A fluorescent detection kit for detecting central nervous system vitamin B12 deficiency hydroxocobalamin receptor antibodies and its application

Abstract

The present invention relates to a fluorescent detection kit for detecting hydroxocobalamin receptor antibodies in central nervous system vitamin B12 deficiency and its application, which can efficiently and accurately detect the presence and concentration of anti-CD320 antibodies in patient serum or cerebrospinal fluid. The kit uses a specific antibody to bind to the CD320 protein produced by cells expressing the CD320 gene, which then binds to a fluorescently labeled secondary antibody to generate a fluorescent signal, thereby diagnosing central nervous system vitamin B12 deficiency. The base sequence in this application ensures the effective expression of the CD320 gene, which is crucial for improving the sensitivity and specificity of the test.

Description

Technical Field

[0001] The present invention relates to the field of fluorescence detection, and in particular to a fluorescence detection kit for detecting hydroxycobalamin receptor antibodies in central nervous system vitamin B12 deficiency and an application thereof. Background Art

[0002] Vitamin B12 is an essential, water-soluble micronutrient involved in metabolic processes. Vitamin B12 plays a vital role in the normal function of the nervous system, participating in myelin synthesis, promoting red blood cell maturation in the bone marrow, and also influencing the circulatory system. Vitamin B12 deficiency can lead to neurological deficits, including poor coordination, spasticity, and cognitive decline. However, blood tests that rely on B12 levels do not accurately reflect levels in the brain.

[0003] CD320, also known as the transcobalamin receptor, is enriched in endothelial cells of the blood-brain barrier and mediates the uptake and transcytosis of transcobalamin-conjugated vitamin B12 into cells of the central nervous system. Studies have shown that immunoglobulins in patients with B12 deficiency inhibit CD320 function. Anti-CD320 antibodies may impede vitamin B12 transport across the blood-brain barrier by reducing the availability of cell-surface receptors. The detection of anti-CD320 antibodies in the blood predicts vitamin B12 deficiency in the brain. CD320 autoantibodies may affect brain neurons by initially reducing vitamin B12 levels. For patients with anti-CD320 seropositivity and unexplained neurological abnormalities, consideration should be given to measuring vitamin B12 metabolites in the cerebrospinal fluid.

[0004] Detecting the presence of CD320 antibodies can help diagnose central nervous system diseases associated with vitamin B12 deficiency and guide clinical treatment. However, there is currently a lack of efficient and rapid methods and kits for detecting CD320 antibodies. Therefore, the development of a highly sensitive and specific detection kit is of great clinical significance. Summary of the Invention

[0005] Given the current lack of efficient and rapid CD320 antibody detection kits, the present invention aims to provide a CD320-targeted antibody kit. The present invention also provides a novel method for detecting anti-hydroxycobalamin receptor autoantibodies in patient serum or cerebrospinal fluid. This method combines highly sensitive cellular immunofluorescence detection with cells carrying a CD320 gene vector. This method boasts high detection efficiency and strong specificity, and has significant clinical application value.

[0006] The present invention utilizes cellular immunofluorescence (CBA) technology, combines the specific binding properties of antigens and antibodies, and does not modify or fix the antigens or antibodies in the sample during the detection process, fully retaining their spatial structure, thereby improving the sensitivity and specificity of the detection.

[0007] Specifically, the present invention uses a multi-stage recombination method to recombinantly integrate the CD320 gene into the pIRES2-EGFP vector. This vector retains the EGFP protein function while minimizing the effects on the function of the target gene. This vector facilitates detection of transfection success and ensures high-quality expression of the CD320 gene, thereby producing sufficient CD320 protein for detecting anti-CD320 antibodies in samples.

[0008] To address the above issues, the present invention provides a detection kit for detecting anti-CD320 antibodies. The kit includes cells expressing the CD320 gene and a second antibody; wherein the second antibody is an anti-human antibody that generates fluorescence or quenches fluorescence when in contact with the second antibody.

[0009] In the present invention, the CD320 antibody contained in the test sample is the first antibody, which is capable of antigen-antibody specific binding with the CD320 protein produced by cells expressing the CD320 gene in the kit of the present invention. The first antibody (antibody antigen) is also capable of antigen-antibody specific binding with the second antibody in the kit.

[0010] As one embodiment of the present invention, the second antibody includes but is not limited to anti-human antibodies produced by goat, rat, mouse, donkey, horse, rabbit, dog, cow, etc.; preferably goat anti-human antibodies, and their sources include but are not limited to commercially available or laboratory-prepared.

[0011] As one embodiment of the present invention, the second antibody type includes but is not limited to IgG, IgM, IgA, IgG (Fc), etc., preferably IgG.

[0012] As one of the embodiments of the present invention, the CD320-expressing cells are cells transfected with a pIRES2-EGFP vector carrying the CD320 gene expression vector.

[0013] As one embodiment of the present invention, the method for preparing cells expressing the CD320 gene comprises:

[0014] Construction of CD320 gene vector;

[0015] Prepare 293T cells for transfection;

[0016] Plasmid transfection into cells;

[0017] As one of the embodiments of the present invention, the CD320 gene vector construction steps include: obtaining a fragment PCR product by PCR amplification, and recombining it into a target vector by a multi-segment sufficient method to finally obtain a target plasmid.

[0018] As one embodiment of the present invention, the construction of the CD320 gene vector further includes the steps of digesting the full-length sequence of the human CD320 gene and the vector with restriction endonucleases such as Xhol-BamHI, followed by ligation. During the construction of the CD320 gene vector plasmid, the CD320 gene is obtained using PCR, using the primer pairs represented by G0294965-1_1 and G0294965-1_2.

[0019] As one embodiment of the present invention, the cells used for transfection include but are not limited to HEK293T, CHO, Hela, Human ES cells, MC3T3-E1, etc.; HEK293T is preferred, and HEK293T that has been adherently grown after passage is further preferred.

[0020] As one embodiment of the present invention, the plasmid transfection method includes but is not limited to electric shock method, liposome-mediated method, virus-mediated method, microinjection method, calcium phosphate method, gene gun method, etc.; preferably, liposome-mediated method.

[0021] As one of the embodiments of the present invention, the liposome used for transfection in the plasmid transfected cells is a cationic liposome; preferably lipofectamine3000.

[0022] As one embodiment of the present invention, the plasmid transfection into cells includes adding plasmid and liposome.

[0023] The kit provided by the present invention can be used to prepare a reagent for a method of detecting anti-hydroxycobalamin receptor autoantibodies in patient serum or cerebrospinal fluid, and the detection method comprises:

[0024] Step 1: Sample processing: Collect patient samples and dilute them with diluent at a ratio of 1:10, 1:32, 1:100, or 1:320;

[0025] Step 2: inoculating the cells expressing the CD320 gene;

[0026] Step 3: Add blocking solution and incubate at 37°C for 30 minutes;

[0027] Step 4: Add the sample to be tested and incubate at 37°C for 1 hour;

[0028] After washing in step 5, add secondary antibody and incubate at 37°C for 30 minutes;

[0029] After washing in step 6, the fluorescence intensity generated by the detection cells and the test sample is analyzed to diagnose whether the patient suffers from central nervous system B12 deficiency.

[0030] As one embodiment of the present invention, the sample in step 1 includes but is not limited to serum and cerebrospinal fluid; preferably serum.

[0031] As one embodiment of the present invention, step 2 further includes: digesting HEK293T cells with 1 ml of trypsin for 1-2 minutes, and resuspending the HEK293T cells in DMEM medium containing 10% fetal bovine serum. The cell suspension is placed in a 96-well plate, and the well plate is placed in an incubator at 37°C, 5% carbon dioxide, and saturated humidity for 8-24 hours. After the cells are completely attached, transfection begins. HEK293T cells transfected with CD320 gene plasmids are cultured in 96-well plates for 24 hours. When the plasmid transfection rate reaches 60%-80% under a microscope, they are used for subsequent testing.

[0032] As one embodiment of the present invention, the blocking solution includes goat serum, bovine serum albumin, skim milk powder, commercially available blocking solution, etc., preferably goat serum.

[0033] As one embodiment of the present invention, the washing solution includes but is not limited to PBS, commercially available washing solution, etc., preferably PBS.

[0034] As one embodiment of the present invention, the secondary antibody reacted in step 5 is a fluorescently labeled goat anti-human antibody.

[0035] As one embodiment of the present invention, step 6 further includes using negative and positive samples as controls to diagnose whether the patient suffers from central nervous system B12 deficiency according to the intensity of the fluorescent signal under a microscope.

[0036] The present invention also provides a method for constructing a CMV-CD320-pIRES-EGFP gene vector plasmid for preparing the fluorescent detection kit for detecting anti-CD320 antibodies, comprising the following steps:

[0037] Step 1: Amplify the CD320 fragment by PCR using the following primers:

[0038] The base sequence of the upstream primer is the base sequence of SEQ ID NO.1 in the base sequence table:

[0039] TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG;

[0040] The base sequence of the downstream primer is the base sequence of SEQ ID NO.2 in the base sequence table:

[0041] TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGTCATCGTCGTCCTTGTAAT;

[0042] Step 2: Screen positive clones using the bacterial solution PCR method, obtain the positive bacterial solution by shaking at 37°C to extract the plasmid, sequence and compare the correct plasmid, and perform double enzyme digestion with Xhol-BamHI.

[0043] A method for obtaining HEK293T transfected cells carrying a CD320 gene plasmid, used for preparing the fluorescent detection kit for detecting anti-CD320 antibodies, comprises the following steps:

[0044] 1) Cell culture: HEK293T cells were routinely cultured in our laboratory in DMEM medium supplemented with 10% inactivated fetal bovine serum. Cells in the logarithmic growth phase were used for experiments.

[0045] 2) Cell recovery and passaging: Pre-add 20 ml of DMEM medium to a 50 ml centrifuge tube. Remove the frozen cells from the liquid nitrogen tank and immediately thaw them in a 37°C water bath. Disinfect the outer wall of the cryotube with 70% alcohol. Transfer the cell storage solution to a centrifuge tube. Centrifuge at 100 rpm for 5 minutes, discard the supernatant, and resuspend the cells in DMEM medium supplemented with 10% fetal bovine serum. Incubate at 37°C in an incubator with 5% CO2 and saturated humidity.

[0046] 3) Cell Preparation: Digest HEK293T cells with 1 ml of trypsin for 1-2 minutes and resuspend in DMEM medium supplemented with 10% fetal bovine serum. Place the cell suspension in a 96-well plate and incubate in a 37°C, 5% CO2, saturated humidity incubator for 8-24 hours. Transfection can begin after the cells have fully adhered.

[0047] 4) Plasmid transfection: Take a sterile 1.5 ml EP tube, add serum-free DMEM medium, thoroughly mix the prepared plasmid and lipofectamine 3000, and let it stand for 15-20 minutes. Add the mixture to the prepared cells and incubate in a 37°C incubator containing 5% carbon dioxide.

[0048] The beneficial effects of the present invention are:

[0049] The present invention provides a fluorescent detection kit for detecting anti-CD320 antibodies and its preparation method, which can efficiently and accurately detect the presence and concentration of anti-CD320 antibodies in patient serum or cerebrospinal fluid. The kit uses a specific antibody to bind to the CD320 protein produced by cells expressing the CD320 gene, which then binds to a fluorescently labeled secondary antibody to generate a fluorescent signal, thereby diagnosing central nervous system B12 deficiency. The base sequence in this application ensures the effective expression of the CD320 gene, which is crucial for improving the sensitivity and specificity of the test.

[0050] This kit has high sensitivity and specificity, a simple operational process, and standardized experimental steps that reduce operational difficulty and improve detection efficiency. Furthermore, the choice of secondary antibodies is flexible and diverse, and anti-human antibodies from different animal sources can be selected according to actual needs, enhancing the adaptability and flexibility of the kit. This invention is not only suitable for diagnosing central nervous system B12 deficiency but can also be expanded to other fields requiring the detection of anti-CD320 antibodies, providing strong support for clinical diagnosis and scientific research.

[0051] This study establishes a highly sensitive method for detecting CD320 antibodies in samples using cellular immunofluorescence technology, suitable for clinical diagnosis and determination of CD320 autoantibody titers. This method utilizes the highly sensitive and specific cellular immunofluorescence staining (CBA) technique, which eliminates the need for chemical modification or fixation of the antigen or antibody, thereby better preserving their spatial structure.

[0052] By comparing with existing detection methods such as enzyme-linked immunosorbent assay (ELISA), radioimmunoprecipitation assay (RIPA), and immunoblotting, it was determined that this CBA detection technology has the characteristics of high sensitivity and strong specificity, successfully solving the common false positives or false negatives of traditional detection methods such as ELISA, and has very important clinical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0054] Attachment Figure 1 Flow chart of the method for preparing cells expressing CD320 gene;

[0055] Attachment Figure 2 Flow chart of the method for obtaining HEK293T transfected cells with CD320 gene plasmid;

[0056] Attachment Figure 3 5 is the CD320 plasmid map constructed in the embodiment of the present invention;

[0057] Attachment Figure 4 This is a diagram of the enzyme digestion results in an embodiment of the present invention;

[0058] Attachment Figure 5 This is a graph showing the detection results of CD320 antibodies with a Flag tag detected by the method of the present invention in cells expressing the CD320 gene constructed in the practice of the present invention. The detection results are negative and strongly positive from left to right.

[0059] Among them: Figure 4 The target gene obtained by PCR amplification was constructed into the pIRES2-EGFP vector, the plasmid was extracted, and the plasmid was digested with XhoI-BamHI. The obtained band was approximately 879 / 5261, which was consistent with the expected size of 879 / 5261. The enzyme digestion results showed that a recombinant plasmid containing the CD320 gene was obtained. DETAILED DESCRIPTION

[0060] Combine Figures 1 to 5 The present invention includes a fluorescence detection kit for detecting anti-CD320 antibodies, the kit including cells expressing CD320 gene and a second antibody; wherein the second antibody is an anti-human antibody, which generates fluorescence or undergoes fluorescence quenching when in contact with the second antibody;

[0061] The CD320 antibody contained in the sample to be tested is the first antibody, which can undergo antigen-antibody specific binding with the CD320 protein produced by cells expressing the CD320 gene in the detection kit, and the first antibody can also undergo antigen-antibody specific binding with the second antibody in the kit.

[0062] The second antibody is goat, rat, mouse, donkey, horse, rabbit, dog or cow anti-human antibody; preferably goat anti-human antibody;

[0063] The second antibody type is IgG, IgM, IgA or IgG (Fc); IgG is preferred;

[0064] The cells expressing the CD320 gene are cells transformed with a pIRES2-EGFP vector carrying the CD320 gene expression.

[0065] The method for preparing cells expressing the CD320 gene comprises the following steps:

[0066] Construction of CD320 gene vector;

[0067] Prepare 293T cells for transfection;

[0068] Plasmid transfection into cells.

[0069] The CD320 gene vector construction steps include: obtaining a fragment PCR product by PCR amplification, and recombining it into a target vector by a multi-segment sufficient method to finally obtain a target plasmid.

[0070] The construction of the CD320 gene vector further includes the steps of digesting the full-length sequence of the human CD320 gene and the vector with a restriction endonuclease and then connecting the two, wherein the restriction endonuclease is Xhol-BamHI.

[0071] In the step of constructing the CD320 gene vector plasmid, the CD320 gene was obtained using PCR. The sequences of the primer pairs used in the PCR method were:

[0072] The base sequence of the upstream primer is:

[0073] TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG;

[0074] The base sequence of the downstream primer is:

[0075] TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGTCATCGTCGTCCTTGTAAT.

[0076] The cells used for transfection are HEK293T, CHO, Hela, Human ES cells or MC3T3-E1; preferably HEK293T, more preferably HEK293T that has been adherently grown after passage;

[0077] The plasmid transfection method is electric shock method, liposome-mediated method, virus-mediated method, microinjection method, calcium phosphate method or gene gun method; liposome-mediated method is preferred;

[0078] The liposomes used in the transfection of the plasmid into the cells are cationic liposomes, preferably lipofectamine 3000;

[0079] The plasmid transfection into cells includes adding plasmid and liposome.

[0080] A method for constructing a CMV-CD320-pIRES-EGFP gene vector plasmid for preparing the fluorescent detection kit for detecting anti-CD320 antibodies comprises the following steps:

[0081] Step 1: Amplify the CD320 fragment by PCR using the following primers:

[0082] The base sequence of the upstream primer is:

[0083] TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG;

[0084] The base sequence of the downstream primer is:

[0085] TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGTCATCGTCGTCCTTGTAAT;

[0086] Step 2: Screen positive clones using the bacterial solution PCR method, obtain the positive bacterial solution by shaking at 37°C to extract the plasmid, sequence and compare the correct plasmid, and perform double enzyme digestion with Xhol-BamHI.

[0087] A method for obtaining HEK293T transfected cells carrying a CD320 gene plasmid, used for preparing the fluorescent detection kit for detecting anti-CD320 antibodies, comprises the following steps:

[0088] 1) Cell culture: HEK293T cells were routinely cultured in our laboratory in DMEM medium supplemented with 10% inactivated fetal bovine serum. Cells in the logarithmic growth phase were used for experiments.

[0089] 2) Cell recovery and passaging: Pre-add 20 ml of DMEM medium to a 50 ml centrifuge tube. Remove the frozen cells from the liquid nitrogen tank and immediately thaw them in a 37°C water bath. Disinfect the outer wall of the cryotube with 70% alcohol. Transfer the cell storage solution to a centrifuge tube. Centrifuge at 100 rpm for 5 minutes, discard the supernatant, and resuspend the cells in DMEM medium supplemented with 10% fetal bovine serum. Incubate at 37°C in an incubator with 5% CO2 and saturated humidity.

[0090] 3) Cell Preparation: Digest HEK293T cells with 1 ml of trypsin for 1-2 minutes and resuspend in DMEM medium supplemented with 10% fetal bovine serum. Place the cell suspension in a 96-well plate and incubate in a 37°C, 5% CO2, saturated humidity incubator for 8-24 hours. Transfection can begin after the cells have fully adhered.

[0091] 4) Plasmid transfection: Take a sterile 1.5 ml EP tube, add serum-free DMEM medium, thoroughly mix the prepared plasmid and lipofectamine 3000, and let it stand for 15-20 minutes. Add the mixture to the prepared cells and incubate in a 37°C incubator containing 5% carbon dioxide.

[0092] A use of the kit in preparing a detection reagent for detecting whether a person has central nervous system B12 deficiency comprises the following steps:

[0093] Step 1, sample processing: collect samples from patient serum or cerebrospinal fluid, and dilute them with diluent at a ratio of 1:10, 1:32, 1:100, or 1:320;

[0094] Step 2, inoculating the cells expressing the CD320 gene;

[0095] Step 3: Add blocking solution and incubate at 37°C for 30 minutes;

[0096] Step 4: Add the sample to be tested and incubate at 37°C for 1 hour;

[0097] Step 5: After washing, add secondary antibody and incubate at 37°C for 30 minutes;

[0098] Step 6: After washing, analyzing the fluorescence intensity generated by the detection cells and the test sample to diagnose whether the patient suffers from central nervous system B12 deficiency;

[0099] Wherein: the sample in step 1 is serum or cerebrospinal fluid, preferably serum;

[0100] The step 2 further comprises: digesting HEK293T cells with 1 ml of trypsin for 1-2 minutes, resuspending the HEK293T cells with DMEM medium containing 10% fetal bovine serum; placing the cell suspension in a 96-well plate, incubating the well plate in an incubator at 37° C., 5% carbon dioxide, and saturated humidity for 8-24 hours, and starting transfection after the cells are completely attached; culturing the HEK293T cells transfected with the CD320 gene plasmid in the 96-well plate for 24 hours, and observing under a microscope when the plasmid transfection rate reaches 60%-80%, for subsequent detection;

[0101] The blocking solution is goat serum, bovine serum albumin or skimmed milk powder, preferably goat serum;

[0102] The washing solution includes but is not limited to PBS;

[0103] The secondary antibody reacted in step 5 is a fluorescently labeled goat anti-human antibody;

[0104] The step 6 further includes using negative and positive samples as controls to diagnose whether the patient suffers from central nervous system B12 deficiency according to the intensity of the fluorescent signal under a microscope.

[0105] Example 1: See Figure 3 The preparation of the kit for detecting anti-human CD320 antibodies is carried out in the following steps:

[0106] Construction of CMV-CD320-pIRES-EGFP gene vector plasmid

[0107] 1) Amplify the CD320 fragment using PCR. The primers used are:

[0108] Upstream primer: G0294965-1_1:

[0109] TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG

[0110] Downstream primer: G0294965-1_2:

[0111] TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGTCATCGTCGTCCTTGTAAT

[0112] 2) Screen positive clones using the PCR method in the bacterial solution, obtain plasmids by shaking the bacterial solution at 37°C, sequence the correct plasmids, and perform double enzyme digestion with Xhol-BamHI.

[0113] The first and last primers used:

[0114] Template Name Primer sequences SEQ ID NO.1 TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG SEQ ID NO.2 TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGTCATCGTCGTCCTTGTAAT

[0115] Sequencing primers used:

[0116] name Sequencing primers Primer type Primer 1 N-5TGGGAGGTCTATATAAGCAGAG Universal primers Test primer 2 IRES-RAACGCACACCGGCCTTATTC Universal primers

[0117] Obtaining HEK293T transfected cells

[0118] 1) Cell culture: HEK293T cells were routinely cultured in our laboratory in DMEM medium supplemented with 10% inactivated fetal bovine serum (FBS, SH30084.03, Hyclone). Cells in the logarithmic growth phase were used in experiments.

[0119] 2) Cell recovery and passaging: Pre-add 20 ml of DMEM medium to a 50 ml centrifuge tube. Remove the frozen cells from the liquid nitrogen tank and immediately thaw them in a 37°C water bath. Disinfect the outer wall of the cryotube with 70% alcohol. Transfer the cell storage solution to a centrifuge tube. Centrifuge at 100 rpm for 5 minutes, discard the supernatant, and resuspend the cells in DMEM medium supplemented with 10% fetal bovine serum. Incubate at 37°C in an incubator with 5% CO2 and saturated humidity.

[0120] 3) Cell Preparation: Digest HEK293T cells with 1 ml of trypsin for 1-2 minutes and resuspend in DMEM supplemented with 10% fetal bovine serum. Place the cell suspension in a 96-well plate and incubate in a 37°C, 5% CO2, saturated humidity incubator for 8-24 hours. Transfection can begin after the cells have fully adhered.

[0121] 4) Plasmid transfection: Take a sterile 1.5ml EP tube, add serum-free DMEM medium, thoroughly mix the target plasmid and lipofectamine 3000, and let it stand for 15-20 minutes. Add the mixture to the prepared cells and incubate in a 37°C incubator with 5% CO2.

[0122] Example 2: Anti-CD320 antibody kit for sample detection

[0123] The method for using the kit prepared in Example 1 for anti-CD320 antibody detection is as follows:

[0124] 1) Cell inoculation: HEK293T cells transfected with CD320 gene plasmid were cultured in a 96-well plate for 24 hours. When the plasmid transfection efficiency reached 60%-80% under a microscope, cells were used for subsequent testing.

[0125] 2) Cell Immunofluorescence: After washing the plasmid-inoculated plate with PBS, add goat serum for blocking and incubate at 37°C for 0.5 h. After discarding the goat serum, add anti-Flag tag primary antibody and incubate at 37°C for 1 h. After discarding the primary antibody and washing with PBS, add fluorescent secondary antibody and incubate at 37°C for 0.5 h. After discarding the secondary antibody, wash with PBS and photograph under a fluorescence microscope.

[0126] 3) The results showed that the method of the present invention can distinguish patients with strong CD320 positive cells from patients with negative cells without positive cells based on the interpretation of fluorescence intensity.

[0127] Example 3: Specific steps for fluorescence detection of anti-CD320 antibodies

[0128] Experimental materials and equipment:

[0129] Cells expressing the CD320 gene: HEK293T cells were transfected with the pIRES2-EGFP vector carrying the CD320 gene expression vector.

[0130] Secondary antibody: Fluorescently labeled goat anti-human IgG antibody using FITC (fluorescein isothiocyanate) as the fluorescent label.

[0131] Specimens: Patient serum or cerebrospinal fluid samples. Blocking buffer: Goat serum. Washing buffer: PBS. Fluorescence microscope: Leica DM6 B equipped with filters suitable for FITC excitation and emission wavelengths. 96-well plates: For cell culture and detection. Fluorescence intensity analysis software: ImageJ.

[0132] Experimental steps:

[0133] Sample processing: Collect serum or cerebrospinal fluid samples from patients and dilute them with diluent at a ratio of 1:10, 1:32, 1:100, or 1:320.

[0134] Inoculation of cells expressing the CD320 gene: HEK293T cells transfected with the CD320 gene plasmid were seeded into a 96-well plate and cultured until the transfection efficiency reached 60%-80%.

[0135] Blocking: Add blocking solution (such as goat serum) and incubate at 37°C for 30 minutes to reduce nonspecific binding.

[0136] Add the sample to be tested: After washing the cells, add the diluted sample to be tested and incubate at 37°C for 1 hour to allow the anti-CD320 antibody in the sample to bind to the CD320 protein on the cell surface.

[0137] Wash: Wash cells with PBS to remove unbound sample.

[0138] Add fluorescently labeled secondary antibody: Add fluorescently labeled goat anti-human IgG antibody and incubate at 37°C for 30 minutes to allow the secondary antibody to bind to the primary antibody (anti-CD320 antibody).

[0139] Second wash: Wash the cells again with PBS to remove unbound secondary antibody.

[0140] Fluorescence intensity analysis: Fluorescence signals were observed and recorded using a Leica DM6 B fluorescence microscope. Fluorescence signal intensity was quantified using ImageJ software and compared with a known standard curve to determine the presence and concentration of anti-CD320 antibodies.

[0141] Specific fluorescence measurement steps: Fluorescence microscope settings: excitation wavelength: 488 nm; emission wavelength: 515-545 nm; exposure time: 200 ms; gain: 1.0; magnification: 20x objective lens;

[0142] Image acquisition: Select an appropriate field of view and capture cell images using a fluorescence microscope. Ensure the image is clear and the fluorescence signal is obvious.

[0143] Quantify fluorescence signal: Open the acquired image using ImageJ software. Use the ROI tool to select the cell region. Select "Measure" in the Analyze menu to obtain the fluorescence intensity value.

[0144] Data Analysis: Compare the fluorescence intensity of the test sample with that of the negative control group and the positive control group. Analyze the relationship between fluorescence intensity and anti-CD320 antibody concentration.

[0145] Interpretation of results: If the fluorescence intensity of the test sample is higher than that of the negative control, it indicates the presence of anti-CD320 antibodies in the sample. Determine the concentration of anti-CD320 antibodies by comparing the fluorescence intensity with a known standard curve.

[0146] Thus far, the description of the above-described embodiments has been provided for the purpose of illustration and description. It is not intended to be exhaustive or to limit the present disclosure. The individual elements or features of a particular embodiment are generally not limited to the particular embodiment, but when applicable, they can be interchanged and used for selected embodiments even if not specifically shown or described. In many aspects, the same elements or features can also be changed. Such changes are not considered to depart from the present disclosure, and all such modifications are intended to be included within the scope of the present disclosure.

[0147] Example embodiments are provided so that the present disclosure will be thorough and will fully convey the scope to those skilled in the art. In order to thoroughly understand the embodiments of the present disclosure, numerous details are set forth, such as examples of specific parts, devices, and methods. It will be apparent to those skilled in the art that specific details need not be used, and the example embodiments may be implemented in many different forms, and neither should be construed as limiting the scope of the present disclosure. In certain example embodiments, well-known processes, well-known device structures, and well-known technologies are not described in detail.

[0148] Here, professional vocabulary is used only for the purpose of describing specific example embodiments and is not intended to be limiting. Unless the context clearly indicates otherwise, the singular forms "a" and "the" used herein may be intended to include the plural forms as well. The terms "including" and "having" are inclusive and therefore specify the presence of the claimed features, wholes, steps, operations, elements and / or components, but do not exclude the presence or additional presence of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof. Unless the order of execution is explicitly indicated, the method steps, processes and operations described herein are not to be interpreted as necessarily needing to be performed in the specific order discussed and shown. It should also be understood that additional or optional steps may be adopted.

Claims

1. A method for constructing a CMV-CD320-pIRES-EGFP gene vector plasmid in a fluorescence detection kit for detecting anti-CD320 antibodies, characterized in that: The kit includes cells expressing the CD320 gene and a second antibody; wherein the second antibody is an anti-human antibody; The CD320 antibody contained in the test sample is the first antibody, which is capable of antigen-antibody specific binding with the CD320 protein produced by cells expressing the CD320 gene in the detection kit. The first antibody is also capable of antigen-antibody specific binding with the second antibody in the kit. When the first antibody comes into contact with cells expressing the CD320 gene and the second antibody, fluorescence is generated or fluorescence is quenched. The method for preparing cells expressing the CD320 gene comprises the following steps: Construction of CD320 gene vector; Prepare 293T cells for transfection; Plasmid transfection into cells; The CD320 gene vector construction steps include: obtaining a fragment PCR product by PCR amplification, and recombining it into a target vector by a multi-segment recombination method to finally obtain a target plasmid; The construction of the CD320 gene vector further includes: a step of digesting the full-length sequence of the human CD320 gene and the vector with restriction endonucleases and then ligating the vector, wherein the restriction endonucleases are Xhol-BamHI; in the step of constructing a plasmid of the CD320 gene vector, the CD320 gene is obtained by PCR, and the sequences of the primer pairs used in the PCR method are: The base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1; The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2; The method for constructing the CMV-CD320-pIRES-EGFP gene vector plasmid includes the following steps: Step 1: Amplify the CD320 fragment by PCR; Step 2: Screen positive clones using the bacterial solution PCR method, obtain the positive bacterial solution by shaking at 37°C to extract the plasmid, sequence and compare the correct plasmid, and perform double enzyme digestion with Xhol-BamHI.

2. The method according to claim 1, wherein: The secondary antibody is goat, rat, mouse, donkey, horse, rabbit, dog or bovine anti-human antibody; The second antibody type is IgG, IgM, IgA, or IgG; The cells expressing the CD320 gene are cells transformed with a pIRES2-EGFP vector carrying the CD320 gene expression.

3. The method according to claim 2, wherein: The secondary antibody was goat anti-human antibody; the secondary antibody type was IgG.

4. The method according to claim 1, wherein the cells used for transfection are HEK293T, CHO, Hela, Human ES cells or MC3T3-E1; The plasmid transfection method is electric shock method, liposome-mediated method, virus-mediated method, microinjection method, calcium phosphate method or gene gun method; The liposomes used for transfection in the plasmid transfected cells are cationic liposomes; The plasmid transfection into cells includes adding plasmid and liposome.

5. The method according to claim 1, wherein the cells used for transfection are HEK293T cells that have been passaged and grown adherently; the plasmid transfection method is liposome-mediated; and the liposome used for transfection in the plasmid-transfected cells is lipofectamine 3000.

6. A method for obtaining HEK293T transfected cells containing a CD320 gene plasmid in a fluorescence detection kit for detecting anti-CD320 antibodies, characterized in that: The kit includes cells expressing the CD320 gene and a second antibody; wherein the second antibody is an anti-human antibody; The CD320 antibody contained in the test sample is the first antibody, which is capable of antigen-antibody specific binding with the CD320 protein produced by cells expressing the CD320 gene in the detection kit. The first antibody is also capable of antigen-antibody specific binding with the second antibody in the kit. When the first antibody comes into contact with cells expressing the CD320 gene and the second antibody, fluorescence is generated or fluorescence is quenched. The method for preparing cells expressing the CD320 gene comprises the following steps: Construction of CD320 gene vector; Prepare 293T cells for transfection; Plasmid transfection into cells; The CD320 gene vector construction steps include: obtaining a fragment PCR product by PCR amplification, and recombining it into a target vector by a multi-segment sufficient method to finally obtain a target plasmid; The construction of the CD320 gene vector further includes: the full-length sequence of the human CD320 gene and the vector are digested with restriction endonucleases and then connected, wherein the restriction endonucleases are Xhol-BamHI enzymes; in the step of constructing the CD320 gene vector plasmid, the CD320 gene is obtained by PCR, and the sequences of the primer pairs used in the PCR method are: The base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1; The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2; The method for obtaining HEK293T transfected cells with CD320 gene plasmid comprises the following steps: 1) Cell culture: HEK293T cells were routinely cultured in our laboratory in DMEM medium supplemented with 10% inactivated fetal bovine serum. Cells in the logarithmic growth phase were used for experiments. 2) Cell recovery and passaging: Pre-add 20 ml of DMEM medium to a 50 ml centrifuge tube. Remove the frozen cells from the liquid nitrogen tank and immediately thaw them in a 37°C water bath. Disinfect the outer wall of the cryotube with 70% alcohol, transfer the cell storage solution to a centrifuge tube, centrifuge at 100 rpm for 5 minutes, discard the supernatant, resuspend the cells in DMEM medium supplemented with 10% fetal bovine serum, and culture in an incubator at 37°C, 5% CO2, and saturated humidity. 3) Cell Preparation: Digest HEK293T cells with 1 ml of trypsin for 1-2 minutes and resuspend in DMEM medium supplemented with 10% fetal bovine serum. Place the cell suspension in a 96-well plate and incubate in a 37°C, 5% CO2, saturated humidity incubator for 8-24 hours. Transfection can begin after the cells have fully adhered. 4) Plasmid transfection: Take a sterile 1.5 ml EP tube, add serum-free DMEM medium, thoroughly mix the prepared plasmid and lipofectamine 3000, and let it stand for 15-20 minutes. Add the mixture to the prepared cells and incubate in a 37°C incubator containing 5% carbon dioxide.

7. Use of a fluorescent detection kit for detecting anti-CD320 antibodies in the preparation of a detection reagent for detecting central nervous system B12 deficiency; The kit includes cells expressing the CD320 gene and a second antibody; wherein the second antibody is an anti-human antibody; The CD320 antibody contained in the test sample is the first antibody, which is capable of antigen-antibody specific binding with the CD320 protein produced by cells expressing the CD320 gene in the detection kit. The first antibody is also capable of antigen-antibody specific binding with the second antibody in the kit. When the first antibody comes into contact with cells expressing the CD320 gene and the second antibody, fluorescence is generated or fluorescence is quenched. The method for preparing cells expressing the CD320 gene comprises the following steps: Construction of CD320 gene vector; Prepare 293T cells for transfection; Plasmid transfection into cells; The CD320 gene vector construction steps include: The fragment PCR product is amplified by PCR method, and recombined into the target vector through multiple sufficient methods to finally obtain the target plasmid; The construction of the CD320 gene vector further includes: the full-length sequence of the human CD320 gene and the vector are digested with restriction endonucleases and then connected, wherein the restriction endonucleases are Xhol-BamHI enzymes; in the step of constructing the CD320 gene vector plasmid, the CD320 gene is obtained by PCR, and the sequences of the primer pairs used in the PCR method are: The base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1; The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2; The application of the method in preparing a detection reagent for detecting whether a person has central nervous system B12 deficiency comprises the following steps: Step 1, sample processing: collect samples from patient serum or cerebrospinal fluid, and dilute them with diluent at a ratio of 1:10, 1:32, 1:100, or 1:320; Step 2, inoculating the cells expressing the CD320 gene; Step 3: Add blocking solution and incubate at 37°C for 30 minutes; Step 4: Add the sample to be tested and incubate at 37°C for 1 hour; Step 5: After washing, add the secondary antibody and incubate at 37°C for 30 minutes; Step 6: After washing, analyzing the fluorescence intensity generated by the detection cells and the test sample; Wherein: the sample in step 1 is serum or cerebrospinal fluid; The step 2 further comprises: digesting HEK293T cells with 1 ml of trypsin for 1-2 minutes, resuspending the HEK293T cells with DMEM medium containing 10% fetal bovine serum; placing the cell suspension in a 96-well plate, incubating the well plate in an incubator at 37° C., 5% carbon dioxide, and saturated humidity for 8-24 hours, and starting transfection after the cells are completely attached; culturing the HEK293T cells transfected with the CD320 gene plasmid in the 96-well plate for 24 hours, and observing under a microscope when the plasmid transfection rate reaches 60%-80%, for subsequent detection; The blocking solution is goat serum, bovine serum albumin or skimmed milk powder; Washing solutions used include PBS; The second antibody reacted in step 5 is a fluorescently labeled goat anti-human antibody; The step 6 further includes using negative and positive samples as controls and performing analysis based on the intensity of the fluorescence signal under a microscope.

Images