SNP molecular markers of porcine lncRNA NEAT1 promoter region and their application in meat production traits

Abstract

This invention belongs to the fields of molecular biology and molecular marker technology, specifically relating to a SNP molecular marker in the promoter region of porcine lncRNA NEAT1 and its application in porcine meat production traits. This invention obtained the gene sequence of a segment of porcine chromosome 2, 6811209-6812099, with a fragment length of 891 bp. BLAST alignment on the NCBI website revealed a nucleotide polymorphism (SNP) site within this amplified fragment. The mutation at this SNP site is specifically located at base 6811742 on chromosome 2, changing from C to T. Following the naming rules of the Ensembl database, this mutation site is named rs324459978. This invention provides a novel marker for marker-assisted selection in porcine breeding, and its application can accelerate the process of improving high-quality pig breeding.

Description

Technical Field

[0001] This invention belongs to the field of pig genetic marker screening and application technology, specifically relating to a SNP molecular marker in the promoter region of pig lncRNA NEAT1 and its application as a meat production trait in pigs. The genetic marker clone is derived from base 6811742 of pig chromosome 2. Background Technology

[0002] With the rapid development of biotechnology in my country and the increasing emphasis on healthy lifestyles, long non-coding RNAs (lncRNAs) are gradually emerging in gene regulation and biological research. In recent years, a growing body of research has shown that lncRNAs not only play a crucial role in gene expression regulation but are also closely related to the occurrence and development of various human diseases. As an emerging regulatory factor, lncRNA research provides a new perspective for revealing complex biological processes and promotes personalized disease prevention and treatment.

[0003] In the context of animal breeding and genetic improvement, understanding single nucleotide polymorphisms (SNPs) associated with lncRNAs is crucial. The presence of these SNPs can affect lncRNA function, thereby interfering with gene expression regulation. Traits affecting biological traits, including growth rate, disease resistance, and production performance, often involve the synergistic effects of multiple genes. As important regulatory factors, the variations in lncRNAs (such as nucleotide substitutions, insertions, or deletions) can influence the expression of downstream genes by altering their structure or interactions. Particularly in pig farming, the improvement of genetic traits is of great significance for enhancing production performance.

[0004] Traditional breeding methods have limitations in selecting animal traits, especially for traits with low heritability, where the results are often unsatisfactory. This is mainly because traditional breeding relies on phenotypic selection, while the genetic basis of many traits is complex, influenced by multiple genetic and environmental factors. Furthermore, phenotypic selection requires a long period of observation and accumulation. This reduces breeding efficiency; therefore, there is an urgent need to find more efficient selection tools to improve breeding efficiency and accuracy.

[0005] Against this backdrop, marker-assisted selection (MAS) technology has emerged and become an important tool in modern animal breeding. MAS technology can accurately identify genetic markers associated with economically important traits and select superior genotypes by analyzing an individual's genotype information, providing a reliable basis for breeding and thus achieving more efficient selection. This method not only overcomes the shortcomings of traditional phenotypic selection but also provides a new perspective for studying the genetic mechanisms of complex traits. Numerous studies have shown that SNPs of lncRNAs can affect the binding sites of gene promoter regions, thereby regulating the binding efficiency of transcription factors to DNA and thus affecting gene transcription activity. Simultaneously, lncRNAs can further regulate gene expression by altering the three-dimensional structure of chromatin and epigenetic modifications. For example, certain lncRNA SNPs can have a profound impact on the expression of target genes by changing the nucleoprotein complexes they bind to or altering their interactions with small RNA molecules.

[0006] NEAT1, an important lncRNA, has been shown to be closely related to muscle growth and development in pigs and mice. Studies have shown that NEAT1 is significantly upregulated during C2C12 cell differentiation and muscle regeneration, and then declines in later stages. Furthermore, NEAT1 can promote the proliferation of C2C12 cells and porcine skeletal muscle satellite cells while inhibiting their differentiation. Further in vivo experiments revealed that interfering with NEAT1 expression leads to increased muscle volume and weight in mice, along with an increase in the cross-sectional area of ​​muscle fibers. This result indicates that interfering with NEAT1 can effectively promote postnatal muscle growth.

[0007] Main References

[0008] [1]Yin,H.et al.(2019).Long Non-coding RNAs in Regulating GeneExpression:A Large Player of the Genetic World.Cellular&Molecular BiologyLetters,24(1),37.

[0009] [2]Wang,K.et al.(2018).Long Non-coding RNAs:Key Regulators of GeneExpression and Potential Therapeutic Targets for Diseases.BiochemicalPharmacology,154,62-70.

[0010] [3]Zhang,L.et al.(2020).Identification of SNPs in Long Non-codingRNAs and Their Associations with Phenotypic Traits in Beef Cattle.BMCGenomics,21(1),325.

[0011] [4]Li,Y.et al.(2021).The Role of Long Non-coding RNA in MuscleDevelopment and Regeneration.Frontiers in Genetics,12,Article 659756.

[0012] [5]Yuan,Y.et al.(2021).Long Non-Coding RNA NEAT1 Modulates theProliferation and Differentiation of Myoblasts.Scientific Reports,11(1),6679..

[0013] [6]Zhou,Y.,&Li,J.(2019).Molecular Marker-Assisted Selection in AnimalBreeding:Tools,Trends and Challenges.Frontiers in Genetics,10,Article 1143.

[0014] [7]Su,H.et al.(2020).Long Non-coding RNAs as Key Regulators of GeneExpression in Animals:Implications for Animal Breeding.Animals,10(1),130.

[0015] [8] Ge, T. et al. (2022). Understanding the Function of Long Non-codingRNAs in Livestock Trait Phenotypes: A Review. Journal of Animal Science and Biotechnology, 13(1), 1-12. Summary of the Invention

[0016] The purpose of this invention is to provide a SNP molecular marker for the promoter region of porcine lncRNA NEAT1. Through previous laboratory exploration, this study discovered an SNP site in the promoter region of porcine lncRNA NEAT1, located at base 6811742 on porcine chromosome 2.

[0017] Another objective of this invention is to provide the application of SNP molecular markers in the NEAT1 promoter region of porcine lncRNA in meat production traits. By cloning the gene sequence of the 6811209-6812099 segment of porcine chromosome 2, and using direct sequencing to identify SNP sites and genotyping methods, the association between these sites and porcine growth traits is analyzed. This establishes new marker-assisted selection sites for porcine growth traits, thereby improving porcine muscle yield.

[0018] This invention is achieved through the following technical solution:

[0019] This invention obtained the gene sequence of the segment 6811209-6812099 on pig chromosome 2, with a fragment length of 891 bp. Its nucleotide sequence is shown in the attached sequence listing SEQ ID NO.1. BLAST alignment on the NCBI website revealed a single nucleotide polymorphism (SNP) site within this amplified fragment, specifically as follows: Figure 2 As shown. The mutation at this SNP site is specifically located at base 6811742 on chromosome 2, where the base changes from C to T. Following the naming conventions of the Ensembl database, this mutation site is named rs324459978.

[0020] The experimental materials included American Large White pigs. Whole-genome DNA was extracted from the blood of American Large White pigs, and primer pairs were designed based on the porcine genome sequence (NC_010444.4) published in the NCBI database. The primer pair sequences are as follows:

[0021] Forward primer (SEQ ID NO.2): 5'-AGTTCAAGTGCTGCCTTC-3',

[0022] Reverse primer (SEQ ID NO.3): 5'-GCCCTTCTTTCGGATTTCT-3'.

[0023] The primer pairs described above can be used to detect and genotype SNP sites in the gene region of chromosome 2 of pig from 6811209 to 6812099.

[0024] After PCR amplification using the aforementioned primer pairs, purification of the PCR product, cloning and sequencing, and sequence alignment analysis, a genetic marker associated with porcine growth traits was identified. The nucleotide sequence of this genetic marker is shown below, with the mutation site located at position 534. The specific sequence (SEQ ID NO.1) is as follows:

[0025] AGTTCAAGTGCTGCCTTCCCAGCCTAACTGCGACCCCGCACCCCACGGCCTGCCTTCTTGCTCATGTTCAGGGCATCGACGGCCAGATATCGCCTCCAGCAAGGGTGGCGAGACCCTCAGCCTCCTCCAGTCTCTGCCTCCCTCCTTCAGACAAAGCAGGGCACAGGGGGCCGCCCAGCCTACGCAGAAGCGGCCCCCTCCCAGGGGTCAAGTTCCCCTTCTCCAGCGGGCAGCAGCGACAGCCAGGCCTGGAGTCTGCTCCTCTCCCTGGGTTCCTGCGGGCCCTTTCGAGGCAGCTCTGCCCTGCAAGACTTCCCTAAGGTCTAGTCTCCCCTCTAACCTGCCTCCAGCAGGCACACTCCCACCCCCAGCCCGCCAGTATCTTCTGACTCTGTCACCGCCCCCATCTGTCCCCTGAGGCCCTAAACTGCCACCTCCTCCCCCACAACTCAGCCCGGGCCCGCGGCCCTCCCTGTGGCTAACTCCTGCTGGACGGGCCACAACTTTTGCTTTTATAGCCCCGGCCGCGTCACR(C / T)CGGGGCATTGCTCAACGGGACGATTCCTCCACCGCCACCGGAAAAAAAGTCCCTCCCTGACCCTGTCTGAGGAGACGCCTCGGGGTGGCACCGGGTGTCCCGGGCTGTCCGCCCTCTCAGACGCCCCAGTTATCCCCGCCCCCCTTAGCAGTGCTTCCTGAGATCCACGACCCATCTCAAGGTCCCCTTTGGGAGGTGGATTCCAGGGGGAAAAGGGGAGACGTCCCCTTTTCTTTCACGGGCCCGGGGAATTAGGGGATGGGTAGGGGAGGTGGCTTGGGAGCTGCCCTCTCAAGAAGAAGGGACCGCCCGGGGTTGCCTCAGGTCACCCTTTCCCGAGAAATCCGAAAGAAGGGC

[0026] The present invention provides a method for screening genetic markers associated with porcine growth traits, and the method comprises the following steps:

[0027] Genomic DNA was extracted from the blood of American Large White pigs. Primers were designed based on the porcine NEAT1 transcription start site, from -422 bp upstream to +468 bp upstream. The porcine genomic DNA was amplified by PCR using these primers, and the nucleotide sequence of the NEAT1 transcription start site from -422 bp upstream to +468 bp upstream (sequence details are shown in SEQ ID NO. 1) was obtained by direct sequencing. This sequence contains one SNP site. This mutation site can be used as a genetic marker for association analysis of growth traits in American Large White pigs.

[0028] This invention provides a genotyping method for detecting SNP sites in the above sequence.

[0029] This invention further provides an application of direct sequencing to determine the association between individuals with different genotypes and growth traits. A systematic understanding of the roles of lncRNAs and their SNPs in gene regulation not only helps to elucidate the genetic mechanisms of biological traits but also provides an important theoretical foundation for improving agricultural productivity and promoting animal health. Further exploration of lncRNA SNP research will bring new opportunities for the development of personalized breeding and precision medicine. Research on the relationship between SNPs in lncRNA NEAT1 and its promoter region and pig growth traits has significant scientific value and application prospects, and can provide new strategies for the genetic improvement of pigs.

[0030] For more detailed technical solutions, please refer to the "Detailed Implementation".

[0031] Compared with the prior art, the present invention has the following advantages and effects:

[0032] Experiments revealed that the polymorphic locus rs324459978 was significantly correlated with eye muscle area and the trait of reaching 100 kg body weight in American Large White pigs (P<0.05). Specifically, individuals with the CC genotype had significantly higher eye muscle area than those with the TT genotype (P<0.05); regarding the trait of reaching 100 kg body weight, individuals with the CC genotype reached 100 kg body weight at a significantly shorter age than those with the TT genotype (P<0.01). From the perspectives of genetic stability and genetic progression, the CC genotype showed a clear advantage in shortening the age of reaching 100 kg body weight and increasing eye muscle area. Based on these results, the polymorphic locus rs324459978 can be used as a molecular breeding marker for increasing meat production traits in pigs. Attached Figure Description

[0033] Figure 1 This invention describes the cloning detection results of the 6811209-6812099 segment of porcine chromosome 2. The agarose gel concentration was 1.5%. Figure labeling: Lanes 1-4: PCR amplification products; Lane M: DL2000 Maker.

[0034] Figure 2 SEQ ID NO.1 is the nucleotide sequence of region 6811209-6812099 of porcine chromosome 2. The accompanying diagram illustrates that there is one mutation site in the sequence that is the specific site leading to polymorphism in this region. SEQ ID NO.1 is the nucleotide sequence of region 6811209-6812099 of porcine chromosome 2, which serves as the nucleotide sequence for the genetic marker of this invention. A mutation site, i.e., a mutation from "C" to "T", exists at the 534th base of this sequence. The base at the mutation site in the sequence is the original base; the mutation mode is described in this specification.

[0035] Figure 3 The sequencing results of the genetic marker sequence of this invention show a bimodal pattern, indicating a mutation from the base "C" to "T". Detailed Implementation

[0036] Example 1: Obtaining DNA fragments from region 6811209-6812099 of porcine chromosome 2 and establishing a method for SNP detection.

[0037] The experiment used American Large White pigs. Primer pairs were designed based on the genomic sequence of the 6811209-6812099 segment of chromosome 2. The specific sequences are as follows:

[0038] Forward primer (SEQ ID NO.2): 5'-AGTTCAAGTGCTGCCTTC-3',

[0039] Reverse primer (SEQ ID NO.3): 5'-GCCCTTCTTTCGGATTTCT-3'.

[0040] The above primer pairs were used to perform PCR amplification on the genomic DNA of different experimental pig groups.

[0041] The PCR reaction system is shown in Table 1.

[0042] Table 1 PCR reaction system

[0043]

[0044] The PCR reaction conditions are shown in Table 2.

[0045] Table 2 PCR reaction conditions

[0046]

[0047] The obtained PCR product was purified and cloned, and then sequenced by Wuhan HeCe Gene Technology Co., Ltd. BLAST alignment analysis revealed a C / T base mutation at position 534 of the sequence.

[0048] Example 2: Association analysis and application of the genetic markers of the present invention with meat production traits of different pig breeds

[0049] To determine the correlation between SNPs in the 6811209-6812099 region of porcine chromosome 2 and phenotypic differences in pigs, this study selected 642 American Large White pigs as the experimental material. Polymorphisms were detected using direct sequencing, and the correlation between polymorphic sites and meat production traits in pigs was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values. The analysis model for American Large White pigs is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm In the formula, Y ijkl G represents the observed trait value; u represents the overall trait mean; G represents the observed trait value. i This is a genotype effect; F j S k B l For fixed effects, ε represents pedigree, sex, and batch effects. ijklm The error is random, assumed to follow the pattern N(0, σ). 2 )distributed.

[0050] Polymorphism detection was performed on the rs324459978 locus in the 6811209-6812112 region of pig chromosome 2, and three genotypes were detected in all of the above populations. The genotype frequencies and their distribution are shown in Table 3.

[0051] Table 3 Genotype and allele frequencies of polymorphic locus rs324459978 in American pig herds.

[0052]

[0053] Table 3 shows that the C allele frequency of the polymorphic site rs324459978 is higher than the T allele frequency in the American Large White pig population.

[0054] Table 4. Association analysis of polymorphic locus rs324459978 with meat production traits.

[0055]

[0056] Note: The above values ​​are the least squares mean ± standard error; within each pig breed, the same letter in the same column indicates no significant difference (P>0.05), different letters indicate significant difference (P<0.05), and no label indicates no significant difference (P>0.05). The number in parentheses indicates the number of pigs.

[0057] Analysis of Table 4 revealed that the polymorphic locus rs324459978 was significantly correlated with eye muscle area and the trait of reaching 100 kg body weight in American Large White pigs (P<0.05). Specifically, individuals with the CC genotype had significantly higher eye muscle area than those with the TT genotype (P<0.05); regarding the trait of reaching 100 kg body weight, individuals with the CC genotype reached 100 kg body weight at a significantly shorter age than those with the TT genotype (P<0.01). From the perspectives of genetic stability and genetic progression, the CC genotype showed a clear advantage in shortening the age of reaching 100 kg body weight and increasing eye muscle area. In summary, the polymorphic locus rs324459978 can be used as a molecular breeding marker for increasing meat production traits in pigs.

Claims

1. The application of SNP molecular markers in the promoter region of porcine lncRNA NEAT1 in improving the meat production trait of American Large White pigs, characterized by: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. There is an allele mutation site at the 534th base of the sequence, which is mutated from C to T. The SNP molecular marker is significantly correlated with eye muscle area and the trait of reaching 100 kg in American Large White pigs. Among them, the eye muscle area of ​​CC genotype individuals is significantly higher than that of TT genotype individuals. In terms of the trait of reaching 100 kg body weight, CC genotype individuals reach 100 kg body weight at a significantly shorter age than TT genotype individuals.

2. The application according to claim 1, characterized in that, The primer pair sequences used to detect SNP molecular markers are shown in SEQ ID NO.2 and SEQ ID NO.3.

Images