucleotides incorporating such bicyclic sugars may be further defined by isomeric configuration. For example, a nucleotide comprising a 4'-2' methylene-oxy bridge, may be in the o-L configuration or in the [3-D configuration. Previously, o-L-methyleneoxy (4'-CH2-O-2') bicyclic nucleotides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365- 6372).

[0109] In certain embodiments, substituted sugars comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars) as disclosed in WO 2007 / 134181, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).

[0110] Modified sugars may be sugar surrogates. For instance, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfur, carbon, or nitrogen atom. Such modified sugars may also comprise bridging and / or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'-position (see, e.g., US 2005 / 0130923) and / or the 5' position. By way of additional example, carbocyclic bicyclic nucleotides having a 4'-2' bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).

[0111] In certain embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetra hydropyran. Such tetra hydro pyrans may be further modified or substituted.

[0112] Nucleotides comprising such modified tetra hydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg . & Med. Chem . (2002) 10:841-854), and fluoro HNA (F-HNA). Additional modified tetra hydropyrans are disclosed in US 20210079391A1.

[0113] Sugar surrogates may comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleotides comprising morpholino sugars and their use in oligomeric compounds has been reported (Braasch et al., Biochemistry, 2002, 41, 4503- 4510, US 5,698,685 US 5,166,315, US 5,185,444, and US 5,034,506). The structure of morpholinos is known in the art and shown in US 20210079391A1.

[0114] Morpholinos may be modified, for example by adding or altering various substituent groups from the morpholino structure. Such sugar surrogates are referred to as "modified morpholinos."

[0115] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleotides (WO 2008 / 101157) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (US 2005 / 0130923) or alternatively 5'-substitution of a bicyclic nucleic acid (WO 2007 / 134181 wherein a 4'-CH2-O-2' bicyclic nucleotide is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleotides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0116] Modified nucleobases

[0117] In addition to naturally occurring nucleobases, typically purines and pyrimidines, modified nucleobases or nucleobase mimetics known to those skilled in the art can be incorporated into the oligonucleotide. Modified nucleobases can include nucleobases with minimal modification from the parent nucleobase, such as 7-deaza purine, 5-methyl cytosine, or a G-clamp. Modified nucleobases can also include nucleobase mimetics such as tricyclic phenoxazine nucleobase mimetics. Methods for preparation of the above noted modified nucleobases are well known to those skilled in the art.

[0118] The oligonucleotide preferably comprises one or more modified nucleobases. As explained above, the nucleotides in the oligonucleotide each comprise a nucleobase. The one or more nucleobases are typically modified compared with the nucleobases in RIMA or DNA. The inclusion of modified nucleobases may improve any of the biological properties discussed above as (a)-(k) and typically increases the binding affinity of the oligonucleotide for the 3' UTR. The oligonucleotide may comprise one type of modified nucleobase. The oligonucleotide may comprise two or more different types of modified nucleobases. Every nucleotide in the oligonucleotide may comprise a modified nucleobase. In this context, the one or more nucleobase modifications are independent of the sequence of nucleobases.

[0119] Modified nucleobases include, but are not limited to, 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, 5-propynylcytosine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2- amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3- deazaguanine and 3-deazaadenine, universal nucleotides, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases.

[0120] Universal nucleotides are capable of base pairing with any nucleotide. The universal nucleotide preferably comprises one of the following nucleobases: hypoxanthine, 4- nitroindole, 5-nitroindole, 6-nitroindole, formylindole, 3-nitropyrrole, nitroimidazole, 4- nitropyrazole, 4-nitrobenzimidazole, 5-nitroindazole, 4-aminobenzimidazole or phenyl (C6- aromatic ring). The universal nucleotide more preferably comprises one of the following nucleosides: 2'-deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 7-deaza-inosine, 2-aza- deoxyinosine, 2-aza-inosine, 2-O'-methylinosine, 4-nitroindole 2’-deoxyribonucleoside, 4- nitroindole ribonucleoside, 5-nitroindole 2’ deoxyribonucleoside, 5-nitroindole ribonucleoside, 6-nitroindole 2’ deoxyribonucleoside, 6-nitroindole ribonucleoside, 3- nitropyrrole 2’ deoxyribonucleoside, 3-nitropyrrole ribonucleoside, an acyclic sugar analogue of hypoxanthine, nitroimidazole 2’ deoxyribonucleoside, nitroimidazole ribonucleoside, 4- nitropyrazole 2’ deoxyribonucleoside, 4-nitropyrazole ribonucleoside, 4-nitrobenzimidazole 2’ deoxyribonucleoside, 4-nitrobenzimidazole ribonucleoside, 5-nitroindazole 2’ deoxyribonucleoside, 5-nitroindazole ribonucleoside, 4-aminobenzimidazole 2’ deoxyribonucleoside, 4-aminobenzimidazole ribonucleoside, phenyl C-ribonucleoside, phenyl C-2'-deoxyribosyl nucleoside, 2’-deoxynebularine, 2’-deoxyisoguanosine, K-2’-deoxyribose, P-2’-deoxyribose and pyrrolidine. The universal nucleotide more preferably comprises 2'- deoxyinosine. The universal nucleotide is more preferably IMP or dIMP. The universal nucleotide may be dPMP (2’-Deoxy-P-nucleoside monophosphate) or dKMP (N6-methoxy-2, 6-diaminopurine monophosphate). Further modified nucleobases include, but are not limited to, tricyclic pyrimidines such as phenoxazine cytidine([5,4-b][l,4]benzoxazin-2(3H)-one), phenothiazine cytidine (lH-pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4- b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.

[0121] Further nucleobases include those disclosed in U 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie , International Edition, 1991, 30, 613, Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.

[0122] Modified nucleobases are also described in, for example, US 3,687,808, US 4,845,205, US

[0123] 5,130,302, US 5,134,066, US 5,175,273, US 5,367,066, US 5,432,272, US 5,457,187, US

[0124] 5,459,255, US 5,484,908, US 5,502,177, US 5,525,711, US 5,552,540, US 5,587,469, US

[0125] 5,594,121, US 5,596,091, US 5,614,617, US 5,645,985, US 5,681,941, US 5,750,692, US

[0126] 5,763,588, US 5,830,653, and US 6,005,096.

[0127] The one or more nucleobase modifications may be dependent on the sequence of the nucleobase(s). For instance, cytidine is typically modified to 5-methyl cytidine.

[0128] Internucleoside linkages The oligonucleotide typically comprises eight or more linked nucleosides. The nucleosides may be linked together using any internucleoside linkages. The oligonucleotide preferably comprises one or more modified internucleoside linkages. The internucleoside linkages are typically modified compared with the phosphorodiester in RIMA or DNA. The inclusion of one or more modified internucleoside linkages typically increases the nuclease stability and / or some other beneficial biological property of the oligonucleotide. The oligonucleotide may comprise one type of modified internucleoside linkage. The oligonucleotide may comprise two or more different types of modified internucleoside linkages. Every nucleotide in the oligonucleotide may be linked by a modified internucleoside linkage. The term "internucleoside linkage(s)" is interchangeable with "internucleoside linking group(s)".

[0129] The two main classes of internucleoside linkage are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (PO), phosphotriesters, methylphosphonates, phosphoramidate, phosphorodiamidate and phosphorothioates (PS). Representative nonphosphorus containing internucleotide linkage include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester (-O-C(O)-S-), thionocarbamate (- O-C(O)(NH)-S-); siloxane (-O-Si(H)2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)- N(CH3)-). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide and / or some other beneficial biological property of the oligonucleotide. Other properties are discussed as (a)- (k) above. Internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0130] The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), a or p such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the oligonucleotide compositions provided herein are all such possible isomers, as well as their racemic and optically pure forms.

[0131] Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3 )-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), and thioformacetal (3'-S- CH2-O-5')- Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

[0132] The oligonucleotide preferably comprises one or more modifications. The one or more modifications are typically compared with RIMA or DNA. The one or more modifications preferably provide one or more beneficial biological properties of the oligonucleotide. Suitable properties are discussed as (a)-(k) above.

[0133] The oligonucleotide preferably comprises one or more of (1) one or more modified sugars, (2) one or more modified nucleobases and (3) one or more modified internucleoside linkages, such as (1), (2), (3), (1) and (2), (1) and (3), (2) and (3) or (1), (2) and (3). One or more modified sugars and / or one or more modified nucleobases typically increase the binding affinity of the oligonucleotide for the 3' UTR. One or more modified internucleoside linkages typically increase the resistance of the oligonucleotide to one or more nucleases. The one or more modifications, such as any one of ( l)-(3) defined above, may define a pattern or motif. The pattern of the one or more modifications may each be independent of one another. Thus, an oligonucleotide may be described by its modified sugar motif, modified nucleobase motif, and / or modified internucleoside linkage motif. The modified nucleobase motif describes one or more nucleobase modifications independent of the sequence of nucleobases.

[0134] Internucleoside linkage motifs

[0135] The oligonucleotide may comprise one or more modified sugars and / or naturally occurring sugars arranged along the oligonucleotide or region thereof in a defined pattern or modified sugar motif. Such motifs may include any of the sugar modifications discussed above and / or other known sugar modifications. The oligonucleotide may comprise or consist of a region having a gapmer modified sugar motif, which comprises two external regions or "wings" and an internal region or "gap." The three regions of a gapmer motif (the 5' wing, the gap, and the 3' wing) form a contiguous sequence of nucleotides wherein at least some of the sugars of the nucleotides of each of the wings differ from at least some of the sugars of the nucleotides of the gap.

[0136] The oligonucleotide may comprise one or more modified sugars and / or naturally occurring sugars arranged along the oligonucleotide or region thereof in randomised pattern.

[0137] The oligonucleotide may be fully modified. The oligonucleotide may be uniformly modified. The oligonucleotide may be uniform 2'-MOE. The oligonucleotide may be uniform 2'-F. The oligonucleotide may be uniform morpholino. The oligonucleotide may be uniform BNA. The oligonucleotide may be uniform LNA. The oligonucleotide may be uniform cEt. The oligonucleotide may comprise a uniformly modified region and additional nucleotides that are unmodified or differently modified. The uniformly modified region is preferably at least about 5, about 10, about 15, or about 20 nucleotides in length. The uniform region is preferably a 2'-MOE region. The uniform region is preferably a 2'-F region. The uniform region is preferably a morpholino region. The uniform region is preferably a BNA region. The uniform region is preferably a LNA region. The uniform region is preferably a cEt region.

[0138] The oligonucleotide preferably does not comprise more than about 4 contiguous unmodified 2'-deoxynucleotides (DNA nucleotides). Oligonucleotides comprising more than 4 contiguous 2'-deoxynucleotides (DNA nucleotides) typically activate RNase H. Such cleavage may be avoided by not having more than about 4 contiguous 2'-deoxynucleotides (DNA nucleotides).

[0139] The oligonucleotide may comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. Internucleoside linkages may be arranged in a gapped motif as described in US 20210079391A1. In such embodiments, the internucleoside linkages in each of two "wing" regions either side of a "gap" region are different from the internucleoside linkages in the gap region. For instance, the internucleoside linkages in the wings may be phosphodiester and the internucleoside linkages in the gap may be phosphorothioate. The modified sugar motif (as discussed below) is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped modified sugar motif and if it does have a gapped sugar motif, the wing and gap lengths may or may not be the same. This is described in US 20210079391A1.

[0140] Oligonucleotides may comprise a region having an alternating internucleoside linkage motif. The oligonucleotide may comprise a region of uniformly modified internucleoside linkages. The oligonucleotide may comprise a region that is uniformly linked by phosphorothioate internucleoside linkages. The oligonucleotide may be uniformly linked by phosphorothioate. Each internucleoside linkage of the oligonucleotide may be selected from phosphodiester (PO) and phosphorothioate (PS). Each internucleoside linkage of the oligonucleotide may be selected from phosphodiester (PO) and phosphorothioate (PS) and at least one internucleoside linkage is phosphorothioate (PS).

[0141] The oligonucleotide may comprise at least about 6 phosphorothioate (PS) internucleoside linkages, such as at least about 8 or at least about 10 phosphorothioate (PS) linkages. The oligonucleotide may comprise at least one block of at least about 6 consecutive phosphorothioate (PS) linkages, such as at least about 8, at least about 10, or at least about 12 consecutive phosphorothioate (PS) linkages. The at least one block may be located at the 3' end of the oligonucleotide. The at least one block may be located within 3 nucleotides of the 3' end of the oligonucleotide. The oligonucleotide may comprise modified nucleobases arranged along the oligonucleotide or in a region thereof in a defined pattern or a modified nucleobase motif. The nucleobase modifications may be arranged in a gapped motif. The nucleobase modifications may be arranged in an alternating motif. These motifs may be the same as or different from the modified sugar and internucleoside linkage motifs discussed above. The oligonucleotides may comprise a block of modified nucleobases. The block may be at the 3' end of the oligonucleotide. The block may be within 3 nucleotides of the 3' end of the oligonucleotide. The block may be at the 5' end of the oligonucleotide. The block may be within 3 nucleotides of the 5' end of the oligonucleotide.

[0142] The nucleobase modifications may be a function of the natural base at a particular position of an oligonucleotide. For example, each purine containing nucleotide or each pyrimidine containing nucleotide in an oligonucleotide may be modified. Each adenine containing nucleotide may be modified. Each guanine containing nucleotide may be modified. Each thymine containing nucleotide may be modified. Each cytosine containing nucleotide may be modified. Each uracil containing nucleotide may be modified.

[0143] Some, all, or none of the cytosine containing nucleotides in an oligonucleotide are 5-methyl cytosine nucleotides.

[0144] The oligonucleotide may comprise modifications in its sugars, internucleoside linkages, nucleobase, and overall length. These listed modifications are independent of each other and may exist in any combination and permutation. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.

[0145] The oligonucleotide preferably comprises one or more 2’-O-methoxyethyl (2'-MOE) nucleotides and / or one or more 2'-O-methyl (OMe) nucleotides. The oligonucleotide preferably comprises only 2’-O-methoxyethyl (2'-MOE) nucleotides or only 2'-O-methyl (OMe) nucleotides. The oligonucleotide preferably comprises at least about 10%, at least about 20%, at least about 30%, at least about 40% or at least about 50% 2’-O- methoxyethyl (2'-MOE) nucleotides or at least about 10%, at least about 20%, at least about 30%, at least about 40% or at least about 50% 2'-O-methyl (OMe) nucleotides. The oligonucleotide preferably comprises about 50% 2’-O-methoxyethyl (2'-MOE) nucleotides or about 50% 2'-O-methyl (OMe) nucleotides.

[0146] The oligonucleotide preferably comprises one or more phosphorothioate (PS) internucleoside linkages and / or one or more phosphorodiamidate morpholino (PMO) internucleoside linkages. The oligonucleotide preferably comprises only phosphorothioate (PS) internucleoside linkages or only phosphorodiamidate internucleoside linkages.

[0147] The oligonucleotide preferably comprises one of the following: 1. only phosphorodiamidate linked morpholino nucleotides;

[0148] 2. only phosphorothioate (PS) linked 2'-O-methoxyethyl (2'-MOE) nucleotides;

[0149] 3. about 50% 2'-O-methoxyethyl (2'-MOE) nucleotides and about 50% phosphorothioate (PS) linked nucleotides; and

[0150] 4. only phosphorothioate (PS) linked 2'-O-methyl (OMe) nucleotides.

[0151] In 3, the oligonucleotide preferably comprises alternating 2'-MOE nucleotides and DNA nucleotides with PS on the DNA nucleotides.

[0152] The oligonucleotide preferably comprises or consists of the sequence shown in any one of SEQ ID NOs: 1-28, 33-50, and 55-74 and having any of the modifications discussed above, especially those set out in #l-#4 in the previous paragraph. The oligonucleotide preferably comprises or consists of the sequence shown in any one of SEQ ID NOs: 1-26, 33-50, and 55-74 and having any of the modifications discussed above, especially those set out in #1- #4 in the previous paragraph. The oligonucleotide preferably comprises or consists of the sequence shown in any one of SEQ ID NOs: 1-2, 5-9. 12, 13, 15-18, 20-26, 33-36, 38-50 and 55-74 and having any of the modifications discussed above, especially those set out in #l-#4 in the previous paragraph.

[0153] The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 11, 34 or 71 and having any of the modifications discussed above, especially those set out in #l-#4 in the above paragraph. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 34 or 71 and having any of the modifications discussed above, especially those set out in #l-#4 in the above paragraph. The oligonucleotide preferably comprises or consists of the sequence shown in any one of SEQ ID NOs: 29-32, 51-54, and 75-78.

[0154] The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 7, 8, 12, 18, 21, 39, 40, 41, 42 or 48 and having any of the modifications discussed above, especially those set out in #l-#4 in the above paragraph. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 7, 8, 12, 18, 21, 39, 40, 41, 42 or 48.

[0155] The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 7, 39 or 42 and having any of the modifications discussed above, especially those set out in #l-#4 in the above paragraph. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 7, 39 or 42.

[0156] One or more nucleotides in the oligonucleotide may be modified, for instance with a label or a tag. The label may be any suitable label which allows the polynucleotide to be detected. Suitable labels include, but are not limited to, fluorescent molecules, radioisotopes, e.g.,1251,35S, enzymes, antibodies, antigens, other polynucleotides, and ligands such as biotin.

[0157] The oligonucleotide may also be modified with a conjugate group. Conjugate groups typically modify one or more properties of the oligonucleotide including, but not limited to, its pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge, and clearance. Conjugate groups are routinely used in the art.

[0158] Conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, including an N- Acetylgalactosamine (GalNAc) moiety and acholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765- 2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777- 3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Then, 1996, 277, 923-937).

[0159] The conjugate group may comprise an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

[0160] The label, tag or conjugate group may be directly attached to the oligonucleotide. The label, tag or conjugate group may be attached to the oligonucleotide by a linking group. Suitable linking groups include, but are not limited to, bifunctional linking moieties such as those known in the art. Some nonlimiting examples of conjugate linking moieties include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexa ne-1 -carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C1-C10 alkyl, substituted or unsubstituted C2 -CIO alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. Further linking groups include ethylene glycol-based linkers, for instance ethylene glycol based linkers with from about 2 to about 48 units and / or a molecular weight up to 5,000, and N- acetylgalactosamine (GalNAc) polymers.

[0161] The label, tag or conjugate group may be attached to either or both ends of the oligonucleotide and / or at any internal position.

[0162] The oligonucleotide is preferably single stranded. The oligonucleotide can be double stranded.

[0163] Oligonucleotides may be manufactured using standard techniques. Custom oligonucleotides having specific sequences and modifications are commercially available from various suppliers (such as IDT, SynOligo, RiboBio, Wuxi Apptec, and Gene Tools).

[0164] Oligonucleotide length

[0165] The oligonucleotide may be any length as long as it specifically hybridises to a target portion of the 3' UTR of HNRNPD mRNA and blocks at least one inhibitory miRNA binding site. As explained below, inhibitory miRNA binding sites are typically at least 5 nucleotides in length (see also SEQ ID NO: 79 below). The oligonucleotide also needs to comprise sufficient nucleotides that allow it to specifically hybridise to the 3' UTR of HNRNPD mRNA. The oligonucleotide is preferably from about 8 to about 50 nucleotide in length. The oligonucleotide is preferably about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, or about 50 nucleotides in length.

[0166] The oligonucleotide is preferably at least about 16 nucleotides in length. The oligonucleotide is preferably at least about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, or about 50 nucleotides in length. The oligonucleotide is preferably from about 22 to about 27 nucleotides in length. The oligonucleotide is preferably about 22, about 23, about 24, about 25, about 26, or about 27 nucleotides in length. The oligonucleotide is most preferably about 25 nucleotides in length.

[0167] Specific hybridisation

[0168] The oligonucleotide specifically hybridises to the target portion of the 3' UTR of HNRNPD mRNA. The oligonucleotide "specifically hybridises" to the target portion when it hybridises with preferential or high affinity to the partner but does not substantially hybridise, does not hybridise, or hybridises with only low affinity to other polynucleotide sequences, especially other RNA sequences in the cell. This can be measured using techniques known in the art.

[0169] Conditions that permit hybridisation are well-known in the art (for example, Sambrook et al., 2001, Molecular Cloning: a laboratory manual, 3rd edition, Cold Spring Harbour Laboratory Press; and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and Wiley-lnterscience, New York (1995)). Hybridisation can be carried out under low stringency conditions, for example in the presence of a buffered solution of 30 to 35% formamide, 1 M NaCI and 1 % SDS (sodium dodecyl sulfate) at 37 °C followed by a 20-minute wash in from IX (0.1650 M Na+) to 2X (0.33 M Na+) SSC (standard sodium citrate) at 50 °C. Hybridisation can be carried out under moderate stringency conditions, for example in the presence of a buffer solution of 40 to 45% formamide, 1 M NaCI, and 1 % SDS at 37 °C, followed by a wash in from 0.5X (0.0825 M Na+) to IX (0.1650 M Na+) SSC at 55 °C. Hybridisation can be carried out under high stringency conditions, for example in the presence of a buffered solution of 50% formamide, 1 M NaCI, 1% SDS at 37 °C, followed by a wash in 0.1X (0.0165 M Na+) SSC at 60 °C.

[0170] The oligonucleotide "specifically hybridises" if it hybridises to the target portion with a melting temperature (Tm) that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C or at least 10 °C, greater than its Tm for other RNA sequences. More preferably, the oligonucleotide hybridises to the target portion with a Tm that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 20 °C, at least 30 °C or at least 40 °C, greater than its Tm for other RNA sequences. Preferably, the oligonucleotide hybridises to the target portion with a Tm that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 20 °C, at least 30 °C or at least 40 °C, greater than its Tm for a RNA which differs from the target portion by one or more nucleotides, such as by 1, 2, 3, 4 or 5 or more nucleotides. The oligonucleotide typically hybridises to the target portion with a Tm of at least 60 °C, such as at least 65 °C or at least 70 °C. The oligonucleotide preferably hybridises to the target portion with a Tm of at least 90 °C, such as at least 92 °C or at least 95 °C. Tm can be measured experimentally using known techniques, including the use of DNA microarrays, or can be calculated using publicly available Tm calculators, such as those available over the internet.

[0171] The sequence of the target portion is preferably found / present in the 3' UTR of HNRNPD mRNA but is not found in any exonic RNA molecules in the cell. The sequence of the target portion is preferably found / present in the 3' UTR of HNRNPD mRNA but is not found in any human exonic RNA molecule. The target portion may in some embodiments be found in intronic or intragenic regions in the cell or human cell. The sequence of the target portion is preferably found / present in the 3' UTR of HNRNPD mRNA but is not found in any other RNA molecule in the cell. The sequence of the target portion is preferably found / present in the 3' UTR of HNRNPD mRNA but is not found in any other human RNA molecule. The skilled person can determine such sequences using publicly available sequence databases and sequence searching tools, such as the UCSC genome browser, the NCBI nucleotide database or the Ensembl browser.

[0172] The oligonucleotide is preferably at least about 90% identical or homologous to the reverse complement of the target portion over its entire length. The oligonucleotide is preferably at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical or homologous to the target portion over its entire length. Homology or sequence identity is typically measured over the entire length of reference sequence (e.g., the target portion). This may also be referred to as global homology or global sequence identity. The oligonucleotide may also have a lower sequence homology or identity to the reverse complement of the target portion because it comprises universal nucleotides which base pair with any nucleotide in the target portion.

[0173] A sequence having at least about 90% identity or homology to the reverse complement of the oligonucleotide is preferably found / present in the 3' UTR of HNRNPD mRNA but is not found in any other RNA molecule in the cell. A sequence having at least about 90% identity or homology to the reverse complement of the oligonucleotide is preferably found / present in in the 3' UTR of HNRNPD mRNA but is not found in any other human RNA molecule. The reverse complement of the oligonucleotide is preferably found / present in the 3' UTR of HNRNPD mRNA but is not found in any other RNA molecule in the cell. The reverse complement of the oligonucleotide is preferably found / present in the 3' UTR of HNRNPD mRNA but is not found in any other human RNA molecule.

[0174] Methods of measuring homology or sequence identity, including global homology or global sequence identity, are known in the art. For example, the UWGCG Package provides the BESTFIT program which can be used to calculate homology or identity (e.g., used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can also be used to calculate identity, homology, or line up sequences (typically on their default settings), for example as described in Altschul S.F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al (1990) J Mol Biol 215:403-10.

[0175] Software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information, (http: / / www.ncbi. nlm.nih.gov / )This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M = 5, N=4, and a comparison of both strands.

[0176] The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

[0177] The oligonucleotide typically comprises or consists of a sequence which is identical to the reverse complement of the target portion over at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, or at least about 49 consecutive nucleotides. The oligonucleotide typically comprises or consists of a sequence which is identical to the reverse complement of the target portion over at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, or at least about 27 consecutive nucleotides. The oligonucleotide most preferably comprises or consists of a sequence which is the reverse complement of the target portion. Complementarity based on Watson-Crick base pairing is well known in the art.

[0178] The target portion is typically the same length as the oligonucleotide. The target portion is preferably from about 8 to about 50 nucleotide in length. The target portion is preferably about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, or about 50 nucleotides in length.

[0179] Human HNRNPD

[0180] The target portion is preferably a portion of the sequence shown in SEQ ID NO: 79 as discussed below. The target portion is preferably at least about 90%, such as at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, identical or homologous to the reverse complement of the sequence shown in any one of SEQ ID NOs: 1-28, 33-50, and 55-74. The target portion is at least about 90%, such as at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, identical or homologous to the reverse complement of the sequence shown in SEQ ID NO: 11, 34 or 71. The target portion is at least about 90%, such as at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, identical or homologous to the reverse complement of the sequence shown in SEQ ID NO: 34 or 71.

[0181] The target portion is preferably the reverse complement of the sequence shown in any one of SEQ ID NOs: 1-28, 33-50, and 55-74. The target portion is preferably the reverse complement of the sequence shown in SEQ ID NO: 11, 34 or 71. The target portion is preferably the reverse complement of the sequence shown in SEQ ID NO: 34 or 71. miRNAs and binding sites

[0182] The oligonucleotide blocks at least one inhibitory miRNA binding site. The target portion in the 3' UTR typically comprises the at least one inhibitory miRNA binding site. By specifically hybridising to the target portion, the oligonucleotide prevents the inhibitory miRNA from binding to its binding site and inhibiting HNRNPD expression. The inhibitory miRNA is preferably miR-141-3p or miR-146-5p. The sequences of the mature forms of these inhibitory miRNAs are shown in SEQ ID NOs: 80 and 84 respectively.

[0183] The way in which inhibitory miRNAs bind to mRNA and inhibitory miRNA binding sites are known in the art. At least 5 nucleotides in the miRNA typically bind to the mRNA such that the miRNA inhibits expression of the gene. The seed sequence in the miRNA is typically important for the binding of the miRNA to the mRNA. The seed sequence (or seed region) is a conserved heptametric sequence which is typically situated at positions 2-8 from the 5' end of the miRNA.

[0184] The oligonucleotide preferably blocks two or more inhibitory miRNA binding sites, such as 2, 3, 4 or more inhibitory miRNA binding sites. The two or more inhibitory miRNA binding sites may be distinct. This means the two or more inhibitory miRNA binding sites are bound by different parts of the miRNA. An example of this are the two inhibitory binding sites shown in SEQ ID NOs: 81 and 82. The two or more inhibitory miRNA binding sites may be overlapping. This means the two or more inhibitory miRNA binding sites are bound by overlapping parts of the miRNA. An example of this is shown in SEQ ID NOs: 84 and 85.

[0185] The two or more miRNA binding sites may have the same length. The two or more inhibitory miRNA binding sites may have different lengths. For instance, SOL044(0) blocks two inhibitory miRNA binding sites shown in SEQ ID NOs: 81 and 82, which have different lengths (5 nucleotides and 8 nucleotides respectively).

[0186] The oligonucleotide preferably blocks at least one miR-141-3p binding site. The oligonucleotide preferably blocks two or more miR-141-3p binding sites. The oligonucleotide preferably blocks at least one miR-146-5p binding site. The oligonucleotide preferably blocks two or more miR-146-5p binding sites.

[0187] A skilled person is capable of designing an oligonucleotide that specifically hybridises to the 3' UTR of the HNRNPD mRNA and blocks at least one inhibitory miRNA binding site. Tools for designing suitable oligonucleotides include, but are not limited to, PFRED (e.g., Sciabola S, Xi H, Cruz D, Cao Q, Lawrence C, Zhang T, Rotstein S, Hughes JD, Caffrey DR, Stanton RV. PFRED: A computational platform for siRNA and antisense oligonucleotides design. PLoS One. 2021 Jan 22;16(l):e0238753. doi: 10.1371 / journal.pone.0238753. PMID: 33481821; PMCID: PMC7822268) and LNCASO (https: / / iomics.ugent.be / lncaso).

[0188] The at least one inhibitory miRNA binding site is typically at least 5 nucleotides in length. The at least one inhibitory miRNA binding site is preferably from about 5 to about 10 nucleotides in length. The at least one inhibitory miRNA binding site is preferably about 5, about 6, about 7 about 8, about 9, or about 10 nucleotides in length. The at least one inhibitory miRNA binding site is preferably about 5, about 6 or about 8 nucleotides in length. These lengths equally apply to the two or more inhibitory miRNA binding sites.

[0189] The at least one inhibitory miRNA binding site typically comprises a stretch of consecutive nucleotides from the reverse complement of the inhibitory miRNA sequence. The at least one inhibitory miRNA binding site typically comprises from about 5 to about 10 consecutive nucleotides, such as about 5, about 6, about 7, about 8, about 9 or about 10 consecutive nucleotides from the reverse complement of the inhibitory miRNA sequence. The at least one inhibitory miRNA binding site typically comprises from about 5 to about 10 consecutive nucleotides, such as about 5, about 6, about 7, about 8, about 9 or about 10 consecutive nucleotides from the reverse complement of miR-141-3p or miR-146-5p. For instance, SOL045(0) comprises the miR-146-5p binding site shown in SEQ ID NO: 84, which is 5 nucleotides in length. SOL046(0) comprises the miR-146-5p binding site shown in SEQ ID NO: 85, which is 8 nucleotides in length.

[0190] The consecutive nucleotides are preferably from the about 10 nucleotides at the 3' end of the reverse complement of the inhibitory miRNA sequence, miR-141-3p or miR-146-5p. The consecutive nucleotides are preferably from the 7 nucleotides at positions 2-8 from the 3' end of the reverse complement of the inhibitory miRNA sequence, miR-141-3p or miR-146- 5p. This is also known as the seed sequence or the seed region.

[0191] Preferred oligonucleotide sequences

[0192] The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of the target portion and which comprises a sequence which is identical to at least about 5 consecutive nucleotides, such as at least about 5, about 6, about 7 about 8, about 9, or about 10 consecutive nucleotides, from the inhibitory miRNA sequence, miR- 141-3p or miR-146-5p. The consecutive nucleotides are preferably from the about 10 nucleotides at the 5' end of the inhibitory miRNA sequence, miR-141-3p or miR-146-5p. The consecutive nucleotides are preferably from the 7 nucleotides at positions 2-8 from the 5' end of inhibitory miRNA sequence, miR-141-3p or miR-146-5p. This is also known as the seed sequence or the seed region.

[0193] The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of the target portion and which comprises a sequence which is the reverse complement of the inhibitory miRNA binding site. The target portion may have any of the lengths discussed above. The miRNA binding site may be any of those discussed above.

[0194] The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of the target portion and which comprises a sequence which is identical to at least about 5 consecutive nucleotides, such as at least about 5, about 6, about 7 about 8, about 9, or about 10 consecutive nucleotides, from the sequence shown in SEQ ID NO: 80 or 83. The target portion may have any of the lengths discussed above. The consecutive nucleotides are preferably from the about 10 nucleotides at the 5' end of the sequence shown in SEQ ID NO: 80 or 83. The consecutive nucleotides are preferably from the 7 nucleotides at positions 2-8 from the 5' end of the sequence shown in SEQ ID NO: 80 or 83. This is also known as the seed sequence or the seed region. The oligonucleotide may comprise T in place of U in SEQ ID NO: 80 or 83.

[0195] The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of the target portion and which comprises the sequence(s) shown in SEQ ID NO: 81 and / or 82. The target portion may have any of the lengths discussed above.

[0196] The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of the target portion and which comprises the sequence shown in SEQ ID NO: 84 or 85. The target portion may have any of the lengths discussed above.

[0197] The sequences of the 3' UTRs of HNRNPD in various species are known in the art. There are several isoforms of human HNRNPD (including ENSG00000138668.20 and all of its associated isoforms, including ENST00000313899.12 (p45), ENST00000352301.8 (p42), ENST00000353341.8 (p40) and ENST00000503822.2 (p37)). The invention may involve any of these isoforms. The main HNRNPD isoforms are p45, p42, p40 and p37. The sequence of the 3' UTR of human HNRNPD mRNA is the same in all four isoforms and is shown in SEQ ID NO: 79. The 3' UTR preferably comprises or consists of the sequence shown in SEQ ID NO: 79.

[0198] The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of from about 8 to about 50 (or any of the lengths of the target portion set out above) nucleotides of the sequence shown in SEQ ID NO: 79 and which comprises a sequence which is identical to at least about 5 consecutive nucleotides, such as at least about 5, about 6, about 7 about 8, about 9, or about 10 consecutive nucleotides, from the inhibitory miRNA sequence, miR-141-3p or miR-146-5p. The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of from about 8 to about 50 (or any of the lengths of the target portion set out above) nucleotides of the sequence shown in SEQ ID NO: 79 and which comprises a sequence which is the reverse complement to at least about 5 consecutive nucleotides, such as at least about 5, about 6, about 7 about 8, about 9, or about 10 consecutive nucleotides, from the inhibitory miRNA binding site. The consecutive nucleotides are preferably from the about 10 nucleotides at the 5' end of the inhibitory miRNA sequence, miR-141-3p or miR-146-5p. The consecutive nucleotides are preferably from the 7 nucleotides at positions 2-8 from the 5' end the inhibitory miRNA sequence, miR-141-3p or miR-146-5p. This is also known as the seed sequence or the seed region. The nucleotides of the sequence shown in SEQ ID NO: 79 are preferably consecutive nucleotides from the sequence shown in SEQ ID NO: 79. The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of from about 8 to about 50 nucleotides (or any of the lengths of the target portion set out above) of the sequence shown in SEQ ID NO: 79 and which comprises a sequence which is identical to at least about 5 consecutive nucleotides, such as at least about 5, about 6, about 7 about 8, about 9, or about 10 consecutive nucleotides, from the sequence shown in SEQ ID NO: 80 or 83. The consecutive nucleotides are preferably from the about 10 nucleotides at the 5' end of the sequence shown in SEQ ID NO: 80 or 83. The consecutive nucleotides are preferably from the 7 nucleotides at positions 2-8 from the 5' end of the sequence shown in SEQ ID NO: 80 or 83. This is also known as the seed sequence or the seed region. The nucleotides of the sequence shown in SEQ ID NO: 79 are preferably consecutive nucleotides from the sequence shown in SEQ ID NO: 79. The oligonucleotide may comprise T in place of U in SEQ ID NO: 80 or 83.

[0199] The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of from about 8 to about 50 (or any of the lengths of the target portion set out above) nucleotides of the sequence shown in SEQ ID NO: 79 and which comprises the sequence(s) shown in SEQ ID NO: 81 and / or 82. The oligonucleotide preferably comprises or consists of a sequence which is the reverse complement of from about 8 to about 50 (or any of the lengths of the target portion set out above) nucleotides of the sequence shown in SEQ ID NO: 79 and which comprises the sequence shown in SEQ ID NO: 84 or 85. The nucleotides of the sequence shown in SEQ ID NO: 79 are preferably consecutive nucleotides from the sequence shown in SEQ ID NO: 79.

[0200] The oligonucleotide preferably comprises or consists of the sequence shown in any one of SEQ ID NOs: 1-28, 33-50, and 55-74. The oligonucleotide preferably comprises or consists of the sequence shown in any one of SEQ ID NOs: 1-26, 33-50, and 55-74. The oligonucleotide preferably comprises or consists of the sequence shown in any one of SEQ ID NOs: 1-2, 5-9. 12, 13, 15-18, 20-26, 33-36, 38-50 and 55-74. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 11, 34 or 71. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 34 or 71. These oligonucleotides may comprise any of the modifications discussed above. The oligonucleotide preferably comprises or consists of the sequence shown in any one of SEQ ID NOs: 29-32, 51-54, and 75-78. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 7, 8, 12, 18, 21, 39, 40, 41, 42 or 48. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 7, 39 or 42.

[0201] Administration to subjects

[0202] The cell or two or more cells is / are preferably in a subject. The method preferably comprises administering the oligonucleotide or two or more oligonucleotides to the subject. The invention therefore provides a method of reducing senescence in a cell or two or more cells in a subject, comprising administering to the subject an oligonucleotide or two or more oligonucleotides which specifically hybridise(s) to a target portion of the 3' untranslated region (UTR) of heterogeneous nuclear riboprotein particle D HNRNPD') mRNA and block(s) at least one inhibitory microRNA (miRNA) binding site and thereby reducing senescence in the cell or two or more cells. This method may involve any of the embodiments discussed above. The oligonucleotide(s) may be any of those discussed above, including the modified oligonucleotides. The oligonucleotide(s) may be administered in the form of a pharmaceutical composition of the invention or a dermatological composition of the invention.

[0203] The two or more oligonucleotides may be administered simultaneously, separately or sequentially. The invention also provides two or more oligonucleotides as defined above as a combined preparation for simultaneous, separate or sequential use in a method of reducing senescence in a cell or two or more cells in a subject. The two or more oligonucleotides can be used in either order. There may be any time period between administering sequentially. One oligonucleotide may may be administered immediately after the other oligonucleotide. The time period between sequential administrations may be less than about 5 seconds, less than about 10 seconds, less than about 30 seconds, less than about 1 minute, less than about 5 minutes, less than about 10 minutes, less than about 30 minutes, less than about 1 hour, less than about 2 hours, less than about 6 hours, less than about 12 hours or less than about 24 hours. There may be longer time periods between administrations.

[0204] The invention also provides an oligonucleotide or two or more oligonucleotides which specifically hybridise(s) to a target portion of the 3' UTR of HNRNPD mRNA and block(s) at least one inhibitory miRNA binding site for use in a method of reducing senescence in a cell or two or more cells in a subject. The invention also provides use of an oligonucleotide or two or more oligonucleotides which specifically hybridise(s) to a target portion of the 3' UTR of HNRNPD mRNA and block(s) at least one inhibitory miRNA binding site in the manufacture of a medicament for reducing senescence in a cell or two or more cells in a subject. The oligonucleotide(s) may be any of those discussed above, including the modified oligonucleotides. The oligonucleotide(s) may be administered in the form of a pharmaceutical composition of the invention or a dermatological composition of the invention.

[0205] Two or more oligonucleotides, such as 3, 4, 5 or 6 oligonucleotides, as defined above may be administered to the subject. The invention may comprise administering to the subject two or more of (a) an oligonucleotide comprising or consisting of the sequence shown in any one of SEQ ID NOs: 1-28, in any one of SEQ ID NOs: 1-26, in any one of SEQ ID NOs: 1-2, 5-9. 12, 13, 15-18, 20-26 or in SEQ ID NO: 29-32, (b) an oligonucleotide comprising or consisting of the sequence shown in any one of SEQ ID NOs: 33-50 or in any of one of SEQ ID NOs: 33-36 and 38-50, or (c) an oligonucleotide comprising or consisting of the sequence shown in any one of SEQ ID NOs: 55-74, such as (a) and (b), (a) and (c), (b) and (c) and (a), (b) and (c). The invention may comprise administering to the subject two or more of (a) an oligonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 11, (b) an oligonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 34, or (c) an oligonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 72, such as (a) and (b), (a) and (c), (b) and (c) and (a), (b) and (c). The invention may comprise administering to the subject an oligonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 34 and / or an oligonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 72. The two or more oligonucleotides may be modified in any of the ways discussion above.

[0206] The invention may comprise administering to the subject two or more of (a) an oligonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 7, (b) an oligonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 39, or (c) an oligonucleotide comprising or consisting of the sequence shown in SEQ ID NO: 42, such as

[0207] (a) and (b), (a) and (c), (b) and (c) and (a), (b) and (c). The two or more oligonucleotides may be modified in any of the ways discussion above.

[0208] The subject is preferably mammalian. The subject is preferably a human, dog, cat, primate, horse, murine, rat, rodent, bovine, murine, porcine, or ovine. The subject is preferably a human.

[0209] The invention comprises administering to the subject an effective amount of the oligonucleotide or two or more oligonucleotides. An effective amount is an amount which reduces senescence in the cell or two or more cells. Suitable amounts are discussed in more detail below.

[0210] The invention may be used in combination with other means of, and substances or compositions for, reducing senescence. Such means, substances or compositions are known in the art.

[0211] The oligonucleotide(s) can be administered by one or more routes of administration using one or more of a variety of methods known in the art. As will be appreciated by the skilled person, the route and / or mode of administration will vary depending upon the desired results. Routes of administration include, but are not limited to, intravenous, intramuscular, intradermal, intraperitoneal, intrapleural, subcutaneous, spinal, or other parenteral routes of administration, for example by injection or infusion. The phrase "parenteral administration" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, intrapleural and intra-sternal injection and infusion. Administration may be intrapleural or intraperitoneal.

[0212] The oligonucleotide(s) is / are preferably administered by inhalation. The oligonucleotide(s) is / are preferably administered by inhalation when the disease or condition is associated with the lung. The oligonucleotide(s) is / are preferably administered by inhalation when the disease or condition is any of the interstitial lung diseases (ILDs) discussed below, including any of the ILDs associated with progressive pulmonary fibrosis (PPF), such as idiopathic pulmonary fibrosis (IPF).

[0213] The invention provides a method for treating or preventing (i) a lung disease or condition, (ii) an ILD associated with PPF or (ii) IPF in a subject, the method comprising administering to the subject by inhalation an oligonucleotide or two or more oligonucleotides which specifically hybridise(s) to a target portion of the 3' untranslated region (UTR) of heterogeneous nuclear riboprotein particle D HNRNPD) mRNA and block(s) at least one inhibitory microRNA (miRNA) binding site and thereby reducing senescence in one or more cells associated with the disease or condition, the ILD associated with PPF or the IPF. Alternatively, the oligonucleotide(s) can be administered by a nonparenteral route, such as a topical, epidermal, or mucosal route of administration, for example, intranasally, orally, vaginally, rectally, sublingually, or topically. The oligonucleotide(s) may be for subcutaneous administration.

[0214] The oligonucleotide(s) may be formulated using any suitable method. Formulation with standard carriers and / or diluents may be carried out using routine methods in the pharmaceutical art. The exact nature of a formulation will depend upon several factors including the composition to be administered and the desired route of administration. Suitable types of formulation are fully described in Remington's Pharmaceutical Sciences, 23rd Edition, Mack Publishing Company, Eastern Pennsylvania, USA.

[0215] The oligonucleotide(s) may be formulated for pharmaceutical use. The oligonucleotide(s) may be administered in a pharmaceutical composition. The pharmaceutical composition typically also comprises a pharmaceutical acceptable carrier and / or diluent. The carrier and / or diluent is generally selected to be suitable for the intended mode of administration and can include agents for modifying, maintaining, or preserving, for example, the pH, osmolarity, viscosity, clarity, colour, isotonicity, odour, sterility, stability, rate of dissolution or release, adsorption, or penetration of the oligonucleotide(s). Typically, these carriers and / or diluents include aqueous or alcoholic / aqueous solutions, emulsions, or suspensions, including saline and / or buffered media. Pharmaceutical compositions may be prepared together with a physiologically acceptable carrier or diluent. The oligonucleotide(s) may be mixed with an excipient which is pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, of the like and combinations thereof.

[0216] For oligonucleotides, examples of pharmaceutically acceptable salts include, but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

[0217] Suitable parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer's. Suitable physiologically acceptable thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates may be included. Intravenous vehicles include fluid and nutrient replenishers and electrolyte replenishers, such as those based on Ringer's dextrose. In some cases, one might include agents to adjust tonicity of the composition, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in a pharmaceutical composition. For example, in many cases it is desirable that the pharmaceutical composition is substantially isotonic. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents, and inert gases, may also be present. The precise formulation will depend on the route of administration.

[0218] Suspensions and emulsions may contain as carrier, for example a natural gum, agar, sodium alginate, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol. The suspensions or solutions for intramuscular injections may contain, together with the active substance, a pharmaceutically acceptable carrier, e.g., sterile water, olive oil, ethyl oleate, glycols, e.g., propylene glycol, and if desired, a suitable amount of lidocaine hydrochloride.

[0219] When parenteral administration is contemplated, the pharmaceutical compositions are usually in the form of a sterile, pyrogen-free, parenterally acceptable composition. A particularly suitable vehicle for parenteral injection is a sterile, isotonic solution, properly preserved. The oligonucleotide(s) can be in the form of a lyophilizate, such as a lyophilized cake. The pharmaceutical composition is preferably in a form suitable for inhalation, such as a solution, a suspension or a dry powder. The pharmaceutical composition may comprise suitable carriers and / or excipients as discussed above. The pharmaceutical composition may be in the form of lyophilised powder and may be administered as a dry powder.

[0220] Alternatively, the lyophilised powered may be rehydrated to form a suspension prior to administration.

[0221] Pharmaceutical compositions for topical administration may include transdermal patches, ointments, lotions, creams, gels, hydrogels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.

[0222] Typically, pharmaceutical compositions for subcutaneous administration contain suitable stabilizers (e.g., amino acids, such as methionine, and or saccharides such as sucrose), buffering agents and tonicifying agents.

[0223] For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1% to 2%.

[0224] Compositions for oral administration may be syrups, emulsions, or suspensions. The syrups may contain as carriers, for example, saccharose or saccharose with glycerine and / or mannitol and / or sorbitol. Oral pharmaceutical compositions include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These pharmaceutical compositions typically take the form of solutions or suspensions and contain 10% to 95% of active ingredient, preferably 25% to 70%.

[0225] Where the oligonucleotide(s) is / are lyophilised, the lyophilised material may be reconstituted prior to administration, e.g., a suspension. Reconstitution is preferably effected in buffer.

[0226] In addition, if desired, the pharmaceutical composition administered may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and / or adjuvants which enhance effectiveness. The pharmaceutical composition preferably comprises human serum albumin.

[0227] One suitable carrier or diluent is Plasma-Lyte A®. This is a sterile, nonpyrogenic isotonic solution for intravenous administration. Each 100 mL contains 526 mg of Sodium Chloride, USP (NaCI); 502 mg of Sodium Gluconate (C6HllNaO7); 368 mg of Sodium Acetate Trihydrate, USP (C2H3NaO2*3H2O); 37 mg of Potassium Chloride, USP (KCI); and 30 mg of Magnesium Chloride, USP (MgCI2*6H2O). It contains no antimicrobial agents. The pH is adjusted with sodium hydroxide. The pH is 7.4 (6.5 to 8.0).

[0228] Suitable further agents for inclusion in the pharmaceutical composition include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine, or lysine), antimicrobials, antioxidants (such as ascorbic acid, sodium sulphite, or sodium hydrogensulphite), buffers (such as borate, bicarbonate, Tris-HCI, citrates, phosphates, or other organic acids), bulking agents (such as mannitol or glycine), chelating agents (such as ethylenediamine tetraacetic acid (EDTA)), complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin, or hydroxypropyl-beta-cyclodextrin), fillers, monosaccharides, disaccharides, and other carbohydrates (such as glucose, mannose, or dextrins), proteins (such as free serum albumin, gelatin, or immunoglobulins), colouring, flavouring and diluting agents, emulsifying agents, hydrophilic polymers (such as polyvinylpyrrolidone), low molecular weight polypeptides, salt-forming counterions (such as sodium), preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid, or hydrogen peroxide), solvents (such as glycerin, propylene glycol, or polyethylene glycol), sugar alcohols (such as mannitol or sorbitol), suspending agents, surfactants or wetting agents (such as pluronics; PEG; sorbitan esters; polysorbates such as Polysorbate 20 or Polysorbate 80; Triton; tromethamine; lecithin; cholesterol or tyloxapal), stability enhancing agents (such as sucrose or sorbitol), tonicity enhancing agents (such as alkali metal halides, such as sodium or potassium chloride, or mannitol sorbitol), delivery vehicles, excipients and / or pharmaceutical adjuvants.

[0229] All of the carriers and / or diluents discussed above are pharmaceutically acceptable.

[0230] The oligonucleotide(s) may be formulated as a dermatological composition. The pharmaceutical composition of the invention may be a dermatological composition. Such compositions may be used to treat or prevent one or more signs of ageing in a subject. The dermatological composition is preferably administered by gymnosis.

[0231] All of the carriers and / or diluents discussed above with reference to the pharmaceutical composition are dermatologically acceptable. The dermatological composition may comprise any of the pharmaceutical carriers and / or diluents discussed above. The dermatological composition may comprise any of the pharmaceutical carriers and / or diluents discussed above with reference to topical compositions.

[0232] The dermatological composition may have the appearance of a white or coloured cream, an ointment, a milk, a lotion, a serum, a paste or of a foam. The dermatological composition can be an aerosol. The dermatological composition may also be in pulverulent solid form, for example in stick form. The dermatological composition may be in the form of a patch, a pencil, a brush, or an applicator. These allow localized application to areas of the skin, hair, or nails. The dermatological composition can also be formulated as a care product and / or as a makeup product.

[0233] The dermatological composition may also comprise typical adjuvants used in the dermatological fields. These include, but are not limited to hydrophilic or lipophilic gelling agents, hydrophilic or lipophilic active agents, preservatives, antioxidants, solvents, perfumes, fillers, filters, pigments, odour absorbers, and dyestuffs. The amounts of these various adjuvants are those conventionally used in the field. These adjuvants, depending on their nature, can be introduced into the fatty phase, into the aqueous phase, into the lipid vesicles and / or into the nanoparticles.

[0234] The dermatological composition may be an emulsion. The proportion of the fatty phase may range from about 5% to about 80% by weight, and preferably from about 5% to 50% by weight relative to the total weight of the composition. The oils, emulsifiers and coemulsifiers used in the emulsion form are chosen from those conventionally used in the field. The emulsifier and the coemulsifier are present in the composition in a proportion ranging from about 0.3% to about 30% by weight, and preferably from about 0.5% to about 20% by weight relative to the total weight of the composition.

[0235] Suitable oils for use in the dermatological composition include, but are not limited to, mineral oils, such as liquid petrolatum, vegetable oils, such as avocado oil or soybean oil, oils of animal origin, such as lanolin, synthetic oils, such as perhydrosqualene, silicone oils, such as cyclomethicone, and fluorinated oil,s such as perfluoropolyethers. It is also possible to use fatty alcohols, such as cetyl alcohol, fatty acids or waxes, such as carnauba wax, or ozokerite.

[0236] Examples of emulsifiers and coemulsifiers that may be used in combination include, for example, fatty acid and polyethylene glycol esters, such as PEG-20 stearate, and fatty acid and glycerol esters, such as glyceryl stearate.

[0237] The dermatological composition may comprise a hydrophilic gelling agent, such as carboxyvinyl polymers (carbomer), acrylic copolymers such as copolymers of acrylates / alkyl acrylates, polyacrylamides, polysaccharides, gums natural and clays. The dermatological composition may comprise a lipophilic gelling agent, such as a modified clay, such as a bentone, a metal salt of fatty acids, a hydrophobic silica or a polyethylene.

[0238] The oligonucleotide(s) may be administered by gymnosis. In other words, the oligonucleotide(s) may be administered without any transfection reagent.

[0239] The oligonucleotide(s) may be administered with a transfection reagent. The pharmaceutical composition or dermatological composition may comprise a transfection reagent. The transfection reagent may be liposomes, preferably cationic liposomes, exosomes, polymers, preferably cationic polymers, and dendrimers. Other transfection reagents include, but are not limited to, macromolecule complexes, nanocapsules, microspheres, beads and lipid- based systems including oil-in-water emulsions, micelles, mixed micelles, and lipid :oligonucleotide complexes of uncharacterized structure.

[0240] Liposomes are preferred transfection reagents. Liposomes are typically microscopic spheres having an aqueous core surrounded by one or more outer layers made up of lipids arranged in a bilayer configuration (see, generally, Chonn et al., Current Op. Biotech. 1995, 6, 698- 708). The liposomes that may be used in the invention include, but are not limited to, multilamellar liposomes or MLVs (MultiLamellar Vesicle), small unilamellar liposomes or SUVs (Small Unilamellar Vesicle), or large unilamellar liposomes or LUVs (Large Unilamellar Vesicle). The liposomes may also be a nonionic liposomes whose wall is composed nonionic lipids.

[0241] The transfection agents may be lipfectamine® or oligofectamine®.

[0242] The transfection agent is preferably a pharmaceutically acceptable transfection agent. Such agents are suitable for administration to subjects and delivery of oligonucleotides.

[0243] The pharmaceutically acceptable transfection reagent is preferably a pharmaceutically acceptable PEI transfection reagent, such as a linear PEI transfection reagent. The pharmaceutical acceptable transfection reagent may be GMP in vivo-jetPEI®.

[0244] The oligonucleotide(s) may be administered with one or more penetration enhancers. The pharmaceutical composition or dermatological composition may comprise one or more penetration enhancers. Such enhancers typically enhance the alimentary delivery of the oligonucleotide(s). Penetration enhancers may be classified as belonging to one of five broad categories, i.e., fatty acids, bile salts, chelating agents, surfactants, and nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems 1991, 8, 91- 192; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems 1990, 7, 1-33). One or more penetration enhancers from one or more of these broad categories may be included.

[0245] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, recinleate, monoolein (a.k.a. 1-monooleoyl-rac- glycerol), dilaurin, caprylic acid, arachidonic acid, glyceryl 1-monocaprate, 1- dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, mono- and di-glycerides and physiologically acceptable salts thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems 1990, 7, 1; El-Hariri et al., J. Pharm. Pharmacol. 1992 44, 651-654).

[0246] The physiological roles of bile include the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 In: Goodman &. Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y., 1996, pages 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus, the term "bile salt" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.

[0247] Chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines) [Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier

[0248] Systems 1990, 7, 1-33; Buur et al., J. Control Rel. 1990, 14, 43-51). Chelating agents have the added advantage of also serving as DNase inhibitors.

[0249] Surfactants include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems 1991, page 92); and perfluorochemical emulsions, such as FC-43 (Takahashi et al., J. Pharm. Phamacol. 1988, 40, 252-257).

[0250] Non-surfactants include, for example, unsaturated cyclic ureas, 1 -alkyl- and 1- alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol. 1987, 39, 621-626).

[0251] The oligonucleotide(s) may be administered in accordance with any of the strategies described in Roberts, T.C., Langer, R. & Wood, MJ. A. Advances in oligonucleotide drug delivery. Nat Rev Drug Discov 19, 673-694 (2020).

[0252] The oligonucleotide(s) may be administered in a manner compatible with the dosage formulation and in such amount will be effective. The quantity to be administered depends on the subject to be treated, capacity of the subject's immune system and the degree of treatment desired. Precise amounts required to be administered may depend on the judgement of the practitioner and may be peculiar to each subject.

[0253] Any suitable dose of the oligonucleotide(s) may be administered to a subject. The dose may be determined according to various parameters, especially according to the oligonucleotide(s) used, the age, weight, and condition of the subject to be treated, the route of administration, and the required regimen. Again, a physician will be able to determine the required route of administration and dosage for any particular subject. A typical daily dose is from about 0.01 to 50 mg per kg of body weight, according to the activity of the specific substance, the age, weight, and conditions of the subject to be treated and the frequency and route of administration. Preferably, daily dosage levels are from 5 mg to 2 g. For example, from about 0.01 to about 50mg per kg of subject of sRNA may administered, such as from about 0.05 to about 40, from about 0.1 to about 30, from about 0.5 to about 20, from about 1 to about 10 or from about 2 to about 5 mg per kg. At least about 0.01 mg per kg of subject may administered, such as at least about 0.05, at least about 0.1, at least about 0.5, at least about 1, at least about 2, at least about 5, at least about 10, at least about 20, at least at least about 30 or at least about 40 mg per kg.

[0254] These doses may be provided as a single dose or may be provided as multiple doses, for example taken at regular intervals, for example 2, 3 or 4 doses administered daily. Other suitable regular intervals include, but are not limited to, every day, every week, every fortnight, or every month.

[0255] Therapeutic methods

[0256] The method of the invention is preferably for treating or preventing a disease or condition in the subject. The invention therefore provides a method of treating or preventing a disease or condition in a subject, comprising administering to the subject an oligonucleotide or two or more oligonucleotides which specifically hybridise(s) to a target portion of the 3' untranslated region (UTR) of heterogeneous nuclear riboprotein particle D HNRNPD) mRNA and block(s) at least one inhibitory microRNA (miRNA) binding site and thereby reducing senescence in one or more cells associated with the disease or condition. This method may involve any of the embodiments discussed above. The oligonucleotide(s) may be any of those discussed above, including the modified oligonucleotides. The oligonucleotide(s) may be administered in the form of a pharmaceutical composition as described above or a pharmaceutical composition of the invention. The one or more cells may be any of those discussed above.

[0257] The invention also provides an oligonucleotide or two or more oligonucleotides which specifically hybridise(s) to a target portion of the 3' UTR of HNRNPD mRNA and block(s) at least one inhibitory miRNA binding site for use in a method of treating or preventing a disease or condition in a subject. The invention also provides use of an oligonucleotide or two or more oligonucleotides which specifically hybridise(s) to a target portion of the 3' UTR of HNRNPD mRNA and block(s) at least one inhibitory miRNA binding site in the manufacture of a medicament for treating or preventing a disease or condition in a subject. The oligonucleotide(s) may be any of those discussed above, including the modified oligonucleotides. The oligonucleotide(s) may be administered in the form of a pharmaceutical composition as described above or a pharmaceutical composition of the invention.

[0258] Two or more oligonucleotides, such as 3, 4, 5 or 6 oligonucleotides, as defined above or of the invention may be administered to the subject or may be used. Any of the embodiments discussed above are equally applicable to the therapeutic embodiments of the invention.

[0259] The subject is preferably mammalian. The subject is preferably a human, dog, cat, primate, horse, murine, rat, rodent, bovine, murine, porcine, or ovine. The subject is preferably a human.

[0260] Routes of administration, pharmaceutical compositions and dosages are defined above. Any of these may be used in the therapeutic embodiments of the invention.

[0261] The disease is preferably associated with senescence. The disease or condition is preferably associated with increased senescence in one or more cells. This can be measured as described above. One or more cells associated with the disease or condition in the subject preferably demonstrate increased senescence. The skilled person is capable of identifying the one or more cells. For instance, the skilled person is capable of identifying the one or more lung fibroblasts associated with idiopathic pulmonary fibrosis (IPF). The oligonucleotide reduces senescence in the one or more cells associated with the disease or condition.

[0262] The disease or condition is preferably an interstitial lung disease (ILD). The ILD may be Acute Chest Syndrome, Acute Respiratory Distress Syndrome (ARDS), Alpha-1 Antitrypsin Deficiency, Asbestosis, Aspergillosis, Asthma, Atelectasis, Bronchiectasis, Bronchiolitis, Bronchiolitis Obliterans (Popcorn Lung), Bronchitis (Acute), Bronchopulmonary Dysplasia, Chronic Bronchitis, Chronic Cough, Chronic Lung Disease, Chronic Thromboembolic Pulmonary Hypertension (CTEPH), Coal Worker's Pneumoconiosis (Black Lung Disease), COPD, Coccidioidomycosis (Valley Fever), Coronavirus, COVID-19, Common Cold, Cryptogenic Organizing Pneumonia (COP), Cystic Fibrosis (CF), E-cigarette or Vaping Use- Associated Lung Injury (EVALI), Emphysema, Enteroviruses, Eosinophilic Granulomatosis with Polyangiitis (EGPA), Hantavirus Pulmonary Syndrome (HPS), Histoplasmosis, Human Metapneumovirus (hMPV), Hypersensitivity Pneumonitis, Idiopathic Pulmonary Fibrosis (IPF), Infectious Lung Diseases, Influenza (Flu), Interstitial Lung Disease (ILD), Idiopathic Pulmonary Fibrosis (IPF), Legionnaires' Disease, Long COVID, Lung Cancer, LAM, MAC Lung Disease, Mesothelioma, Middle Eastern Respiratory Syndrome (MERS), NTM Lung Disease, Occupational Lung Diseases, Parvovirus B19, Pertussis (Whooping Cough), Pneumonia, Pneumothorax (Collapsed Lungs), Primary Ciliary Dyskinesia (PCD), Pulmonary Alveolar Proteinosis (PAP), Pulmonary Arterial Hypertension (PAH), Pulmonary Embolism, Pulmonary Hypertension, Regressive Pulmonary Fibrosis (RPF), Respiratory Syncytial Virus (RSV), Sarcoidosis, Severe Acute Respiratory Syndrome (SARS), Silicosis, or Tuberculosis (TB).

[0263] The disease or condition may be an interstitial lung disease (ILD) associated with progressive pulmonary fibrosis (PPF). The ILD associated with PPF may be connective tissue disease (CTD), genetic and / or familial pulmonary fibrosis (G / F PF), hypersensitivity pneumonitis (HP), idiopathic non-specific interstitial pneumonia (iNSIP), interstitial pneumonia (IPAF) preferably with autoimmune features, idiopathic pulmonary fibrosis (IPF) or an unclassifiable ILD (uILD). The disease or condition is preferably idiopathic pulmonary fibrosis (IPF).

[0264] The disease or condition is preferably selected from idiopathic pulmonary fibrosis (IPF), chronic obstructive pulmonary disease (COPD), renal fibrosis, chronic kidney disease, age related macular degeneration (AMD), osteoarthritis, osteoporosis, rheumatoid arthritis, nonalcoholic fatty liver disease, non-alcoholic steatohepatitis, chronic wounds, radiation wounds, blistering diseases, actinic keratosis, systemic sclerosis, non-segmental vitiligo, papular pruritic eruption, alopecia, senile pruritis, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, cardiovascular disease, hypertension, type 2 diabetes, cancer, cognitive dysfunction, frailty, progeroid syndromes, and any disease in which senescence is implicated.

[0265] The disease or condition is preferably selected from idiopathic pulmonary fibrosis (IPF), radiation-induced dermatitis (RD), chronic obstructive pulmonary disease (COPD), age related macular degeneration (AMD), osteoarthritis, and osteoporosis.

[0266] The method typically comprises administering a therapeutically effective amount or a prophylactically effective amount of the oligonucleotide(s). A therapeutically effective amount is an amount which ameliorates one or more symptoms, such as all the symptoms, of the disease or condition and / or abolishes one or more symptoms, such as all the symptoms, of the disease or condition. The therapeutically effective amount preferably cures the disease. A prophylactically effective amount is an amount which prevents the onset of the disease or condition and / or prevents the onset of one or more symptoms, such as all the symptoms, of the disease or condition. The prophylactically effective amount preferably prevents the subject from developing the disease. Suitable amounts are discussed in more detail above.

[0267] The oligonucleotide(s) or the pharmaceutical composition may be administered to a subject that displays symptoms of the disease or condition. One or more cells associated with the disease or condition typically demonstrate increased senescence. The oligonucleotide(s) or the pharmaceutical composition may be administered to a subject that is asymptomatic, i.e. does not display symptoms of disease. Despite the lack of symptoms, one or more cells associated with the disease or condition may demonstrate increased senescence. The oligonucleotide(s) or the pharmaceutical composition may be administered when the subject's disease status is unknown or the patient is expected not to have a disease or condition. The oligonucleotide(s) or the pharmaceutical composition may be administered to a subject that is predisposed, such as genetically predisposed, to developing the disease or condition.

[0268] The oligonucleotide(s) or the pharmaceutical composition may be administered to a refractory subject or a subject otherwise contraindicated to first line treatment.

[0269] The invention may be used in combination with other means of, and substances or compositions for, treating or preventing the disease or condition or providing pain relief. In some cases, the oligonucleotide(s) may be used in combination with existing treatments for the disease or condition including intensive care treatment. These include one or more of standard of care treatments, anti-inflammatories, anti-fibrotics and vasodilators. For ILDs, ILDs associated with PPF and IPF, the invention may be combined with pirfenidone, nintedanib, or any of the drugs discussed in Bonella F, Spagnolo P, Ryerson C. Current and Future Treatment Landscape for Idiopathic Pulmonary Fibrosis. Drugs. 2023 Nov;83(17): 1581-1593. doi: 10.1007 / s40265-023-01950-0.

[0270] Treating or preventing one or more signs of ageing

[0271] The method of the invention is preferably for the treatment or prevention of one or more signs of ageing in the subject. The invention therefore provides a method of treating or preventing one or more signs of ageing in a subject, comprising administering to the subject an oligonucleotide or two or more oligonucleotides which specifically hybridise(s) to a target portion of the 3' untranslated region (UTR) of heterogeneous nuclear riboprotein particle D HNRNPD) mRNA and block(s) at least one inhibitory microRNA (miRNA) binding site and thereby reducing senescence in one or more cells associated with the one or more signs of ageing. In one embodiment, the method is a non-therapeutic method. The method may reverse, delay or slow one or more signs of ageing in the subject.

[0272] This method may involve any of the embodiments discussed above. The oligonucleotide(s) may be any of those discussed above, including the modified oligonucleotides. The oligonucleotide(s) may be administered in the form of a dermatological composition as described above or a dermatological composition of the invention. The one or more cells may be any of those discussed above. The one or more cells are preferably one or more skin cells. The one or more cells are preferably one or more skin fibroblasts. The one or more cells are preferably one or more skin cells. The one or more cells are preferably one or more hair follicle cells. The one or more cells are preferably one or more hair follicle stem cells. The one or more cells are preferably one or more nail cells. The one or more cells are preferably one or more nail matrix cells.

[0273] The invention also provides an oligonucleotide or two or more oligonucleotide(s) which specifically hybridise(s) to a target portion of the 3' UTR of HNRNPD mRNA and block(s) at least one inhibitory miRNA binding site for use in a method of treating or preventing one or more signs of ageing in a subject. The invention also provides use of an oligonucleotide or two or more oligonucleotide(s) which specifically hybridise(s) to a target portion of the 3' UTR of HNRNPD mRNA and block(s) at least one inhibitory miRNA binding site in the manufacture of a medicament for treating or preventing one or more signs of ageing in a subject. The oligonucleotide(s) may be any of those discussed above, including the modified oligonucleotides. The oligonucleotide(s) may be administered in the form of a dermatological composition as described above or a cosmetic or dermatological composition of the invention.

[0274] Two or more oligonucleotides, such as 3, 4, 5 or 6 oligonucleotides, as defined above or of the invention may be administered to the subject or may be used. Any of the embodiments discussed above are equally applicable to the ageing embodiments of the invention.

[0275] The subject is preferably mammalian. The subject is preferably a human, dog, cat, primate, horse, murine, rat, rodent, bovine, murine, porcine, or ovine. The subject is preferably a human.

[0276] Routes of administration, compositions and dosages are defined above. Any of these may be used in the ageing embodiments of the invention.

[0277] The one or more signs of ageing are preferably associated with increased senescence. The one or more signs of ageing are preferably associated with increased senescence in one or more cells. This can be measured as described above. The oligonucleotide(s) reduce senescence in the one or more cells associated with the one or more signs of ageing.

[0278] Any number of signs of ageing may be treated or prevented in accordance with the invention, such as about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 signs of ageing.

[0279] The one or more signs of ageing are preferably present in the skin, hair, or nails. The one or more signs of ageing in the skin may be one or more signs of cutaneous ageing. Such signs may be selected from reduced collagen deposition, reduced skin elasticity, the appearance of wrinkles, sagging, adipose deposition, altered pigmentation, skin thinning, skin fragility, inflammation, compromised wound healing, impaired regenerative capacity, fibrosis, and loss of substructure. The method or use preferably results in one or more of increased collagen deposition, increased skin elasticity, a reduced appearance of wrinkles, reduced sagging, and corrected pigmentation.

[0280] The one or more signs of ageing in the hair may be selected from hair loss, hair thinning, hair becoming brittle, a reduced rate and / or length of hair growth, and a loss of hair pigmentation.

[0281] The one or more signs of ageing in the nails may be selected from a reduced rate and / or length of nail growth, nails becoming dull and brittle, in growing nails, and toenails becoming hard and thick.

[0282] The method or use typically comprises administering a therapeutically effective amount or a prophylactically effective amount of the oligonucleotide(s). A therapeutically effective amount is an amount which ameliorates one or more signs of ageing, including those described above, and / or abolishes one or more signs of ageing, including those described above. A prophylactically effective amount is an amount which prevents the onset of the one or more signs of ageing, including those described above. The prophylactically effective amount preferably prevents the subject from developing the one or more signs of ageing. Suitable amounts are discussed in more detail above.

[0283] The oligonucleotide(s) or the dermatological composition may be administered to a subject that displays one or more signs of ageing. One or more cells associated with the one or more signs of ageing typically demonstrate increased senescence. The oligonucleotide(s) or the dermatological composition may be administered to a subject that does not display the one or more signs of ageing. Despite the lack of signs, one or more cells associated with the one or more signs of ageing may demonstrate increased senescence. The oligonucleotide(s) or the dermatological composition may be administered when the subject's status is unknown or the patient is expected not to have the one or more signs of ageing. The oligonucleotide(s) or the dermatological composition may be administered to a subject that is predisposed, such as genetically predisposed, to developing the one or more signs of ageing.

[0284] The invention may be used in combination with other means of, and substances or compositions for, treating or preventing the one or more signs of ageing. In some cases, the oligonucleotide(s) may be used in combination with existing anti-ageing treatments.

[0285] Oligonucleotides of the invention

[0286] The invention also provides an oligonucleotide of about 50 or fewer nucleotides and comprising or consisting of any one of the sequences shown in SEQ ID NOs: 1-28, 33-50, and 55-74. The oligonucleotide may have any length of about 50 or fewer nucleotides, including about 49 or fewer, about 48 or fewer, about 47 or fewer, about 46 or fewer, about 45 or fewer, about 44 or fewer, about 43 or fewer, about 42 or fewer, about 41 or fewer, about 40 or fewer, about 39 or fewer, about 38 or fewer, about 37 or fewer, about 36 or fewer, about 35 or fewer, about 34 or fewer, about 33 or fewer, about 32 or fewer, about 31 or fewer, about 30 or fewer, about 29 or fewer, about 28 or fewer, about 27 or fewer, or about 26 or fewer nucleotides. The nucleotides may be any of those discussed above with reference to the methods of the invention.

[0287] The oligonucleotide preferably comprises or consists of any one of the sequences shown in SEQ ID NOs: 1-26, 33-50, and 55-74. The oligonucleotide preferably comprises or consists of any one of the sequences shown in SEQ ID NOs: 1-2, 5-9. 12, 13, 15-18, 20-26, 33-36, 38-50 and 55-74. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 11, 34 or 71. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 34 or 71. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 7, 8, 12, 18, 21, 39, 40, 41, 42 or 48. The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 7, 39 or 42.

[0288] The oligonucleotide is preferably from about 22 to about 27 nucleotides in length, such as about 22, about 23, about 24, about 25, about 26 or about 27 nucleotides in length. The oligonucleotide is preferably about 25 nucleotides in length.

[0289] The oligonucleotide is preferably modified to increase its binding affinity for the 3' UTR and / or to increase its resistance to one or more nucleases. The oligonucleotide preferably comprises one or more of (1) one or more modified sugars, (2) one or more modified nucleobases and (3) one or more modified internucleoside linkages, such as (1), (2), (3), (1) and (2), (1) and (3), (2) and (3) or (1), (2) and (3). The oligonucleotide may comprise any of the modifications discussed above with reference to the oligonucleotides of the invention.

[0290] The oligonucleotide preferably comprises one or more 2’-O-methoxyethyl (2' MOE) nucleotides and / or one or more 2'-O-methyl (OMe) nucleotides. The oligonucleotide preferably comprises one or more one or more phosphorothioate (PS) internucleoside linkages and / or one or more phosphorodiamidate morpholino (PMO) internucleoside linkages.

[0291] The oligonucleotide preferably comprises any of the preferred modifications discussed above with reference to the method of the invention, including those numbered #l-#4. The oligonucleotide preferably comprises one of the following:

[0292] 1. only phosphorodiamidate morpholino (PMO) linked nucleotides;

[0293] 2. only 2’-O-methoxyethyl (2'-MOE) and phosphorodiamidate morpholino (PMO) linked nucleotides; 3. half 2'-O-methoxyethyl (2'-M0E) nucleotides and half phosphorothioate (PS) linked nucleotides; and

[0294] 4. only 2'-O-methyl (OMe) and phosphorothioate (PS) linked nucleotides.

[0295] The oligonucleotide preferably comprises or consists of the sequence shown in SEQ ID NOs: 29-32, 51-54, and 75-78.

[0296] The oligonucleotide of the invention may also be modified with a tag, label or conjugate group. Such groups are described above with reference to the method of the invention and any of those embodiments equally apply to the oligonucleotides of the invention.

[0297] The oligonucleotide of the invention may be used in any of the methods described above. The oligonucleotide of the invention may be used in therapy. The oligonucleotide of the invention may be used as a prophylactic.

[0298] The oligonucleotide may be isolated, substantially isolated, purified or substantially purified. The oligonucleotide is isolated or purified if it is completely free of any other components, such as buffer, other oligonucleotides, production material or cells. The oligonucleotide is substantially isolated or substantially purified if it is only mixed with carriers or diluents, such as buffers or excipients, which will not interfere with its intended use. The oligonucleotide is not naturally occurring.

[0299] Compositions of the invention

[0300] The invention also provides compositions for use in the invention. The invention provides a pharmaceutical composition comprising an oligonucleotide of the invention and a pharmaceutically acceptable carrier and / or diluent. Suitable carriers and diluents are discussed above with reference to the method of the invention.

[0301] The pharmaceutical composition preferably comprises a pharmaceutically acceptable transfection agent. Any of the transfection agents discussed above may be used. The transfection agent preferably comprises liposomes.

[0302] The pharmaceutical composition preferably comprises one or more penetration enhancers. Such enhancers are discussed above.

[0303] The pharmaceutical composition is preferably a dermatological composition. The dermatological composition may comprise any of the dermatological acceptable carriers and / or diluents described above. The dermatological composition may comprise an emulsion. The pharmaceutical or dermatological composition may comprise two or more oligonucleotides of the invention, such as 3, 4, 5 or 6 oligonucleotides of the invention. The pharmaceutical or dermatological composition may comprise two or more of (a) an oligonucleotide of the invention comprising or consisting of the sequence shown in any one of SEQ ID NOs: 1-28, in any one of SEQ ID NOs: 1-26, in any one of SEQ ID NOs: 1-2, 5-9. 12, 13, 15-18, 20-26, or in SEQ ID NO: 29-32, (b) an oligonucleotide of the invention comprising or consisting of the sequence shown in any one of SEQ ID NOs: 33-50 or in any of one of SEQ ID NOs: 33-36 and 38-50, or (c) an oligonucleotide of the invention comprising or consisting of the sequence shown in any one of SEQ ID NOs: 55-74, such as (a) and (b), (a) and (c), (b) and (c) and (a), (b) and (c). The two or more oligonucleotides of the invention may be modified in any of the ways discussed above. The pharmaceutical or dermatological composition may comprise two or more of (a) an oligonucleotide of the invention comprising or consisting of the sequence shown in SEQ ID NO: 11, (b) an oligonucleotide of the invention comprising or consisting of the sequence shown in SEQ ID NO: 34, or (c) an oligonucleotide of the invention comprising or consisting of the sequence shown in SEQ ID NO: 72, such as (a) and (b), (a) and (c), (b) and (c) and (a), (b) and (c). The pharmaceutical or dermatological composition may comprise an oligonucleotide of the invention comprising or consisting of the sequence shown in SEQ ID NO: 34 and / or an oligonucleotide of the invention comprising or consisting of the sequence shown in SEQ ID NO: 72.

[0304] The pharmaceutical or dermatological composition may comprise two or more of (a) an oligonucleotide of the invention comprising or consisting of the sequence shown in SEQ ID NO: 7, (b) an oligonucleotide of the invention comprising or consisting of the sequence shown in SEQ ID NO: 39, or (c) an oligonucleotide of the invention comprising or consisting of the sequence shown in SEQ ID NO: 42, such as (a) and (b), (a) and (c), (b) and (c) and (a), (b) and (c).

[0305] The invention also provides an inhalation device, such as a metered dose inhaler (MDI), comprising a therapeutically effective amount or a prophylactically effective amount of an oligonucleotide of the invention or two or more oligonucleotides of the invention. The invention also provides a cartridge adapted for use with an inhalation device or a MDI, comprising a therapeutically effective amount or a prophylactically effective amount of an oligonucleotide of the invention or two or more oligonucleotides of the invention. The inhalation device, MDI or cartridge of the invention may be for treating any of the diseases or conditions discussed above, including a lung disease or condition, an ILD, an ILD associated with PPF or IPF. The oligonucleotide or the two or more oligonucleotides may be any of those discussed above. The oligonucleotide or the two or more oligonucleotides may be formulated in any of the ways discussed above.

[0306] SEQUENCE LISTING SEQ ID NOs: 1-78 are shown in the Table below.

[0307] SEQ ID NO: 79 (the sequence of 3' UTR of human HNRNPD mRNA) - The underlined sequences in the boxes are the parts of the inhibitory miRNA binding sites (for miR-146-5p, miR-146-5p, miR-146-5p and miR-146-5p respectively). The shaded sequences are the target portions for (i.e. the reverse complement of) SOL044(0), SOL045(0) and SOL046(0) sequentially.

[0308] GTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCA GTTCAAACTAAATTTTTTGTATCAAGTCCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAA TTCTGAGTTCTCA —TTAAAAGAAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAAT

[0309] TTGTGTTTTATGCCCTTTCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTG TCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTAT CATCAGAATAGGAAAAATTGTCATGGATTCAAGTTATTAAAAGCATAAGTTTGGAAGACAGGCTTGC CGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCC ATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAAT ACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTAT TGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTAT GCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGAT TTTTAGAGCTGTGGTGGACTTCATAGATGAATTCAAGTGTTGAGGGAGGATTAAAGAAATATATACC GTGTTTATGTGTGTGTGCTTATTTGTTTGAATGATTTTATTTTCCATTTCTCAAAGGTTTTATTTTTTTG GTTAGGGCCTTAAAATTTCAGGACTGTGATTATTAGTATGTGTGCCTAAGGAACTTTTTGAGTCACTC TTAAGAAAGTGAAACTGAAGAGTCTAAGTGATAACTATAGGATTAAGTCAGAATTGTTTTTCCTGTCA TTTGTTGGAAGCTTCTTGAGTTCTGTTATTAGCATTCAGGGAATTGATACCCATCAACTTGAATGGAA AATCGTTTGTAGGTATTACTTAAGTGAATGTTAAGAGTTCCACCCTGAGTGGTAATCTAAGGCTGTGC AGTCAGTTACTTCAGACTGCTCAGAATAGTTCATTAGAAAGGTAACAAATGAGAAATGTATTATTATA CAGTTCTATAGTAGTGAAGTGATGGAATACCTTTCTTACTTTTGTGGAGTTACATCTGATGCTAAGAA TTTGACCTCCAACTAAGCAAACATTTTAATGAGCAAAAGTTAGTGTTATTAAAGTTTTTTTATGATAGA TCCAAATTGAGGACCTGTGTCCTGTTTTTATAAGATTGCAACCCAGCTATGCTCATTTGTTTATGTTTT GTATATGGCTGCTTTTGTGTTACAGTGGTAGAGTTTAGTAGTTAGGACAGAGACCTGCAAAGCAAAA TAATTTACAGTCTGGCCCTTTACAGAAAAGTTTGCTGACTCATGGTCAAAATAAATGAAAATTTTTTGT GTTAGGGTTGTTAAGCTAGGGTTCTTTTTGGTATCATATGCTTATTTTATGTAAATCTCTCAATAAAAA ATTA I I I I I AAGAGA

[0310] SEQ ID NO: 80 (Human miR-141-3p)

[0311] UAACACUGUCUGGUAAAGAUGG

[0312] SEQ ID NO: 81 (Preferred human miR-141-3p binding site)

[0313] GACAGTGT SEQ ID NO: 82 (Preferred human miR-141-3p binding site)

[0314] AGTGTT

[0315] SEQ ID NO: 83 (Human miR-146-5p)

[0316] UGAGAACUGAAUUCCAUGGGUU

[0317] SEQ ID NO: 84 (Preferred human miR-146-5p binding site)

[0318] AATTC

[0319] SEQ ID NO: 85 (Preferred human miR-146-5p binding site)

[0320] AGTTCTCA

[0321] EXAMPLES

[0322] The following Examples illustrates the invention.

[0323] Example 1

[0324] Methods

[0325] Human cell lines

[0326] All cell lines involved in these studies were human primary cell lines, aged to replicative senescence by continuous culture. Cell lines included were a) primary human dermal fibroblasts, b) primary human lung fibroblasts, c) Primary human bronchial epithelial cells d) primary human lung fibroblasts from 2 different donors with Idiopathic Pulmonary Fibrosis (IPF), e) Primary human articular chondrocytes, f) primary human retinal endothelial cells and g) primary human pigmented retinal epithelial cells. All cell types were cultured in the recommended media suggested by the supplier.

[0327] Introduction of oligonucleotides

[0328] Oligonucleotides were introduced to cells by one of three means. Early experiments used lipofectamine or oligofectamine, whereas later experiments introduced oligonucleotides by naked delivery (gymnosis). Doses were initially at 25nM, 50nM and lOOnM concentrations, subsequent experiments were carried out at the dosage that led to the greatest effect on senescence. Incubation times were 48hrs. Gymnotic delivery was confirmed by the use of a fluorescently tagged oligonucleotide. We also carried out an assessment of effects on senescence over 48 hours, 5 days and 10 days in IPF patient cells.

[0329] Assessment of effects on senescence kinetics Senescence was assessed by battery of cell kinetic assays since there is no single marker for senescence. Cells were firstly assessed for Senescence-associated beta galactosidase (SA-p-Gal) activity, as this selectively labels senescent cells on the basis of their enhanced lysosome component. Cell proliferation was measured using Ki67 staining. Ki67 labels cells in S phase; senescent cells do not proliferate. DNA damage was assessed by the use of yH2AX staining. yH2AX marks the initial stages of DNA damage repair, so a reduction in this parameter indicates a reduction in DNA damage.

[0330] Assessment of gene expression

[0331] In some cases, effects on senescence and fibrotic markers were assessed using quantitative PCR. Senescence was assessed in early experiments by assaying for reductions in CDKN2A (pl6) expression. Fibrotic markers ACTA2, COL1A1, and GREM1 were assessed in some cases, as were anti-fibrotic markers LIF, CTSL, HMOX1 and MMP14. In some cases we measured the expression of the IL6 gene; IL-6 is a key component of the senescence- associated secretory phenotype. For assessment of effects on chondrocyte function, we assessed expression of ACAN and MMP13, markers of cartilage protection.

[0332] Assessment of effects on the protein expression of fibrotic markers

[0333] We carried out an assessment of the performance of SOL044, SOL045 and SOL046 on protein expression of Collagen 1 (COL1), aSMA, MMP7 and GREM1. These experiments were caried out by immunofluorescence. These experiments also included assessment of the effects on COL1 and aSMA expression in response to the state-of-the art treatments, the anti-fibrotic markers pirfenidone and nintedanib. Subsequent experiments on the protein expression of GREMLIN1 and MMP7, key markers of fibrosis, were measured by ELISA in IPF patient cells in the presence and absence of SOL045.

[0334] The oligonucleotides designed in this Example are shown in Tables 1, 3 and 5 below. The oligonucleotides tested in this example are shown in Table 2, 4 and 6 below.

[0335] Table 1 - SOL044(0) and associated sequences

[0336] Table 2 - SOL044(0) related sequences tested Table 3 - SOL045(0) and associated sequences

[0337] Table 4 - SOL045(0) related sequences tested Table 5 - SOL046(0) and associated sequences

[0338] Table 6 - SOL046(0) related sequences tested

[0339] Results

[0340] The results are shown in Figures 1-13.

[0341] Discussion

[0342] The data presented here demonstrate that our invention of a series of oligonucleotides designed to interrupt the interaction between the pl6-regulated miRNAs miR-141-3p and / or miR-146b-5p and their target sequences in the 3' untranslated region of the HNRNPD gene are able to reduce beta galactosidase activity and DNA damage burden in wild type senescent human primary cells of multiple lineages, and also to attenuate senescence and disease markers in lung fibroblasts from patients with IPF and articular chondrocytes from donors with osteoarthritis respectively. We have demonstrated that we are able to deliver the oligonucleotides to the cells by gymnosis in vitro and that our oligonucleotides have similar performance in IPF donor fibroblasts to those seen with the state-of-the art drugs nintedanib and pirfenidone. Our data show that these oligos have potential for therapeutic modulation of levels of senescence and markers of inflammatory and fibrotic disease in human patients.

[0343] Example 2

[0344] Methods

[0345] In vivo pharmacokinetics (PK) method

[0346] Labcorp was chosen as partner for the described in vivo pharmacological studies. C57BL6 / J mice were used in these studies, and were group-housed (up to three animals / cage) in polycarbonate cages. Animals were acclimated ahead of procedures for at least 5 days including the day of arrival. 3.5 mg of oligonucleotide were dissolved in 875 pL of sterile saline solution to yield 4 mg / ml final concentration and vortexed for 30 seconds prior to dosing to homogenize solution. The dose was chosen based on available clinical PK data of lung-dosed oligonucleotides with similar chemical design. Mice were intratracheally administered with the therapeutic oligonucleotide once at Day 0, at a total volume of ~50 pl, corresponding to a final dose of lOmg / kg, under recoverable anaesthesia (isoflurane / oxygen mix).

[0347] Chosen tissues sampling times were 8-, 48-, and 168-hours post dose based on the dose time for each animal. For biochemical analysis, tissues were collected, weighed, snap-frozen on dry ice, and then stored at -80°C. Bronchoalveolar Lavage Fluid (BALF) was collected at 48h and 168h post dose timepoints; the BAL from each mouse was centrifuged at 800xg for 10 min at ca 4°C. All aliquots were frozen and retained at -70°C.

[0348] Tissue handling and Oligonucleotide quantification through SplintR

[0349] Each organ was weighed to determine the total organ weight in mg. The tissue was placed in a ZR Bashing Bead Lysis Tube with lysis buffer and shaken for 15 min at highest speed in a bead homogeniser at room temperature (RT).

[0350] The sample lysate was then centrifuged at 18000 x g, 10 min, 4°C to pellet and remove debris.

[0351] The SplintR assay is based on the methods described by Shin et al. ("Quantification of Antisense Oligonucleotides by Splint Ligation and Quantitative Polymerase Chain Reaction." Nucleic Acid Ther. 2022 Feb;32(l):66-73. doi: 10.1089 / nat.2021.0040). In brief, this consists of two steps, one sequence-specific probe / oligonucleotide ligation reaction and one qPCR reaction for quantification of ligated probes. The ligation reaction uses 25 U of SplintR ligase, with a final concentration of SplintR ligase of 25,000 units / mL or 25 units / pL. Ligations are prepared for each experiment including both 'no oligo' and 'no enzyme' controls. The second reaction uses a set of qPCR probes designed to fit the oligonucleotide sequence to avoid secondary interactions.

[0352] Data analysis

[0353] The initial in vivo study was designed to assess the pharmacokinetics and biodistribution of the 3 oligonucleotides with the same nucleotide sequence (SOL045) but 3 different chemistries after intratracheal administration of a single lOmg / kg dose. Assessed thereby were the following oligonucleotide modifications: Full MOE-PS (SOL045), alternating MOE / DNA-PS (SOL068), and Morpholino (SOL002). All oligonucleotides were found to distribute preferentially to the lungs, when compared to liver and kidney. This was confirmed by a low systemic oligonucleotide distribution in plasma.

[0354] While alternating MOE / DNA-PS oligonucleotide was rapidly released from lungs after 24h, the morpholino modified oligonucleotide was still detectable after 168h post administration. The MOE-PS oligonucleotide showed the most favourable PK profile, with a characteristic slow accumulation in the lungs up to 48h, followed by a drop at 72h and a second slow accumulation to 168h.

[0355] Results

[0356] The preliminary results are shown in Figure 14.

[0357] Based on these preliminary results, we performed a second in vivo PK study of the same overall design, but with 3 MOE-PS oligonucleotides chosen from the oligonucleotide panels shown in Tables 1 and 3, namely SOL044-4, SOL045+5 and SOL045+8, along with a scrambled control oligonucleotide. All 4 intratracheally dosed MOE-PS oligonucleotides showed favourable lung distribution, within the range of literature-reported oligonucleotides carrying similar chemical designs. No effect on body or tissue weight resulted from the single dose administration of the oligonucleotides. The results are shown in Figure 15.

[0358] Example 3

[0359] Methods

[0360] Assessment of oligonucleotide panels

[0361] For each of the index oligonucleotides: SOL044, SOL045 and SOL046, panels of oligonucleotides were designed to 'walk' in a base-by-base fashion across the relevant microRNA binding sites targeted by each index oligonucleotide. The sequences of these panels are those shown in Tables 1, 3 and 5 respectively. The oligonucleotide panels were tested in primary human lung fibroblasts from a patient with IPF, and were delivered via gymnosis at doses of lOnM, 30nM, lOOnM and 300nM. Incubation times were 48hrs. Following incubation, senescence kinetics were then assessed as described in Example 1 above. The assessment of all kinetics measured enabled the selection of lead oligonucleotides that were used for subsequent experiments, namely SOL044-4, SOL045+5 and SOL045+8.

[0362] Assessment of oligonucleotide efficacy in human Precision-Cut Lung Slices

[0363] Precision-Cut Lung Slices (PCLS) are recognised as a suitable model to investigate cytokine secretion, protein production, enzyme activity and airway function. Commercially available PCLS were procured from healthy volunteers (HV), patients with Chronic Obstructive Pulmonary Disease (COPD), patients with Idiopathic Pulmonary Fibrosis (IPF), and patients with non-IPF Interstitial Lung Fibrosis (ILF). PCLS were cultured for 14 days, and treated via gymnosis with a dose of 400nM of oligonucleotide every 48 hours, at days 1, 3, 5, 7, 9, and 11. PCLS were collected at day 14 for immunohistochemical staining with o-SMA to measure fibroblast transdifferentiation status, and stained for SA-p-Gal to assess levels of senescence. Supernatants were collected at each treatment timepoint for quantification of markers of fibrosis and inflammation using ELISAs, to include MMP-7, MMP-9, IL-6, IL-8, GM-CSF, and Fibronectin.

[0364] Results

[0365] The results are shown in Figures 16-26.

Claims

CLAIMS1. A method of reducing senescence in a cell, comprising contacting the cell with an oligonucleotide which specifically hybridises to a target portion of the 3' untranslated region (UTR) of heterogeneous nuclear riboprotein particle D HNRNPD) mRNA and blocks at least one inhibitory microRNA (miRNA) binding site and thereby reducing senescence.

2. A method according to claim 1, wherein the portion of the 3' UTR is at least 16 nucleotides in length.

3. A method according to claim 1 or 2, wherein the 3' UTR comprises or consists of the sequence shown in SEQ ID NO: 79.

4. A method according to any one of the preceding claims, wherein the at least one inhibitory miRNA binding site is at least 5 nucleotides in length.

5. A method according to any one of the preceding claims, wherein the inhibitory miRNA is miR-141-3p or miR-146b-5p.

6. A method according to any one of the preceding claims, wherein the at least one inhibitory miRNA binding site comprises the sequence shown in SEQ ID NO: 81, 82, 84 or 85.

7. A method according to any one of the preceding claims, wherein the oligonucleotide is (a) at least 20 nucleotides in length, (b) from about 22 to about 27 nucleotides in length or (c) about 25 nucleotides in length.

8. A method according to any one of the preceding claims, wherein the oligonucleotide comprises or consists of the sequence shown in any one of SEQ ID NOs: 1-28, 33-50, and 55-74 or the sequence shown in SEQ ID NO: 11, 34 or 71.

9. A method according to any one of the preceding claims, wherein the oligonucleotide comprises or consists of the sequence shown in (i) SEQ ID NO: 7, 8, 12, 18, 21, 39, 40, 41, 42 or 48 or (ii) SEQ ID NO: 7, 39 or 42.

10. A method according to any one of the preceding claims, wherein the oligonucleotide is modified to increase its binding affinity for the 3' UTR and / or to increase its resistance to one or more nucleases.

11. A method according to any one of the preceding claims, wherein the oligonucleotide comprises one or more 2’-O-methoxyethyl (2' MOE) nucleotides and / or one or more 2'- O-methyl (OMe) nucleotides.

12. A method according to any one of the preceding claims, wherein the oligonucleotide comprises one or more phosphorothioate (PS) internucleoside linkages and / or one or more phosphorodiamidates.

13. A method according to any one of the preceding claims, wherein the oligonucleotide comprises or consists of the sequence shown in any one of SEQ ID NOs: 29-32, 51-54, and 75-78.

14. A method according to any one of the preceding claims, wherein the cell is in vitro or ex vivo.

15. A method according to any one of the preceding claims, wherein the cell is in a subject and the method comprises administering the oligonucleotide to the subject.

16. A method according to claim 15, wherein the method is for treating or preventing a disease or condition in the subject.

17. A method according to claim 16, wherein the disease or condition is selected from idiopathic pulmonary fibrosis (IPF), chronic obstructive pulmonary disease (COPD), renal fibrosis, chronic kidney disease, age related macular degeneration (AMD), osteoarthritis, osteoporosis, rheumatoid arthritis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, chronic wounds, radiation wounds, blistering diseases, actinic keratosis, systemic sclerosis, non-segmental vitiligo, papular pruritic eruption, alopecia, senile pruritis, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, cardiovascular disease, hypertension, type 2 diabetes, cancer, cognitive dysfunction, frailty, and progeroid syndromes.

18. A method according to claim 15, wherein the method is for the treatment or prevention of one or more signs of ageing in the subject.

19. An oligonucleotide which specifically hybridises to a portion of the 3' UTR of HNRNPD mRNA and blocks at least one inhibitory miRNA binding site for use in a method of reducing senescence in a cell in a subject.

20. An oligonucleotide for use according to claim 19, wherein the method is for treating or preventing an age-related disease or condition in the subject.

21. An oligonucleotide of about 50 or fewer nucleotides and comprising or consisting of any one of the sequences shown in SEQ ID NOs: 1-28, 33-50, and 55-74.

22. An oligonucleotide according to claim 21, wherein the oligonucleotide comprises or consists of any one of the sequences shown in (a) SEQ ID NOs: 1-26, 33-50, and 55-74(b) SEQ ID NOs: 1-2, 5-9. 12, 13, 15-18, 20-26, 33-36, 38-50 and 55-74 or (c) SEQ ID NOs: 11, 34 and 71.

23. An oligonucleotide according to claim 21, wherein the oligonucleotide comprises or consists of the sequence shown in (i) SEQ ID NO: 7, 8, 12, 18, 21, 39, 40, 41, 42 or 48 or (ii) SEQ ID NO: 7, 39 or 42.

24. An oligonucleotide according to any one of claims 21-23, wherein the oligonucleotide is as defined in any one of claims 10-12.

25. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 21-24 and a pharmaceutically acceptable carrier and / or diluent.

Citation Information

Patent Citations

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20040171570A1

  • 4'-thionucleosides and oligomeric compounds

    US20050130923A1

  • 5'-modified bicyclic nucleic acid analogs

    US20070287831A1

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20080039618A1

  • Reclamation of a Titanosilicate, and Reconstitution of an Active Oxidation Catalyst

    US20080064591A1