SSR molecular marker primer set for identifying Dracaena species and its application
By developing SSR molecular marker primer sets and genetic analysis methods, the problem of dragon blood tree species identification was solved, efficient and stable variety distinction and traceability detection were achieved, and the protection of dragon blood tree resources and the selection and breeding of excellent varieties were supported.
Patent Information
- Application Number
- CN202411577936.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-07
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2044-11-07
AI Technical Summary
It is difficult to accurately identify the dragon blood tree varieties in the existing technology, resulting in the confusion of the source of dragon blood-depleted medicinal materials on the market, affecting the safety of clinical medicines, and the wild dragon blood tree resources are on the verge of extinction, and an efficient identification method is needed to support the breeding of excellent dragon blood tree varieties and resource protection of the dragon blood tree.
A SSR molecular marker primer set, including 16 pairs of specific primers, was developed for genetic analysis of dragon blood tree varieties. The genetic distance cluster analysis tree map was constructed through PCR amplification and fluorescent capillary electrophoresis combined with cluster analysis to achieve accurate identification of dragon blood tree varieties.
It has achieved efficient and stable identification of dragon blood tree varieties, can distinguish different varieties and genus species, and supports traceability detection of dragon blood exhaust raw materials, improving the accuracy of dragon blood tree resource management and the safety of clinical medicine.
Smart Images

Figure CN119144759B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a primer set for SSR molecular markers for identifying Dracaena species and an application thereof. Background Art
[0002] Dragon's Blood is a traditional precious Chinese medicine with the effects of promoting blood circulation, dispersing blood stasis, relieving pain, promoting tissue regeneration and healing sores. It has a history of thousands of years of use. According to literature, the dragon blood tree ( Dracaena ) plant is the earliest plant source of Dragon's Blood. The original plant of Dragon's Blood produced in China is the plant of the genus Dracaena, Hainan Dragon's Blood Tree ( D. cambodiana Pierreex Gagnep) and Dracaena scabra ( D. cochinchinensis (Lour.) SC Chen). In addition, other species of the genus Dracaena from Southeast Asia are also an important source of dragon's blood.
[0003] Due to the increasing demand for Dragon's Blood medicinal materials, the predatory logging of its resource plants and the destruction of the ecological environment, the wild Dragon's Blood tree resources are on the verge of extinction. At present, Hainan Dragon's Blood Tree and Sword-Leaf Dragon's Blood Tree are both listed as national second-level rare and endangered plants. The Socotra Dragon's Blood Tree ( D. cinnabari The Dragon Blood Tree (Dracaena balf. F.) is also endangered, and the practice of cutting down trees for resin extraction has been banned in some countries in Southeast Asia. Currently, conservation efforts for wild dragon blood trees worldwide have shifted from simple protection to a combination of conservation and cultivation.
[0004] According to research, the primary cultivated Dracaena species in China is the Hainan Dracaena, with other species including the fragrant Dracaena, sword-leaved Dracaena, black pearl, and space iron. While Dracaena species are morphologically similar, the use of the original plant name for Dracaena has been confusing. This has led to confusion regarding the source plant of Dracaena medicinal materials in the market, resulting in significant differences in their main active ingredients. This has hampered the healthy development of the Dracaena industry and created safety risks in clinical use. Therefore, developing a precise identification method for Dracaena species is crucial, not only for clarifying the original plant of Dracaena medicinal materials but also for the selection and breeding of superior Dracaena varieties. Summary of the Invention
[0005] In view of the current confusion of Dracaena germplasm resources and the current status of Dracaena microsatellite marker development, the present invention provides the following technical solutions:
[0006] The first aspect of the present invention provides an SSR molecular marker primer set for identifying Dracaena species, the primer set comprising the following 16 pairs of primers:
[0007] The primer pair DSSR-080 includes the upstream primer DSSR-080-F and the downstream primer DSSR-080-R. The sequence of DSSR-080-F is TCTTCGTGGAGGCCCTGATA, and the sequence of DSSR-080-R is GGGGA AGGCAAAGGAGAGAG;
[0008] The primer pair DSSR-050 includes the upstream primer DSSR-050-F and the downstream primer DSSR-050-R. The sequence of DSSR-050-F is CCGACCATGGACAAGAAGCT, and the sequence of DSSR-050-R is AGTTTGCAACCTGGGTTCCA;
[0009] The primer pair DSSR-063 includes the upstream primer DSSR-063-F and the downstream primer DSSR-063-R. The sequence of DSSR-063-F is TCTTGATCTTCCGGCAGCAG, and the sequence of DSSR-063-R is TGCACCTTGGCTTCGTAGAG;
[0010] The primer pair DSSR-174 includes the upstream primer DSSR-174-F and the downstream primer DSSR-174-R. The sequence of DSSR-174-F is AGGCCCACACTTTTCCCAAA, and the sequence of DSSR-174-R is GCCAAACAATAACGAGCCCC;
[0011] The primer pair DSSR-087 includes the upstream primer DSSR-087-F and the downstream primer DSSR-087-R. The sequence of DSSR-087-F is TGGTGAAGATGTTGGCCTCC, and the sequence of DSSR-087-R is AGGGGCAGCACATTTCTCTC;
[0012] The primer pair DSSR-187 includes the upstream primer DSSR-187-F and the downstream primer DSSR-187-R. The sequence of DSSR-187-F is CGCCATGCTCAAGTCCTACT, and the sequence of DSSR-187-R is GACCCACAGCTCATCCATCC;
[0013] The primer pair DSSR-086 includes the upstream primer DSSR-086-F and the downstream primer DSSR-086-R. The sequence of DSSR-086-F is CATGCGGCCATTATTGTGGG, and the sequence of DSSR-086-R is CCACTGCTCTTCCAAGGGAA;
[0014] The primer pair DSSR-056 includes the upstream primer DSSR-056-F and the downstream primer DSSR-056-R. The sequence of DSSR-056-F is GCTTAAAGGGTGTGCTTGGC, and the sequence of DSSR-056-R is GGCTTGCAGGAATTTCTGGC;
[0015] The primer pair DSSR-039 includes the upstream primer DSSR-039-F and the downstream primer DSSR-039-R. The sequence of DSSR-039-F is TTGACGTTCATGTCCCTGCA, and the sequence of DSSR-039-R is AGAAACAGTTCAGCTCGGCA;
[0016] The primer pair DSSR-013 includes the upstream primer DSSR-086-F and the downstream primer DSSR-086-R. The sequence of DSSR-086-F is TGCCCTGTTGTTTTCTTCGT, and the sequence of DSSR-086-R is GTTTGTAGTGCCCACCCTGT;
[0017] The primer pair DSSR-079 includes the upstream primer DSSR-079-F and the downstream primer DSSR-079-R. The sequence of DSSR-079-F is AAAACCATAGCCACGACCGT, and the sequence of DSSR-079-R is GCAGGCCCTGTAGTTGGATT;
[0018] The primer pair DSSR-065 includes the upstream primer DSSR-065-F and the downstream primer DSSR-065-R. The sequence of DSSR-065-F is TCCCTAATGGTACCTCGCCA, and the sequence of DSSR-065-R is GGAGGTTTTTACCGGCAGGA;
[0019] The primer pair DSSR-006 includes the upstream primer DSSR-006-F and the downstream primer DSSR-006-R. The sequence of DSSR-006-F is ATAATCCCCGGAGCTAACGC, and the sequence of DSSR-006-R is TGATTAGGGCGACGGATTGG;
[0020] The primer pair DSSR-026 includes the upstream primer DSSR-026-F and the downstream primer DSSR-026-R. The sequence of DSSR-026-F is ACAAGTGTGAGCCTTGGGAC, and the sequence of DSSR-026-R is TCACGACGATTGATCCACAA;
[0021] The primer pair DSSR-022 includes an upstream primer DSSR-022-F and a downstream primer DSSR-022-R. The sequence of DSSR-022-F is CCACTGTTGGTCATGCTTCT, and the sequence of DSSR-022-R is CAACCTGTTGAGGCAGAGGT.
[0022] The primer pair DSSR-188 includes an upstream primer DSSR-188-F and a downstream primer DSSR-188-R. The sequence of DSSR-188-F is TAGAACGGCACTGAACCCAG, and the sequence of DSSR-188-R is TTCAACAGAACTGCCTGCCA.
[0023] The second aspect of the present invention provides the use of the above-mentioned SSR molecular marker primer set in the genetic analysis of Dracaena germplasm resources.
[0024] A third aspect of the present invention provides a method for genetic analysis of Dracaena germplasm resources, comprising the following steps:
[0025] (1) Extracting DNA from samples to be analyzed: Collect young leaves of Dracaena and extract genomic DNA;
[0026] (2) Synthesizing specific fluorescent primers: screening and synthesizing the 16 pairs of primers described in claim 1;
[0027] (3) PCR amplification: using the fluorescent PCR reaction to perform PCR amplification on the genomic DNA in step (1) using the 16 pairs of primers;
[0028] (4) Genetic analysis: The observed number of alleles, effective number of alleles, Shannon index, polymorphism information index, observed heterozygosity, expected heterozygosity and inbreeding coefficient were calculated, and cluster analysis was performed using the non-weighted group average method based on Nei genetic distance to construct a dendrogram of genetic distance cluster analysis.
[0029] A fourth aspect of the present invention provides the use of the above-mentioned SSR molecular marker primer set in identifying different Dracaena varieties and Dracaena species.
[0030] A fifth aspect of the present invention provides a method for identifying Dracaena species, comprising the following steps:
[0031] a. Extracting genomic DNA from Dracaena materials;
[0032] b. Using the DNA obtained in step a as a template, perform PCR amplification using the 16 pairs of primers described in claim 3, and perform capillary electrophoresis analysis on the amplified fragments;
[0033] c. Compare the characteristic fingerprint of the sample to be tested with that of the control variety, or use the dendrogram of cluster analysis described in claim 3 to determine the genetic relationship between the sample to be tested and the control variety.
[0034] Further, in the step b, the PCR amplification system is: 25 μL, including 12.5 μL of 2x EcoTaq PCR SuperMix, 1 μL each of the forward and reverse primers, 20 ng of DNA template, and finally supplemented with ddH2O to make up the volume; the PCR amplification program is: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, gradient annealing at 62 - 52 °C for 30 s, extension at 72 °C for 30 s, running for 10 cycles; denaturation at 95 °C for 30 s, annealing at 52 °C for 30 s, extension at 72 °C for 30 s, running for 25 cycles; extension at 72 °C for 20 min.
[0035] Advantages of the present invention:
[0036] The 16 pairs of primers provided by the present invention not only have high amplification efficiency and stable amplification results in Dracaena plants, but also have strong discrimination ability for Dracaena plants (PIC > 0.6). Using the above SSR molecular marker primer set, different Dracaena varieties and Dracaena species can not only be identified, but also the raw materials of dragon's blood can be traced and detected. Description of the drawings
[0037] Figure 1 It is the electrophoretic dotting diagram of amplification at 7 loci for 2 samples (partial loci dotting diagram shown), and the sample loading order from left to right is: HK4-ZP-LXS080, HK5-ZP-LXS080, HK4-ZP-LXS050, HK5-ZP-LXS050, HK4-ZP-LXS063, HK5-ZP-LXS063, HK4-ZP-LXS174, HK5-ZP-LXS174, HK4-ZP-LXS087, HK5-ZP-LXS087, HK4-ZP-LXS187, HK5-LXS187, HK4-ZP-LXS086, HK5-ZP-LXS086, DNA Marker.
[0038] Figure 2 It is the genotyping peak diagram and fragment size of some samples.
[0039] Figure 3 It is the phylogenetic tree of 16 Dracaena samples constructed based on 16 pairs of SSR primers.
[0040] Figure 4 It is the clustering phylogenetic tree of 4 samples to be tested (triangles) and 16 control samples. Detailed implementation manners
[0041] The specific embodiments of the present invention will be described below to facilitate those skilled in the art to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions made using the concept of the present invention are within the scope of protection.
[0042] Example 1: Screening of SSR primer sets
[0043] 1. Screening of SSR primers: The MISA software was used to analyze and screen SSR sequences in the Dracaena transcriptome. The screening criteria for SSR loci are as follows: (1) Remove loci where all repeat units are composed of G / C bases; (2) Remove loci with single-base repeat units and compound repeat units; (3) Retain SSR sequences with a repeat count of more than 5 times; (4) Preferentially select loci from different gene sequences respectively.
[0044] 2. Primer design: Primers were designed from the SSR loci that meet the above conditions. The primer design parameters are as follows: (1) Primer sequence length is 18 - 22 bp; (2) Amplification product length is 110 - 350 bp; (3) Annealing temperature (Tm value) is 50°C - 60°C; (4) GC content of the amplification product is 40% - 60%.
[0045] 3. Primer synthesis: 192 pairs of primers were randomly selected from the SSR markers that meet the above two-step criteria and synthesized using the adapter method. That is, a 21bp adapter sequence was added to the upstream primer during synthesis. When performing PCR amplification using the adapter method, in the first step, the adapter-containing upstream primer and the downstream primer bind to the template to obtain a PCR product with an adapter sequence. In the second step, the adapter primer with a fluorescent group and the downstream primer bind to the PCR product of the first step to obtain a PCR product with a fluorescent group and a 21bp adapter sequence.
[0046] 4. Samples of 16 Dracaena plants with significantly different genetic backgrounds were used as screening materials (Table 1), and qualified DNA was extracted from these samples.
[0047] Table 1 Information of 16 samples for screening
[0048]
[0049] 5. Fluorescent PCR amplification
[0050] Table 2 PCR amplification system and amplification program
[0051]
[0052] 6. Detection and dilution of fluorescent PCR products
[0053] After the fluorescence PCR amplification was completed, 2 μL of the PCR product was taken for agarose gel electrophoresis detection (1% concentration) ( Figure 1 ). The primer screening was carried out according to the following criteria: (1) obvious bands were present in all samples, indicating a high amplification success rate; (2) the bands were single and clear, without trailing, indicating high amplification specificity. For the PCR products that met the above criteria, they were diluted according to the detection concentration of the samples on the machine to obtain fluorescence PCR products with uniform concentration.
[0054] The specific sequences of the 16 pairs of SSR primers screened are as follows:
[0055] Table 3 Sequences of 16 pairs of SSR primers
[0056]
[0057] 7. Fluorescent capillary electrophoresis detection
[0058] The fluorescence PCR products diluted to a uniform concentration were added to the upper machine plate. The detection plate with the added samples and reagents was centrifuged and then placed on the PCR instrument to run the denaturation program (95 °C, 3 min). After the denaturation was completed, it was immediately cooled. Referring to the ABI 3730xL upper machine operation process, the detection file corresponding to the name of the detection plate was selected, and the SSR sample analysis detection program was run. The capillary original data was analyzed using the Fragment(Plant) fragment analysis function in the GeneMarker software. By comparing and analyzing the positions of the molecular weight internal standards in each lane with the positions of the peaks of each sample, the fragment size of each amplification product was obtained ( Figure 2 ).
[0059] 8. Data analysis
[0060] According to the lengths of the amplification products of each pair of SSR primers, using software such as GenAlEx version 6.501, various genetic diversity indexes of SSR loci and populations were calculated, including observed alleles (Na), effective alleles (Ne), Shannon index (I), polymorphism information index (PIC), observed heterozygosity (Ho), expected heterozygosity (He), and inbreeding coefficient (Fis) (Table 2). Further, with the criteria that the peak quality was qualified, Na (number of alleles) ≥ 3 and PIC (polymorphism information index) > 0.6 (Table 2), 16 pairs of SSR marker primer groups with good polymorphism and high resolution were screened out. Using the PowerMarker software, an unweighted pair-group method with arithmetic means (UPGMA) phylogenetic tree of 16 samples was constructed ( Figure 3 ). It can be seen from Figure 3 that the 16 SSR loci can distinguish 16 Dracaena varieties, indicating that the 16 pairs of SSR primers have high resolution.
[0061] Table 4 Genetic diversity indices of 16 pairs of SSR primers
[0062]
[0063] Note: N a: Observed allele N e: Effective allele I : Shannon index H o: Observed heterozygosity H e: Expected heterozygosity PIC : Polymorphism information index
[0064] Example 2: Identification of unknown Dracaena germplasm resources
[0065] (1) Extraction and detection of sample DNA: Wipe the sample clean with absorbent cotton balls soaked in 75% alcohol and let it dry. Select 100 mg of fresh wood (10 - 50 mg of dry wood), and extract DNA with reference to the plant genomic DNA extraction kit (OMEGA HP Plant DNA Kit, USA). Take 2 μL of the DNA stock solution for concentration and purity detection (NanoDrop 2000, USA). The DNA should meet the following quality requirements: concentration greater than 50 ng / μL, A260 / A280 is 1.8 - 2.2, and A260 / A230 is greater than 1.0. <0,
[0066] (2) Fluorescent PCR amplification:
[0067] The PCR reaction system is 25 μL, including 12.5 μL of 2x EcoTaq PCR SuperMix (Transgen, China), 1 μL of each forward and reverse primer, 20 ng of DNA template, and finally made up to volume with ddH2O.
[0068] The PCR amplification program is set as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62 - 52°C for 30 s, extension at 72°C for 30 s, running for 10 cycles; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, running for 25 cycles; extension at 72°C for 20 min, and finally stored at 4°C.
[0069] (3) Electrophoresis identification and dilution of fluorescent PCR products: After the fluorescent PCR amplification is completed, take 2 μL of the PCR product for agarose gel electrophoresis detection (1% concentration), and judge the amplification efficiency of each SSR primer by the brightness of the PCR product bands. Dilute each fluorescent PCR product according to the concentration requirement for sample loading on the sequencer to obtain fluorescent PCR products with uniform concentration, and arrange for detection on the sequencer.
[0070] (4)Fluorescent capillary electrophoresis detection: Add the fluorescent PCR products diluted to a uniform concentration to the sample loading plate, and add the sample loading detection reagents according to the following system respectively:
[0071] Table 5 Fluorescent PCR reaction system
[0072]
[0073] Centrifuge the sample loading plate with added samples and reagents, and then place it on the PCR instrument to run the denaturation program (95°C, 3 min). Immediately cool it after denaturation is completed; refer to the ABI 3730xl sample loading operation process, select the detection file corresponding to the name of the sample loading plate to be detected, and run the SSR sample analysis detection program.
[0074] (5)Export the original data in.fsa format from the ABI 3730xl instrument. After classifying and archiving according to the detection sites, import them into the GeneMarker analysis software respectively to obtain the fragment sizes of each amplified product. Use the UPGMA method for cluster analysis and draw a circular cluster diagram ( Figure 4 ). Judge the variety of the sample to be detected and its genetic relationship with the control variety according to the positions of the sample to be detected and the control variety in the phylogenetic tree. It can be seen from Figure 4 that the two samples (HaiN-DF and HaiN-DF-resin) from Dongfang, Hainan are clustered on a single branch alone, indicating that they may be the same variety or similar varieties. At the same time, they also have a relatively close genetic relationship with the control varieties from Maoming, Guangdong (GuangD-SJL) and Wanning, Hainan (HaiN-WN1); while the fat-containing material from Sanya (HaiN-SY8-resin) has a relatively close relationship with the control variety from Lingshui (HaiN-LS2).
[0075] In the present invention, specific embodiments are used to elaborate on the principle and implementation manner of the present invention. The description of the above embodiments is only used to help understand the method and its core idea of the present invention; at the same time, for those of ordinary skill in the art, according to the idea of the present invention, there will be changes in the specific implementation manner and application scope. In summary, the content of this specification should not be construed as a limitation to the present invention.
Claims
1. An SSR molecular marker primer set for the variety identification of Dracaena cochinchinensis, characterized in that, The primer set includes the following 16 pairs of primers: Primer pair DSSR-080 includes upstream primer DSSR-080-F and downstream primer DSSR-080-R. The sequence of DSSR-080-F is TCTTCGTGGAGGCCCTGATA, and the sequence of DSSR-080-R is GGGGAAGGCAAAGGAGAGAG; Primer pair DSSR-050 includes upstream primer DSSR-050-F and downstream primer DSSR-050-R. The sequence of DSSR-050-F is CCGACCATGGACAAGAAGCT, and the sequence of DSSR-050-R is AGTTTGCAACCTGGGTTCCA; Primer pair DSSR-063 includes upstream primer DSSR-063-F and downstream primer DSSR-063-R. The sequence of DSSR-063-F is TCTTGATCTTCCGGCAGCAG, and the sequence of DSSR-063-R is TGCACCTTGGCTTCGTAGAG; Primer pair DSSR-174 includes upstream primer DSSR-174-F and downstream primer DSSR-174-R. The sequence of DSSR-174-F is AGGCCCACACTTTTCCCAAA, and the sequence of DSSR-174-R is GCCAAACAATAACGAGCCCC; Primer pair DSSR-087 includes upstream primer DSSR-087-F and downstream primer DSSR-087-R. The sequence of DSSR-087-F is TGGTGAAGATGTTGGCCTCC, and the sequence of DSSR-087-R is AGGGGCAGCACATTTCTCTC; Primer pair DSSR-187 includes upstream primer DSSR-187-F and downstream primer DSSR-187-R. The sequence of DSSR-187-F is CGCCATGCTCAAGTCCTACT, and the sequence of DSSR-187-R is GACCCACAGCTCATCCATCC; Primer pair DSSR-086 includes upstream primer DSSR-086-F and downstream primer DSSR-086-R. The sequence of DSSR-086-F is CATGCGGCCATTATTGTGGG, and the sequence of DSSR-086-R is CCACTGCTCTTCCAAGGGAA; Primer pair DSSR-056 includes upstream primer DSSR-056-F and downstream primer DSSR-056-R. The sequence of DSSR-056-F is GCTTAAAGGGTGTGCTTGGC, and the sequence of DSSR-056-R is GGCTTGCAGGAATTTCTGGC; The primer pair DSSR-039 includes the upstream primer DSSR-039-F and the downstream primer DSSR-039-R. The sequence of DSSR-039-F is TTGACGTTCATGTCCCTGCA, and the sequence of DSSR-039-R is AGAAACAGTTCAGCTCGGCA; The primer pair DSSR-013 includes the upstream primer DSSR-086-F and the downstream primer DSSR-086-R. The sequence of DSSR-086-F is TGCCCTGTTGTTTTCTTCGT, and the sequence of DSSR-086-R is GTTTGTAGTGCCCACCCTGT; The primer pair DSSR-079 includes the upstream primer DSSR-079-F and the downstream primer DSSR-079-R. The sequence of DSSR-079-F is AAAACCATAGCCACGACCGT, and the sequence of DSSR-079-R is GCAGGCCCTGTAGTTGGATT; The primer pair DSSR-065 includes the upstream primer DSSR-065-F and the downstream primer DSSR-065-R. The sequence of DSSR-065-F is TCCCTAATGGTACCTCGCCA, and the sequence of DSSR-065-R is GGAGGTTTTTACCGGCAGGA; The primer pair DSSR-006 includes the upstream primer DSSR-006-F and the downstream primer DSSR-006-R. The sequence of DSSR-006-F is ATAATCCCCGGAGCTAACGC, and the sequence of DSSR-006-R is TGATTAGGGCGACGGATTGG; The primer pair DSSR-026 includes the upstream primer DSSR-026-F and the downstream primer DSSR-026-R. The sequence of DSSR-026-F is ACAAGTGTGAGCCTTGGGAC, and the sequence of DSSR-026-R is TCACGACGATTGATCCACAA; The primer pair DSSR-022 includes the upstream primer DSSR-022-F and the downstream primer DSSR-022-R. The sequence of DSSR-022-F is CCACTGTTGGTCATGCTTCT, and the sequence of DSSR-022-R is CAACCTGTTGAGGCAGAGGT; The primer pair DSSR-188 includes the upstream primer DSSR-188-F and the downstream primer DSSR-188-R. The sequence of DSSR-188-F is TAGAACGGCACTGAACCCAG, and the sequence of DSSR-188-R is TTCAACAGAACTGCCTGCCA.
2. The application of the SSR molecular marker primer set according to claim 1 in the genetic analysis of Dracaena germplasm resources.
3. A method for genetic analysis of Dracaena cambodiana germplasm resources, characterized in that, Comprising the following steps: (1) Extracting the DNA of the sample to be analyzed: Collecting the young leaves of Dracaena and extracting the genomic DNA; (2) Screening and synthesizing the 16 pairs of primers described in claim 1; (3)PCR amplification: Using fluorescence PCR reaction, the genomic DNA in step (1) was subjected to PCR amplification using the 16 pairs of primers respectively. (4)Genetic analysis: The number of observed alleles, effective alleles, Shannon index, polymorphism information index, observed heterozygosity, expected heterozygosity and inbreeding coefficient were statistically observed, and unweighted pair-group method with arithmetic mean (UPGMA) based on Nei's genetic distance was used for cluster analysis to construct a dendrogram of genetic distance cluster analysis.
4. Use of the SSR molecular marker primer set according to claim 1 in identifying different Dracaena varieties and Dracaena species.
5. A method for identifying a variety of Dracaena cambodiana, characterized in that, Comprising the following steps: a. Extract the genomic DNA of Dracaena materials; b. Using the DNA obtained in step a as a template, perform PCR amplification using the SSR molecular marker primer set for Dracaena variety identification according to claim 1, and perform capillary electrophoresis analysis on the amplified fragments respectively. c. Compare the characteristic fingerprint of the test sample with that of the control variety, or use the dendrogram of cluster analysis described in claim 3 to determine the genetic relationship between the test sample and the control variety.
Citation Information
Patent Citations
Species identification method and kit for origin of resina draconis medicinal material
CN111662998A