Anti-BCMACAR targeting immune-related disorders, compositions and methods thereof

Abstract

The present disclosure provides chimeric antigen receptor (CAR) molecules having specificity for B cell maturation antigen (BCMA), compositions and methods for treating immune-related disorders, in particular plasma cytopathy, such as multiple myeloma (MM).

Description

Technical Field

[0001] The present disclosure relates to immunotherapy. More specifically, the present disclosure relates to chimeric antigen receptor (CAR) molecules specific for B cell maturation antigen (BCMA), compositions for treating immune-related disorders, and methods thereof. Background Art

[0002] The following is a list of references believed to be relevant to the background art of the presently disclosed subject matter:

[0003] [1] Friedman KM, Garrett TE, Evans JW, et al. Effective targeting of multiple hematological malignancies expressing B cell maturation antigen by anti-B cell maturation antigen chimeric antigen receptor T cells. Hum. Gene Ther 2018;29:585-601.

[0004] [2] Carpenter RO, Evbuomwan MO, Pittaluga S, et al. B cell maturation antigen is a promising target for adoptive T cell therapy in multiple myeloma. Clin. Cancer Res 2013;19:2048-2060.

[0005] [3] Ali SA, Shi V, Maric I, et al. T cells expressing chimeric antigen receptor against B-cell maturation antigen lead to remission in multiple myeloma. Blood 2016;128:1688-1700.

[0006] [4] Brudno JN, Maric I, Hartman SD, et al. T cells genetically modified to express chimeric antigen receptors against B-cell maturation antigen lead to remission in patients with poor prognosis and relapsed multiple myeloma. JCO 2018;36:2267-2280.

[0007] [5] Raje N, Berdeja J, Lin Y, et al. Anti-BCMACAR T-cell therapy bb2121 for the treatment of relapsed or refractory multiple myeloma. N Engl J Med 2019;380:1726-1737.

[0008] [6] Cohen AD, Garfall AL, Stadtmauer EA, et al. B-cell maturation antigen-specific CAR T cells are clinically active in multiple myeloma. J Clin Invest 2019;129:2210-2221.

[0009] [7] Jiang S, Jin J, Hao S, et al. Low-dose human scFv-derived BCMA-targeted CAR-T cells achieve rapid responses and high complete remissions in patients with relapsed / refractory multiple myeloma. Blood 2018;132:960.

[0010] [8] Liu Y, Chen Z, Fang H, et al. BCMA-guided CAR-T therapy produces durable responses in relapsed or refractory multiple myeloma. Blood 2018;132:956.

[0011] [9] Mailankody S, Ghosh A, Staehr M, et al. Clinical responses and pharmacokinetics of MCARH171, a humanized Bcma-targeted CAR T-cell therapy, in relapsed / refractory multiple myeloma: final results of a phase I clinical trial. Blood 2018;132:959.

[0012]

[10] Munshi NC, Anderson LD, Jr., Shah N, et al. Idecabtagene vicicleucel in relapsed and refractory multiple myeloma. N. Engl. J. Med. 2021;384:705-716.

[0013]

[11] Eisenberg V, Hoogi S, Shamul A, Barliya T, Cohen CJ. T cells “ala CAR-T(e)” - genetically engineered T cells respond to cancer. Adv. Drug Deliv. Rev. 2019;141:23-40.

[0014]

[12] Kawalekar OU, O'Connor RS, Fraietta JA, et al. Distinct co-receptor signaling modulates specific metabolic pathways and influences CAR T cell memory development. Immunity. 2016;44:380-390.

[0015]

[13] Watanabe N, Bajgain P, Sukumaran S, et al. Fine-tuning the CAR spacer improves T cell potency. Oncoimmunology. 2016;5:e1253656.

[0016]

[14] Ying Z, Huang XF, Xiang X, et al. Safe and effective anti-CD19 CAR T-cell therapy. Nat. Med. 2019;25:947-953.

[0017] Acknowledgment herein of the above references should not be inferred as an intention that these references are in any way relevant to the patentability of the presently disclosed subject matter. Background Art

[0019] Multiple myeloma (MM) develops in the bone marrow through clonal expansion of malignant plasma cells and is associated with overproduction of monoclonal immunoglobulins in the blood and urine. Despite significant advances in the treatment of MM, the disease remains incurable and carries a poor prognosis in relapsed / refractory (R / R) patients. Therefore, there is a need to develop novel therapeutic approaches targeting multiple myeloma. Following the significant success of CD19-targeted CAR therapy for hematological malignancies and its FDA approval in 2017, new potential targets for CAR therapy are needed. In this regard, B cell maturation antigen (BCMA) is a cell surface protein belonging to the tumor necrosis factor receptor (TNFR) superfamily. After interacting with APRIL and BAFF, BCMA promotes B cell survival and proliferation. In addition to mature B lymphocytes and plasma cells, BCMA is highly expressed in most MM cases, making it an attractive target for CAR therapy [1].

[0020] Kochenderfer and colleagues tested anti-BCMACAR in a clinical trial using 0.3-3x10 6 The group of patients treated with CAR T cells / kg produced a 20% objective response rate [2]. 6 Cells / kg) achieved a high overall response rate (ORR) (81%) [3,4]. Several recent trials have demonstrated the potential of the anti-BCMA CART approach in promising phase I / II studies, achieving an ORR of 80% in heavily pretreated R / R multiple myeloma patients, with deep and durable responses [5-10]. Based on the impressive results of the phase II trial published in NEJM, the FDA and EMA approved Idecabtagene Vicleucel (Ide-cel or bb2121) for the treatment of R / R Mm patients. An additional CAR T cell product that showed very encouraging results is Ciltacabtagene autoleucel (Cilta-cel), which combines two anti-BCMA single heavy chain domains and a 4-1BB co-stimulatory domain. A few clinical trials using this construct have demonstrated an ORR greater than 80% without excessive toxicity in terms of cytokine release syndrome or neurotoxicity.

[0021] It is reasonable to speculate that the high doses of CAR T cells required to achieve responses

[10] and prevent relapse may be related to low affinity of the targeting moiety, poor antigen expression, lack of T cell persistence over time, and / or reduced CAR expression and stability

[11] . Therefore, CAR molecules may be modulated to enhance the function of engineered T cells.

[0022] CAR molecules consist of two basic parts: an extracellular binding domain and a signaling domain. The binding domain is usually composed of a single-chain fragment variable (scFv) targeting a designed antigen, while the signaling domain is usually composed of a co-stimulatory portion (CD28 and / or 4-1BB), which together with CD3 promotes T cell activation. In addition, the type of co-stimulation can greatly promote the persistence and metabolic activity of CART cells (such as shown in 4-1BB-based CARs), while CD28 promotes a more effective but short-lived response

[12] . The hinge domain and the transmembrane domain connect the two CAR parts, providing appropriate connection and flexibility of the CAR molecule, affecting CAR-T cell function, structural stability and expression. The choice of a specific hinge domain of CAR is usually selected based on the proximity of the target ligand to the cell membrane.

[0023] As key determinants of their function, the composition and structure of CARs are often optimized empirically. For example, studies by Zhang et al. showed that incorporating the transmembrane domain of CD8 or CD28 instead of the transmembrane domain of CD3 can lead to higher CAR surface expression. In another study, Smith et al. showed that the use of a longer hinge domain increased the potency and specificity of CARs. It was also shown how optimization of CAR design and co-stimulation can reduce activation-induced cell death (AICD) and lead to improved CAR expression over time. In addition to specificity, hinge composition can also affect tonic signaling and improve in vivo activity; studies have shown that modifications of IgG-based hinges improve in vivo activity and reduce tonic signaling effects mediated by the CH2CH3 domain located in the IgG hinge

[13] . It has also been recently shown that modifications of the CD8α hinge domain and TM domain lead to increased expression of anti-apoptotic molecules in CAR-T cells and reduced cytokine secretion while retaining cytotoxic function

[14] . A recent retrospective analysis of clinical studies based on anti-CD19 CAR-T further supports the view that the structural composition of the CAR domain (beyond the scFv and co-stimulatory moieties) influences clinical outcomes and associated toxicities. For example, it has been shown that CARs based on the CD28 hinge-TM exhibited higher clinical efficacy and severe cytotoxicity compared with CARs based on the CD8 hinge-TM.

[0024] Therefore, there is a need in the art to provide improved BCMA-CAR-T molecules that have empirically evaluated optimal configurations and exhibit increased specificity and high in vitro and long-term in vivo efficacy. The present specification addresses these needs. Summary of the invention

[0025] The first aspect of the present disclosure relates to a chimeric antigen receptor (CAR) molecule, which comprises the following components: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to B cell maturation antigen (BCMA); (ii) at least one hinge domain and at least one transmembrane domain derived from the differentiation 8 α (CD8 α) protein cluster (also known as the T cell surface glycoprotein CD8 α chain). It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO: 9, and any fragments, derivatives and variants thereof. The CAR molecule also comprises (iii) at least one intracellular T cell signal transduction domain. More specifically, the domain comprises at least one domain of a member of the tumor necrosis factor (TNF) receptor family, and optionally at least one domain of a T cell receptor (TCR) molecule. In some embodiments, the CAR T molecule of the present disclosure comprises an amino acid sequence as shown in any one of SEQ ID NO: 1 or any fragments and derivatives thereof, for example, the CAR T molecule comprises an amino acid sequence as shown in SEQ ID NO: 40.

[0026] Another aspect of the present disclosure relates to a nucleic acid molecule comprising at least one nucleic acid sequence encoding at least one CAR molecule, or any box, vector or vector comprising the nucleic acid molecule. In some embodiments, such encoded CAR molecules include the following components. First (i), at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds BCMA; second (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragment, derivative and variant thereof. The CAR molecule also includes at least one intracellular T cell signal transduction domain as a third component (iii). More specifically, the domain includes at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0027] Another aspect of the present disclosure relates to a gene editing system, the gene editing system comprising:

[0028] First (i), at least one nucleic acid molecule according to the present disclosure, or any box, vector or vehicle comprising the at least one nucleic acid molecule; and

[0029] Second (ii), at least one gene editing component or a nucleic acid sequence encoding the gene editing component. In some specific embodiments, at least one nucleic acid molecule of the gene editing system provided by the present disclosure encodes at least one CAR molecule, and the at least one CAR molecule comprises the following components: (i), at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds to BCMA; (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragments, derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain. More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0030] Another aspect of the present disclosure relates to genetically engineered cells of T cell lineages expressing at least one CAR molecule, or any cell population comprising the genetically modified cells disclosed herein. More specifically, in some embodiments, the CAR expressed by the engineered cells comprises the following components: first (i), at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds to BCMA; second (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragment, derivative, and variant thereof. The CAR molecule also comprises at least one intracellular T cell signal transduction domain as a third component (iii). More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0031] Another aspect of the present disclosure relates to a composition comprising at least one CAR molecule, any nucleic acid molecule comprising at least one nucleic acid sequence encoding the CAR molecule, or any box, vector, vector or gene editing system comprising the nucleic acid molecule, any host cell expressing the CAR molecule, and / or any genetically engineered cell expressing the T pedigree of the CAR or a cell population comprising at least one genetically engineered cell of the T pedigree. More specifically, such CAR molecules comprise the following components. First (i), at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds to BCMA; second (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragments, derivatives and variants thereof. The CAR molecule also comprises at least one intracellular T cell signaling domain as a third component (iii). More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0032] It should be noted that, according to an optional embodiment, the composition of the present disclosure further comprises at least one of a pharmaceutically acceptable carrier, a diluent, an excipient and an additive.

[0033] Another aspect of the present disclosure relates to a method for treating, preventing, ameliorating, inhibiting or delaying the onset of an immune-related disorder in a mammalian subject. In some embodiments, the method comprises the step of administering to the subject an effective amount of at least one of the following:

[0034] (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one box, vector vector or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell expressing the CAR (specifically, a cell of the T lineage), or such a cell population; and (d) a composition comprising at least one of (a), (b) and (c). More specifically, in some embodiments of the disclosed method, such CAR molecules include the following components. First (i), at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds to BCMA; second (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragments, derivatives and variants thereof. The CAR molecule also includes at least one intracellular T cell signaling domain as a third component (iii). More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0035] Another aspect of the present disclosure relates to an effective amount of at least one of the following:

[0036] (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one box, vector or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell expressing the CAR molecule, specifically, a cell of the T lineage, or a population of these cells; and (d) a composition comprising at least one of (a), (b) and (c); for use in a method for treating, preventing, improving, inhibiting or delaying the onset of an immune-related disorder in a mammalian subject. In some embodiments of the use discussed, such CAR molecules comprise the following components. First (i), at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; second (ii), at least one hinge domain and at least one transmembrane domain derived from a CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO: 9, and any fragments, derivatives and variants thereof. The CAR molecule also comprises at least one intracellular T cell signaling domain as a third component (iii). More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0037] In yet another aspect, the present disclosure provides a method for targeting activated T lineage cells against target cells expressing BCMA protein and / or tissues containing the target cells. More specifically, the method comprises the step of contacting the cells of the T lineage with an effective amount of at least one of the following items:

[0038] (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one box, vector vector or gene editing system comprising the nucleic acid molecule of (a); and (c) a composition comprising at least one of (a) and (b); more specifically, such CAR molecules include the following components. First (i), at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; second (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragments, derivatives and variants thereof. The CAR molecule also includes at least one intracellular T cell signaling domain as a third component (iii). More specifically, the domain includes at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0039] These and other aspects of the disclosure will become apparent from the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to better understand the subject matter disclosed herein and to illustrate how it may be implemented in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:

[0041] Figure 1A-1E Anti-BCMA-based characterization of chimerism

[0042] Fig. 1A. Schematic representation of different designs of anti-BCMA chimeric receptors described in the Materials and Methods section.

[0043] Figure 1B .As shown in the figure, human primary PBMCs activated by anti-CD3 were transduced with different anti-BCMA chimeric antigen receptors (CAR) or truncated CD34 (CD34t, control gene). These cells were stained with protein L or anti-CD34 antibodies, respectively. Transgenic expression was assessed by flow cytometry. The dotted line represents the staining of the analog transduction control. The percentage and mean fluorescence intensity (MFI) of positive cells are shown (in brackets). The figure represents the average of 4 different donors, and it was found that the staining difference between the population transduced with BCMA-CAR and the control population was statistically significant (p<0.05 was calculated using the student's paired t test).

[0044] Figure 1C .10 5 Transduced cells were plated in 96-well plates with 10 5 K562-BCMA or K562 cells (negative control) were co-cultured for 16 hours. Interferon gamma (IFNγ) secreted in the co-culture supernatant was measured by enzyme-linked immunosorbent assay (ELISA). These results are representative of 3 independent experiments.

[0045] Figure 1D The cell concentrations of BCMA-CAR T cells and control T cells were determined every 2 to 3 days for 3 weeks. These results are representative of 3 independent experiments using different donors (ICBB vs. H8BB / H828, P < 0.05; by two-way ANOVA).

[0046] Figure 1E Cell viability was assessed 3 weeks after transduction. BCMA-CAR T cells were stained with propidium iodide (PI) and analyzed by flow cytometry (ICBB vs H8BB / H828, p<0.001 by paired Student's t-test).

[0047] Figure 2A-2C . Anti-tumor function of BCMACAR-T cells

[0048] Figure 2A .OKT3-activated human primary B cell maturation antigen (PBMC) was transduced with retroviral vectors encoding ICBB-, H828-, H8BB- and truncated CD34 (CD34t control). As shown in the figure, transduced T cells were co-cultured with different tumor lines. Interferon gamma (IFNγ) secreted in the co-culture supernatant was measured by enzyme-linked immunosorbent assay (ELISA). These results are presented as mean + standard error of the mean (SEM) (n = 4, with 3 different donors; normalized to the activity of the positive control CARH828 against K562-BCMA, with an average secretion of 5928pg / ml). The difference between H8BB and H828 was found to be statistically significant (p = 0.00098; calculated using paired Student's t test).

[0049] Figure 2B-2C Similarly, these cells were co-cultured with the indicated target T cells, and secreted TNFα ( Figure 2B ) concentration and IL2( Figure 2C) concentration. These results are presented as mean + SEM (n = 3, with 3 different donors; normalized to the activity of the positive control CAR H828 against K562-BCMA, with an average secretion of 1453pg / ml of IL2 and 2990pg / ml of TNFα). The differences between H8BB and H828 were found to be statistically significant (IL2 p = 0.01, TNF-p = 3.7x10 -5 ; calculated using paired Student's t test).

[0050] Figure 3A-3C Phenotypic characteristics of BCMA-CAR-transduced T cells

[0051] Figure 3A .CD4 / CD8 ratios of different anti-BCMA chimeras. CAR-transduced T cells or control T cells were stained with anti-CD4 and CD8 antibodies and analyzed by flow cytometry on day 7. These results are representative of 4 independent experiments using different donors. No significant differences were observed between the different groups.

[0052] Figure 3B .Memory phenotype of T cells transduced with different BCMA chimeras. Three weeks after transduction, CAR-transduced T cells or control T cells were stained with anti-CD45RO antibody and CCR7 antibody and analyzed by flow cytometry. These results represent the average of 4 independent experiments using different donors (n=4).

[0053] Figure 3C (i)- Figure 3C (iv) Monitoring BCMA CART T cells in culture over time to deplete the marker PD-1 ( Figure 3C i) LAG-3 ( Figure 3C ii) TIM-3( Figure 3C iii) and TIGIT( Figure 3C iv) expression (as shown).

[0054] Figure 4A - Figure 4B. Profile of depletion and activation of BCMACAR T cells

[0055] Figure 4A (i)- Figure 4A (iv). BCMA-CAR-T cells were co-cultured at 37°C for 24 hours in the presence of H929-MM cell line or K562 overexpressing BCMA (K562-BCMA) or K562 cell line in T cell culture medium without IL-2 at an effector to target (E:T) ratio of 10:1. After incubation, cells were washed and stained with a mixture of fusion protein / antibody at 4°C for 20 minutes (as indicated), and PD-1 ( Figure 4Ai) LAG-3 ( Figure 4A ii) TIM-3( Figure 4A iii) and TIGIT( Figure 4A iv) expression. These results represent 3 different experiments using different donors. Data are expressed as mean and standard error of the mean (SEM).

[0056] Figure 4B(i)-Figure 4B(iii) CAR-transduced T cells or CD34 T cells were co-cultured with BCMA-positive targets as indicated. After overnight or 4 h co-culture (for CD69), the expression of CD25 (Figure 4B (i)), CD69 (Figure 4B (ii)), and 4-1BB (Figure 4B (iii)) in the cells was analyzed by flow cytometry. + The population was gated to detect 4-1BB and CD69 expression, and CAR+ cells were gated to detect CD25 expression. The average percentage of positive cells ± SEM is indicated on the histogram overlap. The gray filled histogram represents CAR-T cell staining, and the dotted histogram represents the staining of CD34t control cells. These results represent 3 independent experiments using 3 different donors.

[0057] Figure 5A-Figure 5C BCMA chimeras mediate antitumor cytotoxic activity in vitro and in vivo

[0058] Figure 5A (i)- Figure 5A (iii). T cells transduced with BCMACAR or CD34t (control) were co-cultured with CFSE-labeled tumor cells with indicated effector and target (E:T) ratios. After 4 hours, propidium iodide (PI) was added and cells were analyzed by flow cytometry. Cytotoxicity was calculated based on the ratio of CFSE+ / PI+ populations in the total CFSE+ population. These results are presented as the mean standard error (SEM) of the mean values ​​of 3 independent experiments using 3 different donors. Figure 5A (i) K562; Figure 5A (ii) RPMI-8226; and Figure 5A (iii) H929), and the difference between the BCMA-CAR and CD34t populations was found to be statistically significant (p<0.05, calculated using Student's paired t-test).

[0059] Figure 5B (i)- Figure 5B (v) In vivo function of BCMA-CAR T cells. NSG xenografts (n = 8 per group) were inoculated with H929 myeloma cells. One week after tumor inoculation, mice were intravenously injected with 15x10 6 BCMA-CAR+( Figure 5B (iii)ICBB, Figure 5B(iv) H828 or Figure 5B (v) H8BB), or CD34t-transduced control cells ( Figure 5B (ii)), or no treatment ( Figure 5B (i)). Tumor volume was measured in a blinded manner using a caliper and calculated using the following formula: (D × D 2 )×Π / 6, where D is the maximum tumor diameter and D is its perpendicular diameter.

[0060] Figure 5C Overall survival rate analysis showed that the differences in mean survival rates between the H828 group and the H8BB group and the untreated group or the control group were statistically significant (p < 1e -4 ; using log-rank analysis).

[0061] Figure 6A-6G .Anti-myeloma effect of H8BB CART cells: persistence of CAR+-T cells in mice NCI-H929 multiple myeloma tumor elimination association

[0062] Fig. 6A (i)- Fig. 6A (iv). Each treatment group had an average of approximately 200 mm 3 NSG mice bearing subcutaneous NCI-H929 tumors (4-5 animals per group) received 15x10 6 Non-transduced (NT) control cells ( Fig. 6A (i)) or 5 ( Fig. 6A (ii)), 10 ( Fig. 6A (iii)) or 15×10 6 indivual( Fig. 6A (iv)) Single intravenous (iv) administration of H8BB-CAR+T cells / mouse. Tumor size was measured twice a week with a caliper by personnel blinded to treatment conditions.

[0063] Figure 6B (i)- Figure 6B (iv) For 15x10 6 Non-transduced (NT) control cells ( Figure 6B (i)), or 5 ( Figure 6B (ii)), 10 ( Figure 6B (iii)) or 15×10 6 indivual( Figure 6B (iv) H8BB-CAR+T cells / mouse, serum B cell maturation antigen (BCMA) protein levels assessed by enzyme-linked immunosorbent assay (ELISA) (dashed line) are plotted with corresponding tumor volume measurements (black line). Error bars show standard error of the mean (SEM).

[0064] Figure 6C Monitoring myeloma development by bioluminescence imaging (BLI).2 Photons per steradian (p / s / cm 2 BLI measurements in units of 100 μg / sr) were converted to colors to indicate disease activity in mice as indicated in the legend. The weights of tumors excised from NSG xenografts in the NT group are indicated in the table to show that the reduction in BLI at this time was due to tumor necrosis rather than a reduction in tumor size.

[0065] Fig.6D The Kaplan-Meier survival curve of the study is shown in the figure ( Fig. 6A and Figure 6C ); * indicates that NSG mice were found dead on day 60 after tumor inoculation, without any obvious relationship with multiple myeloma.

[0066] Fig. 6E 25 μL of blood was collected from the tail vein, lysed with IOTEST 3 lysis buffer (Beckman Coulter) for 10 min, and stained with a mixture of fluorescent recombinant human B-cell maturation antigen (BCMA) protein, anti-CD3, anti-CD8, and anti-CD4. The percentage of H8BB CAR T cells in NSG blood (percentage of CD3+BCMA.CAR+ cells) was assessed by flow cytometry.

[0067] Fig. 6F Mean weight of tumors resected from NCI-H929 multiple myeloma (MM) xenografts on day 9 after T cell infusion. H8BB CAR T xenograft tumors are shown in the bottom panel; non-transduced (NT) xenograft control tumors are shown in the top panel.

[0068] Figure 6G On day 9 after H8BB CAR or NT T cell infusion, CD3+ T cell infiltration into tumor tissue was assessed by immunohistochemistry using anti-human CD3 antibody ( Fig. 6F Depicted in , upper panel). Marker bar represents 50-μm. Note: Figure 6A-6D and Figure 6E-6G Refers to experiments conducted in different groups of mice.

[0069] Figure 7A-7D .H8BB CAR T cells target plasma cells in multiple myeloma patients Fig. 7A B-cell maturation antigen (BCMA) expression was assessed by flow cytometry in bone marrow (BM) aspirates from patients with multiple myeloma (MM), amyloidosis (AL), monoclonal gammopathy of undetermined significance (MGUS), plasmacytoma (PC), and Walden-Ström's macroglobulinemia (WDS). ++ CD138 ++Median BCMA expression in patient bone marrow gated for plasma cells. n=3 (AL, circles), n=16 (MM, squares), n=3 (MGUS, upper triangles), n=3 (PC, lower triangles), n=2 (WDS, diamonds). Error bars show standard error of the mean (SEM).

[0070] Figure 7B Activation of CD3+ T cells was determined by evaluating the expression of CD137 (4-1BB) by flow cytometry. H8BBCAR T cells and non-transduced (NT) T cells were incubated overnight in the presence of bone marrow-derived mononuclear cells (BM-MCs). Statistical analysis was based on Student's paired t-test.

[0071] Figure 7C Mean fluorescence intensity (MFI) of BCMA expression on the targeted CD38++CD138++ plasma cell population of patients from P1 to P4 (p=0.01 by Student's t-test).

[0072] Fig.7D Evaluation of CD38 expression in MM patients by flow cytometry (P1 to P4) after co-culture with H8BB CAR T cells or NT control cells ++ CD138 ++ The presence of plasma cells.

[0073] Figure 8A-8C Animal models

[0074] Fig. 8A NSG mice (N = 5 animals per group) bearing approximately 100 mm3 subcutaneous NCI-H929 tumors received 7.5 × 10 6 Single intravenous (iv) administration of CAR+ T cells / mouse. Tumor size was measured twice a week with calipers by personnel blinded to treatment conditions.

[0075] Figure 8B .Kaplan-Meier survival curve study.

[0076] Figure 8C Myeloma development was monitored by bioluminescence imaging (BLI). BLI measurements in photons per second per cm2 per steradian (p / s / cm2 / sr) were converted into colors to indicate disease activity in mice as shown in the legend.

[0077] Fig. 9 .Schematic diagram of HBI0101 CAR construct

[0078] C11D5-3-CD8-41-BBZ encodes anti-BCMACAR. The BCMACAR sequence consists of the C11D5-3 anti-BCMA single chain variable fragment (scFv), the CD8α hinge and transmembrane regions, the cytoplasmic portion of the 4-1BB co-stimulatory molecule, and the CD3ζ T cell activation domain.

[0079] Fig.10 .HBI0101-Clinical Research Outline

[0080] Prior to enrollment, candidates were screened for eligibility. Lymphocytes were collected using the Sprectra Optia apheresis device on day 10 prior to infusion. Patients were then hospitalized for baseline assessments and HBI0101 production from fresh / frozen apheresis was started. On days -5 to -2, the patient's T cells were depleted with fludarabine and cyclophosphamide, and two days after the lymphodepletion "removal", the manufactured HBI0101 was infused (Day 0). After infusion, patients were hospitalized for two weeks for safety follow-up. Routine follow-up was performed at the indicated time points (1, 2, 4, 6, 9, 12, 15...60 months after HBI0101 infusion) for five years or until the patient discontinued the study.

[0081] Fig.11 "3+3" dose escalation study design

[0082] DLT, dose-limiting toxicity; MTD, maximum tolerated dose.

[0083] Figure 12A-12B .QC and sterility testing during the manufacturing process of HBI0101

[0084] Fig. 12A . HBI0101 culture samples were collected at the indicated time points for QC. Fig. 12B .HBI0101 culture samples were collected at the indicated time points for in-process sterility (IE) and end-of-process sterility (EOP) controls. Td, transduction, CPN, copy number.

[0085] Fig.13 .Spouse picture

[0086] Of the 22 patients enrolled and underwent leukapheresis, a total of 20 MM patients underwent lymphodepletion and were treated according to a "3+3" dose-escalation study design: Cohort 1 was administered with 150x10^6CAR+ cells (N=6), Cohort 2 used 450x10^6CAR+ (N=7), and Cohort 3 used 800x10^6CAR+ (N=7). DEX, dexamethasone; Rx, radiation.

[0087] Figure 14A-14B Objective responses in patients treated with HBI0101 CART cells

[0088] Fig.14AOverall response (OR) rate. The best response for each patient is shown, grouped by dose cohort (150-, 450-, and 800 x 10 6 CAR+ cells / dose). Disease response was determined according to the International Myeloma Working Group (IMWG)

[0089] Consensus criteria (Kumar S, et al. Lancet Oncol. 17(8): e328-e346 (2016)]. Minimal residual disease (MRD) was defined as 1x10 5 The number of MM plasma cells detected in the bone marrow per total nucleated cell. An MRD of 1x10^-5 or less was considered MRD negative.

[0090] Fig. 14B .Response to HBI0101 treatment. The best responding swimmer plots in individual MM patients are shown according to cell dose (150- to 800x10^6CAR+). Response assessment was performed according to IMWG criteria. Gray progressive disease (PD); light gray stable disease (SD); green-very good partial response (VGPR); light blue-strict complete response / MRD-positive complete response (sCR / CR(MRD+)); blue-strict complete remission / MRD-negative complete remission (sCR / CR(MRD-)).

[0091] Figures 15A-15D .Survival rate of R / R Mm patients administered HBI0101 CAR T cells

[0092] Fig.15A Kaplan-Meier analysis was performed for progression-free survival (PFS) of all patients.

[0093] Fig. 15B .Kaplan-Meier analysis of progression-free survival (PFS) by dose cohort.

[0094] Fig. 15C .Kaplan-Meier analysis of overall survival of all patients.

[0095] Fig.15D .Kaplan-Meier analysis of overall survival (OS) by dose cohort.

[0096] Figures 16A-16D .MM disease surveillance

[0097] Figure 16A-16C In Group 1 (N=6) ( Fig.16A )、Group 2 (N=6) ( Fig. 16B ) and Group 3 (N=6) ( Fig. 16C) were measured at designated time points before and after HBI0101 infusion. The normal range for kappa light chains: 6.7-22.4 mg / L, and the normal range for lambda light chains: 8.3-27 mg / L.

[0098] Fig.16D .Soluble BCMA (sBCMA) levels were measured by ELISA before and after CART infusion in the “responder” (blue squares) and “non-responder” (black dots) groups.

[0099] Figures 17A-17D Correlation between laboratory parameters and response to HBI0101

[0100] Fig.17A Shown are lactate dehydrogenase (LDH) levels assessed on day 14 after HBI0101 infusion.

[0101] Fig. 17B Shown are peak C-reactive protein (CRP) levels assessed on day 14 after HBI0101 infusion.

[0102] Fig. 17C Shown are fibrinogen levels assessed on day 14 after HBI0101 infusion.

[0103] Fig.17D Shown are ferritin ratios assessed on day 14 after HBI0101 infusion.

[0104] Bars represent median values.

[0105] Figure 18A-18E .Efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ malignant PCs

[0106] Fig.18A Arrows show the flow cytometry gating strategy used to assess BCMA and CD56 expression on MM-PCs.

[0107] Fig.18B The presence of PCs (as a percentage of CD38++CD138++ cells) in bone marrow samples was assessed by flow cytometry before and one month after HBI0101-CART infusion.

[0108] By gating on white blood cells (WBC), such as ( Fig.18A ) as shown.

[0109] Figure 18C-18E . The expression of BCMA and CD56 on MM-PCs was analyzed by “responder” (blue squares) versus “non-responder” (black dots) groups.

[0110] Figure 18C-Figure 18D .BCMA expression levels in multiple myeloma patients (N=12). Mean fluorescence intensity (MFI) was determined by flow cytometry ( Fig.18C) and the percentage of BCMA-positive PCs ( Fig.18D ).

[0111] Fig.18E . Percentage of CD56-positive PCs in the "responder" (N=9) and "non-responder" (N=3) groups. Samples were gated on CD38++CD138++ cells (e.g. Fig.18A )).

[0112] Figure 19A-19F Analysis of BCMA expression on MM-PCs: in vivo dynamics of the HBI0101 CART

[0113] Figure 19A-19B .Analysis of BCMA expression on MM-PCs. MM patients treated with HBI0101 were classified according to SD / PD (black dots, N=3), VGPR (green squares, N=3), and sCR / CR (blue circles, N=6) groups. The mean fluorescence intensity (MFI) was determined by flow cytometry ( Fig.19A ) and the percentage of BCMA-positive PCs ( Fig.19B ). Figures 19C-19F ) In vivo kinetics of HBI0101 CART in MM patients treated with HBI0101 and classified by SD / PD (dots, N=5), VGPR (squares, N=5), and sCR / CR (circles, N=10).

[0114] Fig.19C .In the SD / PD vs. VGPR and sCR / CR groups, the median number of HBI0101-CART cells per 1 mL of blood was determined by quantification of the CAR transgene level by qRT-PCR at the indicated time after CART infusion and further adjusted to the copy number of each transduced cell on the day of CART infusion. The quantitative limit (LOQ) was 500 CART / mL of blood.

[0115] Fig.19D .HBI0101 CART cells expanded overall in the first month of CART therapy. The area under the curve (AUC) was calculated using Prism software (GraphPad) as a measure of overall CART expansion.

[0116] Fig.19E .The median peak concentration (Cmax) of HBI0101 in cells in the SD / PD group (dots) versus the VGPR group (squares) and the sCR / CR group (triangles).

[0117] Fig.19F.Median time to reach Cmax (Tmax) in the SD / PD group vs. the VGPR group and the sCR / CR group. The upper and lower bars represent the maximum and minimum values, respectively. SD, stable disease; PD, progressive disease; VGPR, very good partial response; (s)CR, (strict) complete response. *p<0.05, **p<0.01, by unpaired t test.

[0118] Figures 20A-20F .sBCMA clearance and HBI0101 CART in vivo dynamics

[0119] Fig. 20A In the "response" and "no response" groups, the median number of HBI0101-CART cells per 1 mL of blood was determined by quantification of the CAR transgene level, which was performed by qRT-PCR at the indicated time after CART infusion and further adjusted to the copy number of each transduced cell on the day of CART infusion. The quantitative limit (LOQ) was 500 CART / mL blood.

[0120] Fig. 20B .HBI0101 CART cells expanded overall in the first month of CART therapy. The area under the curve (AUC) was calculated using Prism software (GraphPad) as a measure of overall CART expansion.

[0121] Fig. 20C . In vivo peak median concentration (Cmax) of HBI0101 cells in the "responding" (squares) vs. "non-responding" (dots) groups.

[0122] Fig.20D .Median time to reach Cmax (Tmax) in the "responder" (squares) vs. "non-responder" (dots) groups. Upper and lower bars represent maximum and minimum values, respectively.

[0123] Figure 20E-Figure 20F Soluble BCMA (sBCMA) levels were measured by ELISA before and after HBI0101 infusion and further normalized to sBCMA concentration at baseline (right y-axis; open circles), relative to HBI0101-cell expansion indicated by CART / mL (left y-axis; solid circles) in the “non-responder” group ( Fig.20E ), and in the Answer group ( Fig.20F ). **p<0.01, by unpaired t test.

[0124] Figure 21A-21B Dose cohort analysis of HBI0101 cell persistence and sBCMA levels

[0125] Fig.21A.Soluble BCMA (sBCMA) levels were measured by ELISA before and after CART infusion in different dose groups. The following are the figures: black circle, 150x106 CAR+; black square, 450x10 6 CAR+ and black triangle, 800x10 6 CAR+ cells. Statistical analysis was performed by two-way ANOVA.

[0126] Fig. 21B .HBI0101 in vivo dynamics according to HBI0101 dose. The number of HBI0101 CARTs per 1 mL of blood was determined by quantification of CAR transgene levels, which was performed by qRT-PCR at the indicated time after CART infusion and further adjusted to the CPN of HBI0101 cells before infusion. The quantitative limit (LOQ) was 500 CARTs / mL of blood.

[0127] Figure 22A-22C Comparison of cytokine profiles for predicting response to HBI0101 treatment

[0128] Fig.22A .Heat map analysis of 12 cytokines detected in serum samples of "responding" patients (N=15) and "non-responding" (N=5) patients at baseline (day 10) and Tmax after HBI0101 treatment. The rows represent the cytokines affected by HBI0101 treatment, and the columns represent the median values ​​of the cytokine values ​​of the "responding" group and the "non-responding" group, the patients "before" and "after" HBI0101 infusion. In the "responding" group, the cytokine values ​​on the Cmax day after CART infusion are used as reference values. Indicates the key color legend, where dark colors represent high cytokine values ​​and light colors represent low cytokine values. Table 6 lists the median and range values ​​of the cytokines represented in detail.

[0129] Fig. 22B (i)- Fig. 22B (vi)- Fig. 22C (i)- Fig. 22C (iii) Graphical representation of the significantly differentially expressed cytokines between the “responder” group and the “non-responder” group before and after HBI0101 infusion. More specifically, Fig. 22B : IL-10 (22B (i)), IL-1ra (22B (ii)), CCL4 (22B (iii)), IL-15 (22B (iv)), G-CSF (22B (v)) and IL-6 (22B (vi)), for Fig. 22C: IFN-γ (22C (i)), IL-2 (22C (ii)) and TNF-α (22C (iii)). The black line represents the median, and the upper and lower bars represent the maximum and minimum values, respectively. R, response; NR, no response. Statistical analysis was performed by two-way ANOVA.

[0130] Figure 23A-23D Effect of belantuzumab pretreatment on the response to HBI0101 therapy in MM patients Figure 23A-23B .Kaplan-Meier analysis of progression-free survival (PFS) of the "Belantuzumab (+)" vs. "Belantuzumab (-)" groups ( Fig.23A ) and overall survival (OS) (B).

[0131] Figure 23C-Figure 23D Effect of prior belantuzumab therapy on PC BCMA expression. Before HBI0101 infusion, the percentage of BM-PC expressing BCMA was determined by flow cytometry ( Fig.23C ) and percentage of BCMA expression MFI ( Fig.23D ) and were analyzed based on the patient's status prior to berantuzumab exposure. Samples were gated on CD38++CD138++ cells.

[0132] Figure 24A-24B .Major steps in the transition of HBI0101 CART-based therapies from bench to bedside

[0133] Fig.24A .POC, proof of concept; GMP, good manufacturing practice; IMPD, investigational medicinal product dossier; IB, inventor’s manual; JACIE, ISCT-Europe and EBMT Joint Accreditation Board; MOH, Ministry of Health; QA, quality assurance; QC, quality control. Fig. 24B A timeline showing the different phases.

[0134] Figure 25A-Figure 25D .HBI0101 Preclinical Evaluation

[0135] Fig.25A (i)- Fig.25A (ii) BCMA expression levels and preclinical evaluation of PC in patients with amyloidosis and multiple myeloma. BCMA expression levels in patients with AL (n=18) and multiple myeloma (n=39). BCMA expression percentage was determined by flow cytometry ( Fig.25A (i)) and MFI( Fig.25A (ii)). Samples were gated on CD38++CD138++ cells.

[0136] Fig.25BBone marrow (BM)-derived primary plasma cells (PCs) (gated on CD38++CD138++) were depleted from AL donors following overnight co-incubation with autologous HBI0101 CART cells (1:1 E:T ratio) compared to non-transduced (NT) cells.

[0137] Fig.25C (i)-(iii). HBI0101 CAR T activation after overnight co-incubation with BM-derived primary plasma cells (PCs) from AL1 and AL2, as shown by the percentage of CD137+(4-1BB+) cells (gated on CAR+ cells). Co-culture with autologous NT cells was used as a control. n=2, p<0.05( Fig.25C (i)). Fig.25C (ii)-(iii): Cytokines secreted by HBI0101CART or NT cells after co-incubation with BM-MNCs (P<0.05).

[0138] Fig.25D Apoptosis of MM- and AL3-CD138+ magnetically enriched cells was increased after 2 h of co-incubation with autologous HBI0101 CAR T cells compared to autologous NT control cells. Co-culture of CD138 cell fractions with autologous CAR T cells or NT cells served as controls. Apoptosis was assessed by flow cytometry measuring intracellular levels of cleaved caspase-3 in CD3-BCMA+ plasma cells.

[0139] Notably, the percentage of CD138+ cells before magnetic separation was 1.50% in multiple myeloma patients and 2.50% in AL patients and increased significantly after enrichment (50.9% and 86.5%, respectively; see Fig. 27 .

[0140] Fig.26 .Non-plasma cell viability

[0141] BM-MNCs from AL1 and AL2 were co-cultured with HBI0101 or non-transduced (NT) cells from AL1 for 1 hour (autologous vs. allogeneic setting). Non-plasma BM-MNC viability was assessed by flow cytometry using 7-AAD staining (bottom panel). Samples were analyzed by gating on CD38++CD138++ cells and CART cells as shown in the top panel.

[0142] Fig. 27 . Enrichment of plasma cells (PC) from AL- and MM-bone marrow aspirates

[0143] Bone marrow mononuclear cells (BM-MNCs) were isolated from fresh bone marrow samples of AL-patient 3 (upper panel) and MM-patient (lower panel) after Ficoll fractionation. TMCD138+ PCs were magnetically sorted using the Human CD138 Positive Selection Kit II. The percentage of PCs before and after CD138+ enrichment in the negative and positive fractions was determined by flow cytometry (samples were gated on CD38++Cd138++ cells).

[0144] Figure 28A-28C .HBI0101 Preclinical Evaluation

[0145] Fig.28A .4-1BB is upregulated in HBI0101 CART cells or NT cells after co-incubation with autologous CD138+ or CD138- cell fractions (gated on CAR+ cells). HBI0101 vs. NT, p<0.0001 HBI0101:CD138+ vs. HBI0101:CD138-, p<0.0001.

[0146] Figure 28B-Figure 28C .Cytokines secreted by HBI0101 CART cells or NT cells after co-incubation with autologous CD138+ or CD138- cell fractions (IFN-γ, TNF-α, respectively).

[0147] Figure 29A-29B .Specificity of BCMA CART (HBI0101) cells in targeting BCMA-expressing cells

[0148] Fig.29A .After 2 hours of co-incubation with HBI0101 cells, apoptosis of BCMA-expressing NCI-H929 myeloma cells was increased, but apoptosis of BCMA-negative K562 chronic myeloid leukemia (CML) cells was not increased. Target cells were not affected by non-transduced (NT) cells regardless of BCMA expression. Apoptosis was indicated as the percentage of cleaved caspase-3 cells (gated on H929 or K562 target cells).

[0149] Fig.29B .After overnight incubation with BCMA-expressing H929 myeloma cells, 4-1BB activation markers were upregulated on the surface of HBI0101 cells, but not after incubation with BCMA-negative K562 cells (p<0.0005). 4-1BB expression was barely detectable on the surface of NT cells, regardless of whether they were co-cultured with H929 or K562 target cells. The percentage of 4-1BB+ cells was determined by flow cytometry (samples were gated on CAR+ cells).

[0150] Figures 30A-30D Feasibility of producing HBI0101 CART from patients with AL amyloidosis

[0151] Fig. 30A Growth rate of HBI0101-transduced cells from AL patients during CART production. Drug product (DP) was generated from 4 leukapheresis patients. The production process for the four patients lasted 10 days. Peak cell growth was observed between day -7 and day -4.

[0152] Fig. 30B .Characteristics of the HBI0101 drug product (DP) on the day of infusion (Day 0). DP identity. The percentages of CD3+ cells, CD4+ cells, and CD8+ cells (gated on live CAR+ cells) were determined by flow cytometry. DP impurities. The percentages of "cellular impurities" for CD19+, CD14+, and CD3-CD56+ (gated on live cells) were determined by flow cytometry and did not exceed 1% per batch in all four batches. The percentage of BCMACAR+ cells (gated on live cells) was determined by flow cytometry using human recombinant BCMA protein. DP efficacy. The number of copies (CPN) of HBI0101 inserted into each transduced cell was quantified by qRT-PCR and further adjusted according to the transduced cells, as described in the Supplementary Materials and Methods section. Efficacy of the drug. The percentage of activated cytotoxic T cells (CD3+CD56+) was determined by flow cytometry (gated on CD4+ or CD8+ T cells). On day 2, IFN-γ secretion from each HBI0101 transduced cell was assessed by ELISA. After overnight incubation, IFN-γ was released into the co-culture supernatant of HBI0101 transduced cells and NCI-H929 (1:1 E:T ratio). The total amount of IFN-γ in each culture well was quantified and then divided by the number of transduced cells introduced into the well.

[0153] Fig. 30C (i)- Fig. 30C (ii). Flow cytometry (in CAR+ and CD4+ [ Fig. 30C (i)] or CD8+[ Fig. 30C (ii) [gated on T cells] The percentage of PD-1+, LAG-3+, and TIM-3+ cells was assessed, and a depletion profile of DP on the day of infusion (day 0) was established.

[0154] Fig.30D (i)- Fig.30D (ii) Flow cytometry (gating on CAR+ cells and CD4+ [ Fig.30D (i)] or CD8+[ Fig.30D (ii) [gated on T cells] The percentages of CD45RA+ / CCR7+ (untreated cells), CD45RA- / CCR7+ (central memory - CM), CD45RA- / CCR7- (effector memory - EM) and CD45RA+ / CCR7- (terminally differentiated effector memory - TEMRA) were assessed to establish the DP differentiation profile on the day of infusion.

[0155] Figure 31A-31G Clinical results of HBI0101CART-based therapy in the treatment of AL amyloidosis

[0156] Fig.31A The difference between involved (iFLC) and uninvolved FLC (dFLC) was evaluated in four AL patients at baseline and after HBI0101 CART infusion.

[0157] Fig.31B Non-involved FLC was assessed in 4 AL patients at baseline and after HBI0101 CART infusion on day 30. Normal range for kappa light chains: 6.7 mg / L-22.4 mg / L, and normal range for lambda light chains: 8.3 mg / L-27 mg / L.

[0158] Fig. 31C .Immunoglobulin levels were monitored over time before and after HBI0101 CART infusion. The marker # mentioned the intravenous Ig (IVIG) intake of patients 1 and 4 on day 26 after CART infusion.

[0159] Fig.31D . BCMA median expression (mean fluorescence intensity; MFI) in AL patient bone marrow-derived plasma cells (gated on CD38++CD138++ cells) was assessed by flow cytometry before HBI0101 CART infusion. Red dots indicate PCs (gated on CD38++CD138++ cells), whereas gray dots indicate non-PCs.

[0160] Fig.31E . Demonstrate the efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++AL primary plasma cells. The presence of plasma cells in bone marrow samples was assessed by flow cytometry (by gating on CD38++CD138++ cells) before and one month after HBI0101 CART infusion.

[0161] Fig.31F .( Fig.31E ) is a dot plot representation of the flow cytometry data for patient 4 depicted in ).

[0162] Figure 31G .Positron emission tomography–computed tomography (PET-CT) before and after HBI0101 CART treatment.

[0163] Figure 32A-Figure 32D .HBI0101 in vivo dynamics

[0164] Fig.32A The number of HBI0101 CART per 1 mL of blood was determined by quantification of the CAR transgene level by qRT-PCR at the indicated times after CART infusion and further adjusted to the transduction percentage on the day of CART infusion. The limit of quantification (LOQ) was 10 2CART / mL blood.

[0165] Fig.32B .In vivo proliferation rate of HBI0101 cells. The black line represents the median, and the upper and lower bars represent the maximum and minimum values, respectively.

[0166] Fig.32C . One month after CART infusion, HBI0101 CART / mL in the bone marrow fluid of AL patients (eg Fig.32A ) as described in detail in ).

[0167] Fig.32D The difference between involved and uninvolved FLC (dFLC) levels before and after CART infusion (right y-axis; solid circles) was compared with CART cell expansion indicated by CART / mL (left y-axis; open circles).

[0168] Fig.33 .HBI0101 and sBCMA in vivo dynamics

[0169] Serum BCMA (sBCMA) levels before and after CART infusion measured by ELISA (right y-axis; solid circles) were compared with CART cell expansion indicated by the expansion of CART cells in blood (left y-axis; open circles).

[0170] Figure 34A-Figure 34C .HBI0101 CAR T cell efficacy clinical results of HBI0101 (N=800x106 group) 29)

[0171] Fig.34A Overall response (OR) rate. The best response for each patient is shown, grouped by dose cohort (150-, 450-, and 800 x 10 6 CAR+ cells / dose). Disease response was determined according to the International Myeloma Working Group (IMWG) consensus criteria [Kumar S et al. Lancet Oncol. 17(8): e328-e346 (2016)]. Minimal residual disease (MRD) was defined as 1x10 5 The number of MM plasma cells detected in the bone marrow out of the total nucleated cells. 1x10 -5 An MRD of 1.4 or lower was considered MRD-negative.

[0172] Fig.34B .Kaplan-Meier analysis of progression-free survival (OS) by dose cohort.

[0173] Fig.34C .Kaplan-Meier analysis of overall survival (PFS) by dose cohort.

[0174] Example

[0175] Experimental Procedure

[0176] PBMCs and cell lines

[0177] Peripheral blood mononuclear cells (PBMCs) were from healthy donors obtained from the Israel Blood Bank (Sheba Medical Center, Tel-Hashomer, Israel), from an apheresis unit (IRB approval number 0458-19-HMO), or from blood of patients with plasma cell malignancies. Blood was collected from patients with plasma cell malignancies according to IRB approval number 0253-20-HMO.

[0178] Bone marrow (BM) was extracted from patients with plasma cell dyscrasia in accordance with the approval of the Ethics Committee of Hadassah Ein-Kerem Medical Center in Helsinki. BM-derived mononuclear cells were isolated by centrifugation in density gradient medium (lymphocyte separation medium, Lonza).

[0179] BCMA + The cell lines are RPMI8226 (ATCC / CCL-155), (NCI)-H929 (ATCC / CRL-9068) and MM1.S (ATCC / CRL-2974). K562 (ATCC / CCL-243) is an erythroleukemia cell line BCMA neg K562-BCMA was engineered to overexpress BCMA. All cell lines were cultured in RPMI medium (Invitrogen, Carlsbad, CA) containing 10% heat-inactivated fetal bovine serum (Biological Industries, Beth Haemek, Israel) and maintained in a 37°C and 5% CO2 incubator.

[0180] Lymphocytes were cultured in BioTarget medium (Biological Industries, Beth Haemek, Israel) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 1% L-glutamine, 1% penicillin / streptomycin, and 300 IU / ml IL-2 (Peprotech Asia, Israel) [Daniel-Meshulam I et al., Int J Cancer. 13(12): 2903-2913. (2013), Eisenberg V et al., Front Immunol. 8: 1212. (2017), Meril S et al., Mol Carcinog. 59(7): 713-723 (2020)].

[0181] Anti-BCMA chimeric receptor

[0182] Different chimeras ICBB, IC28 and H8BB ( Figure 1A ) were generated by overlapping polymerase chain reaction (PCR) based on heavy chains followed by light chains derived from the previously described C11D5.3 antibody [Carpenter RO et al., Clin. Cancer Res. 19(8): 2048-2060. (2013)]. ICBB and IC28 incorporate optimized short IgG4-derived spacers and streptococcal tags [Liu L et al., Nat. Biotechnol. 34: 430-434 (2016)], while H828 and H8BB incorporate CD8α-derived hinge domains and transmembrane (TM) domains. H828 CAR was a kind gift from Dr. Kochenderfer [Carpenter RO et al.] at NCI, NIH. Clin. Cancer Res. 19(8): 2048-2060. (2013)]. These chimeras were subcloned into the well-characterized retroviral vector backbone pMSGV1 (a kind gift from Dr. Steven Rosenberg at NCI). Retroviral transduction, co-culture, ELISA, and cytotoxicity assays were performed as previously described [Hoogi S et al. J. Immunother. Cancer. 7:243. (2019); Shamalov K et al., Oncoimmunology. 6:e1285990. (2017), Tal Y et al., Oncotarget. 5:10949-10958, (2014)].

[0183] Generation of clinical-grade HBI0101 retroviral library

[0184] PG13 HBI0101 was generated by transiently transfecting Phoenix-ECO cells (ATCC) with a plasmid encoding the γ-retroviral vector MSGV1-HBI0101 using JetPrime reagent (Tamar), and subsequently transducing PG13 cells (ATCC) with HBI0101-Phoenix-ECO cell-free vector supernatant. The PG13-transduced population was then subcloned by limiting dilution, and PG13-HBI0101 was expanded to generate a seed bank. The certified PG13 seed bank was sent to the Indiana University Vector Production Facility (IU-VPF) in Indianapolis, which has generated a master cell bank (MCB) and GMP-certified HBI0101 clinical-grade retroviral supernatant for transduction of autologous T cells of MM patients.

[0185] HBI0101 cell production

[0186] For in vitro studies:Peripheral blood mononuclear cells were isolated from the blood of patients with AL and / or multiple myeloma, and CD3-activated peripheral blood mononuclear cells were used for further production. Blood was collected from patients with AL or / and multiple myeloma (0253–20-HMO) and treated on a Ficoll gradient (lymphocyte separation medium, Lonza) to isolate peripheral blood mononuclear cells (PBMCs). PBMCs were suspended at a concentration of 1x10^6 cells per mL in T cell culture medium (TCM) containing AIM-V (Gibco) supplemented with 5% human serum (Valley), 1% glutamine (Gibco). IL2 (300 IU / mL; Proleukin, Novartis) and anti-CD3 monoclonal antibody OKT-3 (50 ng / mL; Miltenyi Biotech) were added to TCM and cultured for 2 days. Tissue culture untreated 24-well plates (R / N; Takara) were coated with 10 mg / mL RectroNectin in PBS (Lonza) overnight at 4°C, followed by blocking with 2.5% human albumin in PBS for 30 minutes and then washed. Retroviral supernatant was thawed, diluted 1:20 with TCM, added to the wells, and centrifuged at 2,000 g for 2 hours at 32°C. The supernatant was then aspirated and 0.5×10 6 CD3 activated PBMC / mL was inoculated into each well of TCM containing 300IU / mL IL2, centrifuged at 1,000g for 10 minutes, and incubated overnight at 37°C. Activated but untransduced (NT) cells were generated and used as T cell controls. On the 6th and 10th day of culture, BCMA CART cells were labeled with human recombinant BCMA protein via flow cytometry to determine transduction efficacy (activity; ACRO).

[0187] For clinical-grade production:

[0188] The production of HBI0101 cells was performed using the same protocol as described above for cell production for ex vivo applications. Modifications were made to the source of starting materials, the use of clinical-grade culture media and reagents, and production under GMP conditions to generate CART cells suitable for clinical use.

[0189] On the 10th day, leukocytes were collected by leukocyte removal using the Spectra Optia apheresis system and then transferred to the advanced cell therapy facility Hadassah (FACT-H). Cells were separated into peripheral mononuclear cells (PBMCS) and stimulated T cells (Figure 12) with anti-CD3 and IL-2. On the 8th day, the stimulated T cells were transduced overnight with the HBI0101 retroviral supernatant diluted 1 / 25 or 1 / 50. Then, cells were seeded into the GRex100 device filled with AIM-V culture medium (Gibco), which was supplemented with 5% human AB serum (Access Cell Culture or Valley), 1% glutamine (Gibco) and 300IU / mL IL-2 for seven days of expansion (Figure 12). Culture medium and IL-2 supplementation were performed every 2 to 3 days. On the day of patient infusion, cells were washed three times with saline containing 1% human albumin (Kedrion) and then reconstituted with saline containing 2.5% human albumin to a concentration of 15 x 10 6 CART cells / mL of final drug product (DP). DP infusion volume varies depending on cell dose.

[0190] Overview of QC and Sterility Testing for HBI0101 Production

[0191] Quality control testing of HBI0101 cells during in-process (IP) and end-product (EOP) was performed according to Fig. 12A The production process was carried out as detailed in , including: i) determination of the transduction percentage, assessed by flow cytometry using BCMA-FITC recombinant protein (ACROBiosystems), and performed on day 7, day 2, and day 0; ii) in vitro efficacy of CART cells, measured by ELISA (R&D) for interferon-γ release after stimulation of myeloma cell lines, and performed on day 2; iii) determination of vector copy number (CPN) by real-time (RT) PCR of genomic DNA of transduced cells on day 2; iv) confirmation of the absence of replication-competent retrovirus (RCR) on day 2 by PCR analysis of genomic DNA of transduced cells using the GALV primer set, as detailed in 3; v) characterization of different cell subpopulations was performed on day 0 by flow cytometry using the following antibody cocktail: anti-CD3 (Beckman Coulter), anti-CD4 (Biolegend), anti-CD8 (BD), anti-CD56 (Biolegend), anti-CD19 (Biolegend), and anti-CD14 (Beckman Coulter); vi) the pH of the DP was assessed on day 0. All test parameters represent the release standards for the final DP, the specifications of which are further detailed in Table 5.

[0192] In addition, and in accordance with Annex 1 Advanced Therapy Medicinal Products (ATMP) Guidelines, IP and EOP HBI0101 cells are Fig. 12B Sterility testing was performed according to the schedule detailed in . Sterility testing was performed by an outsourced GMP certified facility (HyLab).

[0193] In vivo testing of HBI0101 CART

[0194] Blood was collected from MM patients or AL patients at the indicated times before and after HBI0101 cell infusion. Genomic DNA was extracted and purified using the Qiagen QIAamp DNA blood mini kit. CAR copy number (CPN) was determined by quantitative real-time PCR using Taqman-based primers as follows: MSGV1 primers (forward: CGGCAGCCTACCAAGAACA, as shown in SEQ ID NO: 29; reverse primer: TGTGTCGCCGACTCGGTAA, as shown in SEQ ID NO: 30; probe: CGGTGGTACCTCACC, as shown in SEQ ID NO: 31), and TaqMan Fast advance Master Mix (Applied Biosystems). A standard curve of MSGV1 plasmid (ranging from 10 7 -10 0 The number of circulating CARTs in 1 mL of blood was then calculated by extrapolating the number of retroviral copies inserted into each CART cell carrier.

[0195] To determine the carrier CPN, on day 2, 20 × 10 6 DNA was extracted from amplified HBI0101-T cells for CART cell infusion (QIAamp DNA Blood Mini Kit). Unknown samples, no-template controls, and standards were performed in triplicate. The average MSGV1-HBI0101 vector CPN per transduced cell (CPN / Td) was calculated by normalizing to the endogenous number of diploid albumin copies and further adjusted to the percentage of transduction.

[0196] For amyloidosis studies, the MSGV1-based HBI0101 vector CPN was quantified using the Applied Biosystems StepOne Real-Time PCR System. The PCR reaction mixture contained 1X Taqman Fast advance MasterMix (Applied Biosystems), Taqman-based primer mix for MSGV1 insertion or albumin amplification, Taqman-labeled probes, and sterile nuclease-free water. MSGV1 primers / probes were as follows: forward: CGGCAGCCTACCAAGAACA, as shown in SEQ ID NO:29; reverse: TGTGTCGCCGACTCGGTAA, as shown in SEQ ID NO:30; probe: CGGTGGTACCTCACC, as shown in SEQ ID NO:31); albumin primers / probes were as follows: forward: GAGTCACCAAATGCTGCACAGA, as shown in SEQ ID NO:32; reverse: GAACGTATGTTTCATCG, as shown in SEQ ID NO:33; probe: ACAGGCGACCATGCT, as shown in SEQ ID NO:34. Unknown samples, no-template controls, and standards were run in triplicate. The average MSGV1-HBI0101 vector CPN per transduced cell (CPN / Td) was calculated by normalizing to the endogenous number of diploid albumin copies and further adjusted to the percentage of transduction.

[0197] Study Design and Patient Assessment in Amyloidosis Research

[0198] In early 2021, a Phase I clinical trial for the treatment of MM was launched and registered on clinical.gov.il (NCT04720313). This study aims to evaluate the safety and efficacy of HBI0101 in patients with MM and additional plasma cell dyscrasias (including AL). Enrolled patients must be refractory to at least three treatments including proteasome inhibitors, immunomodulators (IMiDs), and anti-CD38 antibodies and have no other available registered therapies. At the beginning of the study, all patients had progressive disease. The first part of the Phase I trial included 150-CAR+ cells, 450-CAR+ cells, and 800×10 6 Increasing cell doses of CAR+ cells were administered with HBI0101-transduced T cells. The patients reported in this article were all enrolled in different safety cohorts. Fig.10The full study protocol outlined in was approved by the Institutional Review Board (IRB) of Hadassah Medical Center and the Central Ethics Committee of the Israeli Ministry of Health. Written informed consent was obtained from each patient, and the study was conducted and approved under the auspices of the Hadassah IRB in accordance with the ethical guidelines of the Declaration of Helsinki. One patient received compassionate care for active malignancy (myelodysplastic syndrome) after obtaining informed consent and authorization from the IRB. This patient received 450x10 6 Cell therapy, because at the time of treatment, Group III (800x10 6 Adverse events were graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events (NCI CTCAE) version 4.03. Cytokine release syndrome was graded according to published criteria [Lee DW et al., Biol Blood Marrow Transplant 2019;25(4)].

[0199] Bone marrow immunophenotype

[0200] Bone marrow (BM) aspirates were collected from patients with multiple myeloma and / or AL before and one month after HBI0101 infusion. Bone marrow samples were labeled with α-hCD38 (A07778), α-HCD 138 (B37788; Beckman Coulter), and α-hBCMA (19F2; Biolegend) and further analyzed using a 10-color Navios flow cytometer (Beckman Coulter). Flow cytometric analysis was performed using KALUZA software. For amyloidosis studies, samples were lysed with IOTest 3 lysis solution x1 (Beckman Coulter); washed before performing flow cytometry.

[0201] Quantification of serum dFLC and serum soluble BCMA (sBCMA)

[0202] Levels of involved and uninvolved FLC were determined in patient sera (in both MM and AL studies) at the indicated time points (Siemens FLC assay).

[0203] Serum samples for serum BCMA (sBCMA) were diluted 1:1,000 and analyzed by sBCMA ELISA kit (R&D Systems). ELISA plates were analyzed with Gen5 3.05 software using a plate reader (Biotek Industries) set at 450 nm. Values ​​represent the average of replicates for each sample. Assay range: 15.6 pg / mL-2000 pg / mL; User-validated assay sensitivity: 8.28 pg / mL.

[0204] Multiplex analysis

[0205] Serum at baseline (day 10) and Tmax (the day of CART peak concentration (Cmax)) from MM patients treated with Luminex Performance Human XL Cytokine Magnetic Panel (25-Plex) FCSTM18-26 (R&D) was further evaluated by Luminex MAGPIX Instrument with x ponent 4.2. The multiplex panel included the following cytokines / chemokines: CCL2, CCL3, CCL4, CXCL10, IL-8, G-CSF, GM-CSF, IFN-α, IFN-γ, IL-10, IL-12, IL-13, IL-15, IL-17, IL-1b, IL-1ra, IL-2, IL-4, IL-5, IL-6, IL-7, CCL5, TNF-α, VEGF, and FGF. The accuracy and sensitivity data of these parameters are reported in the manufacturer's manual. Use Data were analyzed using Analyst 5.1 software. The concentrations of IFN-γ, TNF-α, and IL-2 were determined by ELISA (R&D).

[0206] T cell exhaustion / activation after antigen stimulation and at rest

[0207] To evaluate T cell exhaustion / activation after antigen stimulation, anti-BCMA chimeras were cultured in the presence of H929-MM cell line or BCMA-overexpressing K562 (K562-BCMA) or K562 cell line in T cell medium without IL-2 for 24 h. Co-cultures were performed in 96-well round-bottom plates. 0.05x10 6Co-cultures of CAR+ effector T cells were mixed with 0.05x10^6 target cells (E:T ratio of 10:1) in T cell culture medium without IL-2 and incubated at 37°C for 24 hours. After incubation, the cells were washed and stained with a mixture of the following fusion proteins / antibodies for 20 minutes at 4°C: BCMA-FITC (Acro), anti-CD3 (Beckman Coulter), anti-PD-1 (Beckman Coulter), anti-LAG-3 (eBioscience), anti-TIM-3 (eBioscience), anti-TIGIT (eBioscience) for evaluating T cell exhaustion, and stained with a mixture of the following fusion proteins / antibodies: BCMA-FITC (Acro), anti-CD137 (4-1BB) (Beckman Coulter), anti-CD69 (BD Pharmingen), anti-CD25 (Beckman Coulter) for evaluating T cell activation. The cells were washed twice with FACS buffer. Samples were collected on a Navios cell analyzer. Data were analyzed using Kaluza software. Cells were gated on BCMACAR+.

[0208] To assess T cell depletion / activation at rest, anti-BCMA chimeras were cultured in T cell medium supplemented with 300 IU / mL IL-2 for 12 days after transduction. Cells were stained every 2 to 4 days with the above T cell depletion and activation antibody cocktail in the absence of prior antigen stimulation.

[0209] Established tumor assay

[0210] NOD / SCID / Gamma mice aged approximately 6-12 weeks were injected subcutaneously with 4×10 50 μL of HBSS medium (Biological Industries, Beth Haemek, Israel) and 100 μL of Cultrex matrix (Trevigen, MD). 6 NCI H929 cells. After tumor inoculation, transduced lymphocytes resuspended in 200 μl HBSS medium were injected. Tumor size was measured blindly using calipers every 2 to 3 days or assessed by injection of luciferin solution (5 mg / ml, 200 μl / mouse, Promega) and bioluminescence imaging (BLI) evaluation. Animals were humanely euthanized if the tumor diameter exceeded 16 mm. All procedures were performed in accordance with the guidelines of the University Animal Welfare Committee.

[0211] T cell persistence in the blood of NSG mice

[0212] 25 μl of blood was collected from the tail vein of mice, lysed with IOTEST 3 lysis solution x1 (Beckman Coulter) for 10 minutes, and stained with a mixture of recombinant human BCMA protein (active) (FITC) (Abcam, ab246085), anti-CD3 (Beckman Coulter), anti-CD8 (BioLegend) and anti-CD4 (BioLegend), CD3+BCMA. CAR+ cells are referred to as "CAR T cells".

[0213] Immunohistochemistry

[0214] Four micrometer-thick formalin-fixed paraffin-embedded (FFPE) tumor sections were stained with anti-human CD3 antibody (103A-76, 1507011D, CellMarque, diluted 1:1000) on a BenchMark ULTRA autostainer (Ventana Medical Systems) with standard antigen retrieval (CC1 buffer, 40 minutes). Detection was performed using the ultraView Universal DAB Detection Kit (Ventana Medical Systems).

[0215] Co-culture of BM-MNCs and BCMA.CART cells

[0216] Bone marrow aspirates were obtained from patients with different types and stages of plasma cell dyscrasias according to the approval of the Ethics Committee of Hadassah Ein Kerem Medical Center in Helsinki. Bone marrow-derived mononuclear cells (BM-MNCs) were isolated by immediate centrifugation on density gradient medium (lymphocyte separation medium, Lonza) or overnight incubation at room temperature after BM aspiration. BM-MNCs were co-cultured with H8BB CART effector cells or control non-transduced (NT) T cells at 37°C overnight and then analyzed by flow cytometry.

[0217] In vitro PC elimination

[0218] BM mononuclear cells (BM-MNC) from primary BM samples separated by ficoll density gradient centrifugation were mixed with 1:1 CART:BM-MNC cells (10 5 Cells were co-cultured overnight at 37° C. Cells were labeled as above and evaluated by flow cytometry.

[0219] In vitro CD138 PC cytotoxicity

[0220] BM-MNCs were enriched in CD138 PCs using the EasySep Human CD138 Positive Selection Kit II (STEMCELL Technologies). BM-MNC, CD138 or CD 138-BM-MNC fractions were co-cultured with HBI0101 or NT effector cells in TCM at a 1:1 E:T ratio for 2 h (for caspase-3 killing assays) or overnight (for cytokine release assays and 4–1BB activation assays). Cell fractions were extracellularly labeled with hBCMA recombinant protein, a-CD3, and a-CD137 for T cell activation assays or with a-BCMA, a-CD3, and a-CD138, fixed, permeabilized, and intracellularly labeled with cleaved caspase-3 for cytotoxicity assays. Stained cells were analyzed by flow cytometry. Cell supernatants were collected and secretion of IFNγ and TNFα was quantified by ELISA (R&D) according to the manufacturer's instructions.

[0221] CD138 PC apoptosis

[0222] The cell fraction of the in vitro PC culture cell suspension was extracellularly labeled with anti-BCMA (Bio-Legend), anti-CD3 (Beckman Coulter) and anti-CD138 (Beckman Coulter) at 4°C for 20 minutes. The cells were then washed twice in PBS 2% FBS, fixed and permeabilized with Fix / Perm solution (BD), and then intracellularly stained with anti-active caspase-3 antibody (BD Pharmingen). The percentage of cleaved caspase-3 in CD3-BCMA gated cells was determined using flow cytometry.

[0223] Non-PC viability by 7AAD staining

[0224] BM-MNCs were co-cultured with HBI0101 or NT cells at an E:T ratio of 1:1 at 37°C in AIM-V (Gibco) supplemented with 5% human AB serum (Access Biological LLC) and 1% Glutamax (Gibco) for 1 hour. After incubation, cells were washed with PBS and stained with anti-CD38 and anti-CD138 (Beckman Coulter) for 20 minutes. 7-AAD (Tonbo Bioscience) (10-color Navios flow cytometer) was added 5 minutes before sample collection. Samples were gated on CD38-CD138- "not" CART. Samples were analyzed using Kaluza 2.1 software.

[0225] 4–1BB activation assay

[0226] HBI0101-transduced or NT T cells were co-cultured with BMMNCs, or with the CD138-positive fraction or CD138-negative fraction of BM-MNCs (1:1 E:T ratio) in U-bottom 96-well plates. After incubation at 37°C overnight, cells were stained with human BCMA recombinant protein (ACRO), anti-CD3 (Beckman Coulter), and anti-CD 137 (4–1BB; BioLegend) and then analyzed by flow cytometry. To assess the percentage of 4–1BB CAR cells, samples were gated on live CD3CAR cells, while NT cell samples were gated on live CD3 cells.

[0227] Clinical studies, inclusion and exclusion criteria

[0228] Inclusion criteria:

[0229] ≥18 years old; voluntarily signed informed consent (ICF); Eastern Cooperative Oncology Group (ECOG) performance status 0–2; diagnosed with MM with relapsed or refractory disease and have received at least 3 different prior therapies; including proteasome inhibitors, immunomodulatory therapies, and at least one antibody therapy.

[0230] Subjects must have measurable disease including at least one of the following criteria:

[0231] Serum M protein greater than or equal to 0.5 g / dL;

[0232] Urine M protein greater than or equal to 200 mg / 24 hours;

[0233] Serum free light chain (FLC) measurement: If the serum FLC ratio is abnormal, the affected FLC level is greater than or equal to 5 mg / dL (50 mg / L);

[0234] Biopsy-proven evaluable plasmacytoma;

[0235] Bone marrow plasma cells > 20% of total bone marrow cells;

[0236] Non-secreting patients will be allowed as long as they have measurable disease by PET-CT or bone marrow aspiration as specified.

[0237] Women of childbearing potential (WCBP) must have a negative serum pregnancy test prior to treatment. All sexually active WCBP and all sexually active male subjects must agree to use effective contraception throughout the study;

[0238] Any non-hematologic toxicity due to prior therapy has recovered to ≤ Grade 2 or baseline, excluding alopecia and Grade 3 neuropathy;

[0239] ·Able and willing to adhere to the study visit schedule and all protocol requirements.

[0240] Exclusion criteria:

[0241] Any systemic treatment for MM within 14 days before leukapheresis.

[0242] Long-acting growth factors or drugs used for cell mobilization within 14 days before leukapheresis.

[0243] Short-acting growth factors or drugs used for cell mobilization within 5 days before leukapheresis.

[0244] Therapeutic doses of steroids within 3 days prior to leukapheresis (physiologic replacement doses of steroids up to 12 mg / m2 / d of hydrocortisone or equivalent).

[0245] Any previous systemic treatment for MM within 14 days before the start of lymphodepletion.

[0246] · CNS-directed radiation within 8 weeks prior to lymphodepletion.

[0247] Long-acting growth factors or drugs used for cell mobilization within 14 days prior to lymphodepletion.

[0248] Short-acting growth factors or drugs used for cell mobilization within 3 days before lymphodepletion.

[0249] Investigational cellular therapy within 8 weeks of lymphodepletion.

[0250] Subjects with known severe central nervous system disease.

[0251] Liver dysfunction ALT>3 normal value.

[0252] Renal insufficiency CRCL <20.

[0253] International ratio (INR) or partial thromboplastin time (PTT) >1.5xULN, unless taking a stable dose of anticoagulant for a thromboembolic event that meets the exclusion criteria.

[0254] Insufficient bone marrow function, defined as an absolute neutrophil count (ANC) <1000 cells / mm3, a platelet count <30,000 mm3, or

[0255] Hemoglobin less than 8 g / dL (transfusions allowed), absolute lymphocyte count <500 cells / mm3.

[0256] Left ventricular ejection fraction < 40%.

[0257] ·Currently receiving chronic immunosuppressant therapy.

[0258] Active infection within 72 hours prior to lymphodepletion.

[0259] Previous history of allogeneic bone marrow transplant or any gene therapy-based cancer treatment.

[0260] Significant comorbid conditions or diseases that the inventors believe would impose an excessive risk to the subjects or interfere with the research.

[0261] ·Known human immunodeficiency virus (HIV) positive status.

[0262] Active hepatitis B or C infection (see acceptance criteria for HBV, HCV, and HIV).

[0263] Subjects with a history of stroke, unstable angina, myocardial infarction, or ventricular arrhythmia within 3 months, requiring medication or mechanical control.

[0264] Subjects with a second malignancy other than myeloma, if the second malignancy required treatment or was not in complete remission within the past 2 years; exceptions to this criterion include successfully treated non-metastatic basal cell or squamous cell skin cancer, or prostate cancer that did not require treatment.

[0265] Subjects with venous thromboembolism requiring anticoagulation and meeting any of the following criteria:

[0266] · Receiving stable dose of anticoagulation therapy for < 1 month (except for acute line insertion-induced thrombosis);

[0267] Grade 2, 3, or 4 bleeding within the past 30 days

[0268] Persistent symptoms from a venous thromboembolic event (e.g., persistent dyspnea or need for oxygen);

[0269] Pregnant or breastfeeding women.

[0270] Table 1. Patients’ previous treatment: exposure and refractory status

[0271]

[0272]

[0273] All data are presented as the number of patients and percentage of patients (number, %).

[0274] Statistical analysis

[0275] Statistical analysis was performed using GraphPad Prism (V9.1.0). Paired Student's t-test or two-way ANOVA test was used for normal data with equal variance unless otherwise stated. P < 0.05 was considered significant and marked with * in the figures. T cells from at least three different healthy donors were used for all in vitro and in vivo experiments. Kruskal-Wall analysis of mouse tumor volume was performed with Dunn's post hoc analysis. Analysis of variance or log-rank (Mantel-Cox) test was performed for survival data.

[0276] To compare the safety and short-term efficacy of different doses of HBI0101 (clinical trial NCT04720313), the planned sample size was 20 patients. Descriptive statistics were performed using the median of the range of continuous variables and counts and percentages for categorical variables. OS was defined as the time from randomization to death from any cause and was measured in the intention-to-treat setting. PFS was defined as the time from CART infusion to disease progression or death from any cause. OS and PFS were estimated using the Kaplan-Meier method. The overall response rate (ORR) was defined as the proportion of patients achieving a strict complete response (sCR), complete response (CR), very good partial response (VGPR), or partial response (PR). Descriptive statistics were performed using percentages. For the purpose of this Phase 1 data analysis, data were collected until February 3, 2022. Data were compiled using Excel software, and all statistical analyses were performed using GraphPad Prism (v9.2.0) software. Appropriate statistical methods were used.

[0277] Significance was calculated as described in the brief description of the figures (two-way ANOVA and paired or unpaired t-tests).

[0278] Example 1

[0279] Generation and preliminary evaluation of different anti-BCMACARs

[0280] Three second-generation anti-BCMA CARs were constructed based on the same scFv derived from the C11D5.3 antibody [2]. As co-stimulatory molecules, these CARs incorporate intracellular domains derived from 4-1BB (H8BB and ICBB) or CD28 (IC28) ( Figure 1A ). More specifically, H8BB includes a hinge domain and a transmembrane (TM) domain derived from CD8α, whereas these domains are replaced by an IgG4 hinge and CD28 TM in ICBB. IC28 shares the same hinge and CD28 TM domains as ICBB CAR, but its co-stimulatory domain is switched from 4-1BB to CD28 ( Figure 1A). As a reference, the present inventors used the previously described [2] and clinically tested [3] H828 CAR, which incorporates a CD8α-derived hinge-TM and CD28 as co-stimulatory domains.

[0281] Next, the functionality of the BCMA-specific CARs was evaluated. To this end, human PBMCs stimulated with anti-CD3 were transduced with these different CARs. Figure 1B As shown, BCMA CAR molecules are expressed at high levels, ranging from 66% of ICBB CAR to 81% of H8BB CAR. Then, to evaluate the basic function of BCMA CAR, overnight co-culture of CAR-transduced T cells with target cells (K562 vs. K562-BCMA) was performed, and IFNγ secretion was measured by ELISA. Figure 1C All four anti-BCMA CARs were able to mediate IFNγ release. These results confirm that different anti-BCMA CARs can be expressed on the surface of T cells ( Figure 1B ) and mediate anti-tumor functions in these cells ( Figure 1C However, although IC28 can induce cytokine release under certain stimuli, it has a poor performance in mediating cytokine release ( Figure 1C IC28 was not as effective as ICBB-, H8BB-, and H828 CARs in CD34t,ns), killing assays, and upregulation of activation markers upon antigen stimulation (data not shown). Figure 1C It is shown that when cultured in the presence of BCMA negative control cell line K562, H8BB CAR T cells secrete less IFNγ than corresponding ICBB CAR T cells (p < 0.05). Since the two chimeras share the same scFv and costimulatory domains, this observation may indicate that the hinge and TM portions incorporated into these CARs may affect their "off-target" specificity. In view of these preliminary data, and based on emerging studies [11,12] that demonstrate the costimulatory benefits of 4-1BB, the inventors therefore focus on 4-1BB-based CARs, namely ICBB and H8BB.

[0282] Example 2

[0283] Growth and viability of T cells transduced with different anti-BCMA chimeras

[0284] We next assessed the ability of the different anti-BCMACARs to promote T cell proliferation after several weeks in culture. To this end, the growth of T cells transduced with the different BCMACARs was monitored over 18 days of culture. Figure 1DIt is shown that, compared with H828-, H8BB- and CD34t-CAR T cells, ICBB CAR T cells show a slower expansion curve (ICBB to H8BB / H828 / CD34t, p<0.05). In addition, the proportion of dead cells was determined by staining transduced lymphocytes with propidium iodide (PI), thereby assessing the viability of BCMACAR T cells. Figure 1E The results showed that the majority of ICBB-transduced cells were PI-positive (61.4% ± 2.0), compared to a significantly reduced number of PI-positive cells detected in all other groups (5.3% to 9.1%; p < 0.0001). The data indicate that H8BB-transduced cells have a similar ability to expand in vitro over time as H828-transduced cells, while ICBB-transduced cells exhibit increased cell death ( Figure 1E ) and subsequent reduced amplification capacity ( Figure 1D ).

[0285] Example 3

[0286] BCMA-specific CAR secretes cytokines

[0287] After the initial assessment of CAR function, a more extensive cytokine secretion assay was performed by co-culturing BCMA-CAR transduced T cells with different plasma and MM cell lines. In general, BCMA-CAR T cells can specifically secrete high levels of cytokines (IFNγ, TNFα and IL-2), which are very important for anti-tumor immunity [Wilde S et al., J Immunol.189(2):598-605. (2012)], when compared with CD34t negative control CAR T cells (Figure 2; p<0.05). More precisely, when co-cultured with target RPMI8226, it was observed that the average secretion of IFNγδδ mediated by H8BB CAR was 6721pg / ml, ICBB CAR was 4520pg / ml and H828 CAR was 5055pg / ml. Similar results were observed when TNFα and IL-2 secretion was measured (e.g., using the RPMI-8226 target, IL-2 averaged 970 pg / ml for ICBB CAR, 1450 pg / ml for H8BBCAR, and 260 pg / ml for H828 CAR). The differences between H8BB and H828 were found to be statistically significant (p = 0.00098 for IFNγ, p = 0.01 for IL-2, and p = 3.7 x 10 for TNFα). -5 ; calculated using paired Student's t test). As previously described in this paper ( Figure 1B), it is noteworthy that H8BB- and H828-CAR T cells showed the lowest non-specific cytokine secretion in control co-cultures with antigen-negative targets (K562) or without any targets (Figure 2A2-C). This observation reinforces the idea that "off-target" (i.e., non-specific target) and tonic (i.e., without antigen stimulation) signaling may be affected by CAR configuration.

[0288] Example 4

[0289] Phenotypic analysis of BCMA-engineered CAR T cells

[0290] The inventors then sought to characterize the phenotype of BCMA-CAR T cells. The inventors focused on the CD4 / CD8 ratio and memory differentiation pattern. To this end, BCMA-CAR transduced T cells were sampled three weeks after PBMC activation and analyzed for marker expression by flow cytometry. Figure 3A As shown, no substantial differences were observed between the different CAR expression populations in terms of the CD4 / CD8 ratio, which was approximately 1:2. In addition, when the expression of the memory markers CD45RO and CCR7 were analyzed, 44 / 40% central memory (CM-CD45RO / CCR7) was observed in ICBB and H8BB-CAR T cells, respectively. + / CCR7 + ) and 33 / 39% effector memory (EM-CD45RO + / CCR7 - )T cells( Figure 3B ). However, H828-transduced T cells exhibited a higher proportion of effector memory T cells compared to 4-1BB-based CAR (57% vs. 36%; p=0.037) ( Figure 3B ). It is reported that CAR T cells exhibit a "less differentiated profile" (i.e., central memory cells), persist, and therefore perform better in vivo [Ren H et al., Front Immunol. 12: 745109. (2021)]. In addition, it has been reported that exhausted T cells may become progressively dysfunctional, and the loss of function is mediated by upregulation of inhibitory receptors such as programmed death receptor-1 (PD-1), lymphocyte activation gene-3 (LAG-3), T cell immunoglobulin-3 (TIM-3), and T cell immune receptor with Ig domain and ITIM domain (TIGIT) [Anderson AC et al., Immunity. 44 (5): 989-1004. (2016)]. Therefore, the expression of these exhaustion markers was monitored in different BCMA-CART cells over time. Figure 3C(i)-(iv) show that compared with 4-1BB-based CAR, the expression of PD-1( Figure 3C (i)), LAG-3( Figure 3C (ii))、TIM-3( Figure 3C (iii)) and TIGIT( Figure 3C (iv)) expression levels were significantly increased (p<0.001). It is noteworthy that H828-transduced T cells showed significantly high levels of exhaustion markers at very early stages of culture after transduction. This increase in basal expression of exhaustion markers may be mediated by tonic signaling enhanced by the CD28 co-stimulatory portion of the CAR, and importantly, may hinder the function of CAR T cells in vivo.

[0291] Example 5

[0292] Upregulation of activation markers and exhaustion profiles in anti-BCMA chimeras following antigen stimulation

[0293] To further investigate whether the high basal expression of exhaustion markers on the surface of H828-based CAR T cells affects their function and whether reduced expression levels of these markers can improve T cell function of 4-1BB-based CAR T cells, the expression of PD-1, LAG-3, TIM-3, and TIGIT on the surface of different BCMA CAR T cells was analyzed after overnight co-culture with BCMA-positive targets. Figure 4A (i)-4(iv) indicate that all four exhaustion markers are highly expressed on the surface of H828 CAR-T cells, even in the absence of target, as previously described. Figure 3C In contrast, 4-1BB-based CAR T cells upregulate PD-1 ( Figure 4A (i)), LAG-3( Figure 4A (ii)) and TIM-3( Figure 4A (iii)) and produce specific responses to different stimuli. The only exception is the inhibitory receptor TIGIT ( Figure 4A (iv)), it was found that it was substantially lower in 4-1BB-based CART cells compared with H828-CAR T cells, but did not respond to antigen stimulation. It is possible that this marker requires longer stimulation. Interestingly, the basal expression of TIM-3 in ICBB-CAR T cells was significantly higher than that in H8BB CAR T cells (p < 0.05). Given that TIM-3 expression can also be induced upon activation [Han G, Front Immunol.4: 449 (2013)], this observation may explain the nonspecific activity observed in cytokine release ( Figure 1C and Figure 2A-2B ).

[0294] Next, to test the hypothesis that high basal expression of exhaustion markers might impede CAR T cell function ( Figure 3C ), the inventors detected whether these CARs can mediate the upregulation of T cell activation markers upon antigen stimulation. After co-culture with BCMA-positive target cells overnight or 4 hours, the surface expression of activation markers of BCMA-CAR T cells was analyzed, including 4-1BB (ie, CD137), CD25, and CD69. As expected, the correlation between the activation state and exhaustion pattern of CAR T cells was found. In fact, Figure 4B ((iii)) indicates that H828-CAR T cells upregulate their 4-1BB molecules after stimulation with BCMA-expressing targets, but to a lesser extent than 4-1BB-based CAR T cells (H828 vs. ICBB and H8BB, p<0.05). Similar results were obtained when CD69 expression was measured after short-term co-culture (4 hours) of myeloma target cells (Figure 4B (ii)). CD25 expression (Fig. 4B (i)) shows that H828 CAR T cells are highly activated (H828 vs. H8BB, p < 0.001) compared to H8BB CAR T cells, even if they are not stimulated ("no target") or stimulated with BCMA-negative cells (K562). In addition, after stimulation with a specific target, H8BB CAR T cells significantly upregulated CD25 (p < 0.01), while ICBB CAR T cells and H828 CAR T cells did not respond significantly to antigen stimulation (Fig. 4B (i)). For example, CD25 expression levels were generally higher in H828-CAR T cells after coculture with BCMA-positive targets (62-65%) compared with H8BB-CAR T cells (52.9-58.6% - H828 vs H8BB, P < 0.001), but this expression level was not significantly increased compared with the results observed in unstimulated cells or when cocultured with BCMA-negative cells (59.3-60.8%). In addition, consistent with the increase in TIM-3 detected in ICBB CAR T cells ( Figure 3C and Figure 4A ), Figure 4B shows that when stimulated with nonspecific cell line K562, these cells express high levels of 4-1BB (p < 0.001). These results indicate that H8BB exhibits the lowest levels of depleted receptors and increased activation marker upregulation, which may be conducive to better specificity and long-term in vivo activity. Therefore, in the context of MM targeting, H8BB CAR appears to be a safer and more effective configuration.

[0295] Example 6

[0296] H8BB-CAR mediates improved in vitro cytotoxicity and in vivo bioactivity

[0297] To evaluate the hypothesis that the H8BB CAR is safe and effective in mediating tumor eradication, the cytotoxic activity of T cells transduced with different BCMACARs was next examined. To this end, tumor target cells were labeled with carboxyfluorescein succinimidyl ester (CFSE) and cocultured with BCMACAR- or CD34t control T cells for 4 h. Then, PI staining of CFSE-positive cells was analyzed as a surrogate for cytotoxic activity. Figure 5A As observed in , all CAR constructs mediated significant cytotoxicity against H929 and RPMI-8226 myeloma cell lines compared to CD34t control T cells (p<0.0001). In addition, 4-1BB-based CAR T cells exhibited significantly higher cytotoxicity against RPMI-8226 myeloma cells, even at the lowest ratio of 2.5:1 (ICBB or H8BB to CD34t, p<0.001). Similar results were obtained when H8BB CAR T cells were co-cultured with H929 ( Figure 5A (iii); H8BB vs. CD34t, p<0.05). In addition, H8BB CAR was more effective than H828CAR in mediating cytotoxicity against RPMI-8226, but not ICBB ( Figure 5A (ii) ); H8BB to H828 at both 5:1 and 10:1 ratios, p<0.05). As expected, CAR T cells did not show any significant cytotoxicity against the BCMA-negative cell line K562 when compared to corresponding control T cells ( Figure 5A (i)). These results suggest that H8BB CARs show superiority over H828 and ICBB CARs in mediating myeloma cell elimination in vitro, even at low E:T ratios. Since cytotoxicity is mediated via spatial recognition between CAR molecules on effector cells and cognate antigens on the surface of target cells, it can be speculated that the configuration of H8BB CARs on the surface of T cells is optimal for allowing BCMA recognition and inducing myeloma killing.

[0298] Finally, the in vivo function of BCMA-CAR was analyzed using xenograft models of human tumors. 6 Immunocompromised NSG mice were inoculated with NCI-H929 cells. Five days later, these mice were intravenously injected with BCMA-CAR or control T cells (CD34t-transduced T cells), or left untreated (“no treatment”). Tumor volume was assessed blindly every 2 to 3 days. Figure 5B Indicated, when compared with the control group (“no treatment”) and / or CD34t group (respectively Figure 5B (i), 5B(ii)) or ICBB group ( Figure 5B(iii)) compared with H8BB-CAR T cells or H828-CAR T cells (respectively Figure 5B (v), 5B (iv))-infused mice showed a significant delay and / or significant regression of tumor volume (H8BB vs. control, p < 0.0001, and H828 vs. control, p < 0.001). This observation was also reflected in the improvement of overall survival ( Figure 5C ; H8BB group and H828 group vs control group, p<0.0001; by log-rank analysis). In addition, the tumor volume of mice treated with H8BB CAR was found to be significantly reduced compared with the tumor volume of the H828 CAR-treated group (H8BB vs. H828, p<0.05 by Kruskal-Wallis test, and Dunn's Post Hoc analysis). Confusingly, ICBB CAR T cells did not show significant anti-tumor activity compared with the control group. Therefore, the inventors concluded that although ICBB CAR cannot mediate the eradication of myeloma in vivo, H8BB CAR was shown to be statistically more effective than H828 CAR in mediating significant anti-tumor cytotoxicity in vitro and in vivo. It is worth noting that among the 9 mice administered H8BB- or H828-CAR T cells, 4 mice in the H828 CAR group relapsed, and the tumor volume of the other two mice fluctuated, while only 2 mice in the H8BB group relapsed ( Figure 5B Although this data is not directly reflected in the median survival rate between the H8BB group and the H828 group ( Figure 5C ), but it suggests that in the long term, H8BB CAR T cells may persist longer than their H828 counterparts (i.e., less exhaustion, less nonspecific activation, less tonic signaling), thereby preventing relapse.

[0299] Example 7

[0300] Further evaluation of H8BB CAR T cells’ anti-tumor / off-target activities in vivo

[0301] Given the several advantages of the H8BB CAR over the other BCMACARs presented here (i.e., appropriate optimal cell growth ( Figure 1C ), anti-tumor cytokine production, and minimal nonspecific secretion ( Figure 2A-2C ), reduced depletion curve ( Figure 4A ), reduced tonic signaling and nonspecific activation ( Figure 4B ), and high antitumor cytotoxic activity in vitro and in vivo ( Figure 5A-Figure 5C), so all efforts have been focused on evaluating the potential therapeutic value of H8BB CAR targeting BCMA in the treatment of plasma cell malignancies. In this attempt, the inventors chose to study the anti-tumor function mediated by H8BB CAR T cells and aimed to determine the optimal effective dose of H8BB CAR T cells for infusion to obtain the desired therapeutic effect. To this end, another model was established in which NSG mice were injected with 4x10 6 In the experiment described in FIG6 , it was decided to subject the H8BB CAR T cells to a luciferase-expressing NCI-H929 myeloma cell line. Figure 5B-Figure 5C Only when tumors are well established (164 ± 30 mm 3 , approximately two weeks after myeloma inoculation), mice were infused with increasing doses of H8BB CAR T cells (5, 10, or 15 × 10 6 As shown in Figure 6, H8BB CAR T cells showed a strong anti-myeloma effect. Specifically, single injections of 10 or 15x10 6 The H8BB CAR T cell-treated mice group showed an initial increase in tumor volume, followed by rapid and complete tumor regression 2 to 3 weeks after infusion ( Fig. 6A (i)-6A(iv), Figure 6C ). In accepting 5x10 6 In the CAR T cell mouse group, 4 / 5 mice showed complete tumor regression except for one mouse that initially showed a higher tumor burden on the day of CAR T injection ( Fig. 6A , Figure 6C The survival curve is shown in Fig.6D These results indicate that the minimum effective dose range for the therapeutic effect of NCI-H929 is between 5 and 10 × 10 6 As for the control group (treated with NT T cells), all mice were sacrificed within one month after tumor inoculation for ethical reasons. At the same time, the concentration of soluble BCMA was evaluated in the serum of mice treated in this experiment as a biomarker for MM [Ghermezi m. Haematologica (2017); 102: 785-795] and as evidence of tumor eradication. Figure 6B (I)- Figure 6B As shown in (iv), after H8BB CAR T cell infusion, sBCMA levels rapidly decreased as tumors regressed. In addition, this data confirmed that high concentrations of sBCMA in the blood of NSG xenografts did not seem to block the anti-myeloma activity of H8BB CAR T cells in vivo.

[0302] To investigate the durability of H8BB CAR T-cell therapy in NSG myeloma xenografts, the presence of CAR T cells within the tumor and in the blood was assessed. Fig. 6E Figure 3 shows that H8BB CAR+ T cells were detected in the peripheral blood of myeloma NSG xenografts 3 days after T cell injection, increased significantly from 13 to 22 days after adoptive transfer, and then declined over the next 3 weeks. In a parallel group of NSG Mm xenografts, 7.5x10 6 Mice were treated with H8BB-CAR T cells or control (NT) T cells and sacrificed on day 9 after T cell administration (i.e., day 20 after tumor inoculation). Tumors were excised and weighed. Fig. 6F The mean weight of tumors from H8BB CAR T-treated mice was significantly lower than that of the NT control group (p=0.03). Immunohistochemical analysis of tumor sections for the human T cell marker CD3 showed that human T cells were abundantly present in H8BB sections ( Figure 6G , bottom panel). In contrast, tumor sections from the control NT mice group showed only sparse staining areas ( Figure 6G , above). Similar results are also shown in Figure 8A-8C Taken together, these data indicate that, following its infusion into the tail vein of NSG mice, H8BBCAR T actively proliferated and trafficked to tumor sites, where it exerted a strong antitumor effect, leading to tumor eradication.

[0303] Example 8

[0304] Anti-myeloma efficacy of H8BB CAR T cells against primary cells from multiple myeloma patients

[0305] As a preclinical evaluation of H8BB CAR T cells in myeloma patients, plasma cells from the bone marrow of patients with different plasma cell lesions (e.g., multiple myeloma-MM, amyloidosis-AL, monoclonal gammopathy of undetermined significance-MGUS, plasma cell neoplasm-PC, and Waldenstrom's macroglobulinemia-WDS) were evaluated for BCMA expression by flow cytometry. According to previously reported data [Bal S, Sigler A, Blood. 134 (Suppl 1): S5452 (2019)], plasma cells derived from the bone marrow of MM patients, AL patients, MGUS patients, PC patients, and WDS patients were observed to express BCMA in CD38 ++ CD138 ++ The differential median expression of BCMA in the 1000 cells / mL samples (gated on 400 cells / mL) was 3.8±3.8, 1.2±0.9, 1.3±0.4, 1.9±1.1, and 1.5±0.4 ( Fig. 7A). Although the mean fluorescence intensity (MFI) of BCMA in MM patients was significantly higher than that in other plasma cell diseases, the p value was not significant. In view of the efficacy of BCMA CART therapy described herein in multiple myeloma cell line xenograft models, the inventors attempted to study whether H8BB-CAR T cells are effective in targeting primary myeloma cell co-cultures. To this end, bone marrow-derived mononuclear cells (BM-MNCs) from MM patients were co-cultured with H8BB CAR T cells or NT (control) in an allogeneic system ( Figure 7B-7D ). Figure 7B It was shown that H8BB T cells significantly upregulated their 4-1BB expression compared with NT cells when co-cultured with BM-MCs of MM patients (p=0.027). Figure 1C Patient BM-MNC (CD38 + CD138 + Overnight co-incubation of BM-MNCs isolated from MM patients with H8BB CAR T cells resulted in almost complete elimination of plasma cells (gated on CD38++CD138++; Fig.7D , bottom panel). In contrast, plasma cells were not affected by the presence of control NT cells ( Fig.7D , above), demonstrating the specificity of BCMA-CAR targeting. In addition, the expression of CD137 (4-1BB), a T cell activation marker, was detected. In summary, these data confirm the potential efficacy of H8BB CAR T in the treatment of multiple myeloma.

[0306] Example 9

[0307] Clinical study in MM patients - evaluating the clinical applicability of the CAR T of the present invention

[0308] A clinical study was initiated in February 2021 to enroll patients with R / R malignant plasma cells to be treated with autologous H8BB-CAR T cells (NCT04720313) in a dose-escalation study to first evaluate the safety of this approach and then its efficacy.

[0309] Therefore, a non-randomized, open-label, single-center Phase 1 clinical study was conducted at the Bone Marrow Transplantation and Cancer Immunotherapy Department of Hadassah Medical Center (HMO) to evaluate the therapeutic applicability of the CAR T (H8BB, the CAR molecule of the present disclosure is also referred to as HBI0101 in all clinical trials) molecule of the present disclosure. Fig. 9 The structure of the HBI0101 / H8BB CAR molecule was made public. The complete study plan and design are detailed in Fig.10 and Fig.11 .

[0310] Subjects selected according to the exclusion and inclusion criteria specified in the experimental procedures underwent lymphocyte apheresis on day 10 before infusion to provide starting material for the preparation of CAR T cells. The collected cells were delivered to a GMP facility for further stimulation, transduction, and expansion ( Figure 12A-12B Prior to HBI0101 infusion, lymphodepletion of the patient was achieved by administering 25 mg / m2 of fludarabine and 250 mg / m2 of cyclophosphamide on days 5 to 3 ( Fig.10 ). Patients with creatinine clearance <30 ml / min received bendamustine at a dose of 90 mg / m2 on days 4 and 3. Fresh HBI0101 cells were administered in ascending doses of 150- (cohort 1), 450- (cohort 2), and 800x10^6 (cohort 3) CAR+ cells. After infusion, patients were hospitalized for at least 10 days as required by the protocol. During hospitalization, patients were followed up for adverse events (AEs) daily and followed Fig.10 Safety and efficacy will be followed up at a predetermined schedule as detailed in the .

[0311] Clinical monitoring of multiple myeloma

[0312] Response to HBI0101 was assessed at a predetermined schedule according to IMWG criteria [Kumar S et al. Lancet Oncol. 17(8): e328-e346 (2016)]. Bone marrow biopsy and computed tomography / positron emission tomography (PET / CT) were used to assess response in patients with non-secretory disease [Kumar S et al. Lancet Oncol. 17(8): e328-e346 (2016)]. Minimal residual disease was assessed by flow cytometry according to Euroflow criteria [Theunissen P et al. Blood. 129(3): 347-357. (2017)]. Patients were divided into “no response” and “response” as follows: “no response”; stable disease (SD) / progressive disease (PD) and “response” ≥ VGPR. Analysis of patient data grouped by PD / SD, VGPR, and CR is also provided.

[0313] Primary and Secondary End Points

[0314] The primary endpoints of the study were safety and determination of the maximum tolerated dose (MTD) of HBI0101. Hematological and non-hematological adverse events were graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events (NCI CT CAE) version 5.00. Cytokine release syndrome (CRS) and immune effector cell-associated neurotoxicity syndrome (ICANS) adverse events were graded according to the 2019 American Society for Transplantation and Cellular Therapy (ASTCT) criteria [Lee DW et al., Biol Blood Marrow Transplant. 2019; 25 (4): 625-638]. Secondary endpoints included: overall response rate (ORR), progression-free survival (PFS) and overall survival (OS).

[0315] There is a positive correlation between the BCMA expression level on the surface of BM-plasma cells in MM patients and the responsiveness to HBI0101 treatment ( Fig.19A and Fig.19B In addition, the pharmacokinetics of HBI0101 cells were evaluated at a series of time points in peripheral blood ( Fig.19C The levels of BCMA+ plasma cells in the bone marrow and circulating soluble BCMA in the peripheral blood were also assessed before and after treatment.

[0316] Furthermore, cytokine / chemokine secretion is assessed in the blood of the subject before and after infusion of the CART of the present invention.

[0317] Example 10

[0318] Patient and disease characteristics

[0319] From January 24, 2021 to December 23, 2021, 22 patients were screened, enrolled, and underwent leukapheresis. For three patients, the apheresis material was cryopreserved; two patients were discontinued before CART cell production (one patient achieved CR and one patient died) ( Fig.13 ). HBI0101 drug product (DP) was successfully produced and infused back into patients from both fresh (n=19) and cryopreserved (n=1) feedstock (no production failures occurred). Three patients received bridging therapy during production. Two patients received local radiotherapy for pain control, and one patient received high-dose dexamethasone and plasma exchange for hyperviscosity. The majority of patients (n=18) received lymphodepletion with fludarabine-cyclophosphamide, and two patients received bendamustine for renal impairment ( Fig.13All patients were infused with fresh DP 10 days after delivery. The median length of hospital stay after CART infusion was 17 days (range, 11–166 days), with most patients discharged after a maximum of 25 days, except for P2, who developed prolonged neutropenia and thrombocytopenia and remained hospitalized for 166 days.

[0320] The characteristics of the patients are detailed in Table 2. The median age was 62 years (range 44-75 years), the median time from the initial disease diagnosis was 55 months (range 8-241 months), and the median number of previous treatments was 6 (range 3-13). Most patients had previously received autologous bone marrow (BM) transplantation (85%), and all patients were insensitive to proteasome inhibitors (PIs), immunomodulators (IMiDs), anti-CD38 antibodies (daratumumab) and their last treatment regimen. Seven of the twenty patients (35%) were refractory to the five combinations. Nine patients (45%) were previously exposed to and refractory to the anti-BCMA binding antibody (belantamab mofortin) (Table 2). Table 1 presents a detailed description of previous treatment lines and refractoriness. Patients in cohort 1 had a higher incidence of extramedullary disease and pentavalent-refractory disease, higher LDH, and extensive BM involvement (defined as >50% plasma cells in BM biopsy), whereas patients in cohort 3 had a worse ECOG performance score and a lower incidence of cytogenetic high-risk disease (Table 2).

[0321] Table 2: Patient and disease characteristics

[0322]

[0323]

[0324] a Median (range) b number(%)

[0325] Abbreviations: ECOG-Eastern Cooperative Oncology Group, R-ISS-revised international staging system; * High-risk cytogenetic abnormalities include: del(17p), t(4;14), and t(14;16).

[0326] Embodiment 11

[0327] HBI0101 CART cell production

[0328] HBI0101 CART cells were produced locally by Hadassah Medical Center's Advanced Cell Therapy Good Manufacturing Practice (GMP) certified facility and were successfully used in all patients. The median lymphocyte count at the time of apheresis was 1.0x106 / mL (range 0.5-2.1), which had no effect on the successful production of CART cells. All final DPs were released according to the criteria specified in Table 3. No significant differences were observed in the production data or in vitro functionality of CART cells between the "responder" and "non-responder" groups (Table 3), which demonstrates the robustness of the production process despite the high variability of the starting material in MM patients.

[0329] Table 3. HBI0101 final product characteristics and release criteria

[0330]

[0331] The production process for all patients lasted for 10 days. The characteristics of HBI0101 drugs (DP) on the day of infusion (day 0) are as follows: DP identity. The percentages of CD3+ cells, CD4+ cells, and CD8+ cells (gated on live CAR+ cells) were determined by flow cytometry. DP efficacy. The percentage of BCMA CAR+ cells (gated on live cells) was determined by flow cytometry using human recombinant BCMA protein. The percentage of activated cytotoxic T cells (CD3+CD56+) was determined by flow cytometry (gated on CD4+ or CD8+T cells). On the second day, IFN-γ secretion of each HBI0101 transduced cell was assessed by ELISA. After overnight incubation, IFN-γ was released into the co-culture supernatant of HBI0101 transduced cells and NCI-H929 (1:1E:T ratio). The total amount of IFN-γ in each culture well was quantified and then divided by the number of transduced cells introduced into the well. The copy number (CPN) of HBI0101 inserted into each CAR transduced cell was quantified by qRT-PCR as described in Materials and Methods and further adjusted according to the transduced cells. Release standard specifications are described in the right column of the table. No statistical significance was observed in all released parameters, demonstrating the robustness of the production process. DP impurities. The percentage of "cellular impurities" for CD19+, CD14+ and CD3-CD56+ (gated on live cells) was determined by flow cytometry and did not exceed 1% each in all 20 batches. *ND, not determined. **fg, femtogram.

[0332] Example 12

[0333] Clinical Research-Safety Assessment

[0334] Hematotoxicity

[0335] All patients developed grade 3-4 neutropenia, of which two-thirds developed grade 3 febrile neutropenia (FN) (Table 4). The entire group had grade 3-4 lymphocytopenia, and about 60% had grade 3-4 thrombocytopenia and anemia. Compared with groups 1 and 2, the incidence of thrombocytopenia and FN was higher in group 3. The median duration of grade 3-4 neutropenia and grade 3-4 thrombocytopenia was 15 days (range 1-65) and 24 days (range 8-138), respectively (excluding 3 patients who progressed and died without count recovery). Less than one-third of patients had grade 3-4 cytopenias lasting more than 28 days after infusion of CART cells (Table 4).

[0336] Table 4: Adverse events and CART-related toxicities

[0337]

[0338]

[0339] Abbreviations: CRS - cytokine release syndrome, ICANS - immune cell-associated neurotoxicity

[0340] CRS and ICANS

[0341] 90% of patients experienced cytokine release syndrome (CRS) of any grade, mainly occurring on the day of CART infusion, with a median of 0 (range 0-21), a median duration of two days (range 1-5), and no one had grade 3 or above CRS (Table 5). However, compared with group 1, the incidence of CRS grade 2 in groups 3 and 2 was higher (3 / 7, 4 / 7, 1 / 6, respectively) (Table 5). 40% of patients used tocilizumab, with a median dose of 1 (range 1-4). There were no immune effector cell-related neurotoxicity syndrome (ICAN) events, and no one required glucocorticoids.

[0342] Table 5. CRS and ICAN associated with CAR T

[0343]

[0344] a Median (range) b Number of patients (range).

[0345] Non-hematologic toxicity

[0346] Non-hematologic toxicity was reported in 80% (n=16) of patients (Table 4). Bacteremia occurred in 15% of patients. Reported grade 3-4 toxicities were sepsis (n=3), elevated liver enzymes (n=2), atrial fibrillation (n=1), infectious gastroenteritis (n=1), pulmonary edema secondary to fluid overload and sepsis (n=2), all of which have resolved. One patient developed a grade 3 pulmonary embolism (PE) during remission 10 months after CART treatment. The patient developed pulmonary embolism due to immobilization after infection with Pseudomonas pneumonia and recovered after anticoagulation. During the subsequent follow-up period, 5 patients were re-hospitalized for observation due to COVID-19 infection 9 months after cell infusion (n = 1); pulmonary embolism, pneumonia, and atrial fibrillation, treated with anticoagulation, antibiotics, and cardioversion 8 months after cell infusion (n = 1); infectious gastroenteritis caused by Salmonella and adenovirus in the stool treated with antibiotics and fluids 27 days after cell infusion (n = 1); fever treated with broad-spectrum antibiotics and 2 doses of tocilizumab 21 days after cell infusion (n = 1); nausea, vomiting, and dyspnea resolved with fluid replacement and antiemetics 19 days after cell infusion (n = 1) (Table 4). No other serious adverse reactions (SAEs) were observed in any group. One patient died within 30 days after infusion due to disease progression. Deaths related to non-treatment.

[0347] Example 13

[0348] Short-term efficacy

[0349] At a median follow-up of 136 days (80, 182, and 160 days for cohorts 1, 2, and 3, respectively), the ORR for the entire cohort was 75%, with 50% (3 / 6), 85% (6 / 7), and 85% (6 / 7) of patients responding in cohorts 1, 2, and 3, respectively ( Fig.14A Ten patients achieved a (strict) complete response (sCR / CR), of which six achieved minimal residual disease (MRD) negativity (four in cohort 3); five patients achieved a very good partial response (VGPR) (four in cohort 2), of which two achieved MRD negativity ( Figure 14A-14B ). The best response was achieved one month after CART infusion in all patients, except for patients P7 and P11, who achieved VGPR at the first follow-up and further deepened their response to sCR / CR and VGPRMRD several months later, respectively ( Fig. 14B The median PFS for the entire cohort was 160 days (range, 14-326+); for cohorts 1, 2, and 3, it was 80 days (range, 23-248), 182 days (range, 33-326+), and not reached (range, 14-223+), respectively. Figure 15A-15B). The median OS was 308 days (range 25-466+), and as of the June 27 data cutoff, the estimated OS was 55%, with a median follow-up of 160 days (range 14-326) for all three groups. The median OS was 237 days (range 25-466+), 282 days (range 63-347+), and was not reached in groups 1, 2, and 3 ( Fig.15D ). All but one death (9 / 20, 45%) were attributed to disease progression. The death of P7 was related to COVID-19 infection. Figure 16A-16C (F3A-C#2) shows FLC levels before and after CART cell infusion in responders and non-responders. In addition, soluble BCMA (sBCMA) levels, a biomarker of anti-myeloma treatment responsiveness9,10,17-19, decreased rapidly in the serum of responders, while levels were barely affected in non-responders ( Fig.16D ). In addition, the median LDH level before lymphopenia tended to be higher in non-responding patients than in responding patients (p = 0.068). Within the first 14 days after CART infusion, no relative increase in peak CRP level, fibrinogen level, and ferritin level was found to be associated with response ( Figures 17A-17D ). No significant differences in CRS were observed between the "responder" and "non-responder" groups (data not shown).

[0350] Embodiment 14

[0351] Assessment and phenotypic characterization of bone marrow plasma cells (PCs)

[0352] To evaluate the patient's response to HBI0101 treatment at the cellular level, BM aspirates were analyzed by flow cytometry before (n=12) and one month after CART administration (n=11). Fig.18A Among these patients, three patients did not respond to HBI0101 treatment and showed only a slight decrease or even an increase in the percentage of BM-PCs ( Fig.18B In contrast, 9 responding patients showed a significant decrease in BM-PC percentage ( Fig.18B In addition, we found that patients in the “responder” group had significantly higher baseline BCMA expression percentage and mean fluorescence intensity (MFI) on the PC surface compared with patients in the “non-responder” group ( Figure 18C-Figure 18D and Figure 19A-19B Interestingly, CD56 was found to be significantly expressed on the PCs of HBI0101 responding patients ( Fig.18E ).

[0353] Embodiment 15

[0354] CART cell dynamics

[0355] After CART administration, the pharmacokinetics of HBI0101 cells were evaluated at a series of time points in the peripheral blood of MM patients. The median time of peak concentration (Cmax) of HBI0101 was day 10 (range, 6-13) in the "responder" group (sCR / CR (range, 6-13) and VGPR (range, 10-13)) and day 13 (range, 10-13) in the "non-responder" group ( Fig.20D and Fig.19F ), HBI0101 cell proliferation decreased rapidly within one month after CART infusion. As a measure of overall CART cell expansion within the first month after CART infusion, the area under the curve (AUC) was borderline significant between the two groups (p = 0.0597) ( Fig. 20B This difference was more pronounced when patients were categorized into SD / PD, VGPR, and sCR / CR subgroups ( Figure 19C-Figure 19D Consistent with this observation, Cmax values, a measure of maximum CART cell expansion, differed significantly between the two groups (60,655 HBI0101 cells / mL blood (range, 4,945-493,152) in the “responder” group and 3,740 HBI0101 cells / mL blood (range, 1,117-21,857) in the “non-responder” group ( Fig. 20C ). Fig.19E It is further indicated that the increased Cmax values ​​are associated with the depth of response of HBI0101. It is worth noting that, although significant differences in sBCMA levels were observed between cohort 1 and cohorts 2 and 3 (p<0.0004), no significant differences in HBI0101 cell dynamics in peripheral blood were found between these cohorts (Figure 21). Compared with the "non-responder" group, the decrease in sBCMA levels observed in the "responder" group was accompanied by the expansion of HBI0101CART in peripheral blood (Figure 22). Figure 20E-Figure 20F ), indicating that the decrease of sBCMA is associated with the anti-myeloma activity of HBI0101 CART cells, which leads to the eradication of PC and subsequent clearance of sBCMA.

[0356] Example 16

[0357] Cytokine profiling predicts response to HBI0101 treatment

[0358] To better understand and potentially predict patient responses to HBI0101 treatment, we next determined the cytokine “signatures” associated with the anti-myeloma function of HBI0101 CART cells in vivo. To this end, serum was collected from MM patients at baseline (day 10) and Tmax (the Cmax day for each patient), and

[0359] Cytokine secretion was analyzed by multiplex array. The multiplex panel included 25 pro-inflammatory and anti-inflammatory chemokines / cytokines. Among the 25 biomarkers analyzed, the differently expressed cytokines in different groups (baseline and Tmax) are depicted in the heat map representation ( Fig.22A Among them, the expressions of IL-1ra, IL-10, CCL4, IL-15, G-CSF and IL-6 were significantly different between the different groups (see Fig. 22B (i)- Fig. 22B More specifically, at Tmax, higher levels of IL-10, CCL4, and IL-15 were found in the "non-responder" group, while higher levels of G-CSF and IL-6 were found in the "responder" group ( Fig.22A and Table 6). At Tmax, IL-1ra was significantly upregulated in the "non-response" group, but not in the "response" group. Fig.22A As shown in Figure 2, another cytokine with a significant increase in Tmax in the "responder" vs. "non-responder" patient groups was IFN-γ. No statistical differences were observed in the levels of TNF-α or IL-2 between the two groups ( Fig. 22C (i)- Fig. 22C (iii)).

[0360] Table 6. Cytokine profiles of MM patients

[0361]

[0362]

[0363] Concentrations are in pg / mL. *Cytokines that were significantly differently expressed in different groups (see Figure 22B-Figure 22C ). Baseline cytokine concentrations were measured on day 10 before CART administration. max , the time when the CART cell concentration reaches its peak.

[0364] Embodiment 17

[0365] Effect of prior anti-BCMA antibody exposure on HBI0101 treatment

[0366] In this study, 9 / 20 patients (2 / 6 from Cohort 1, 5 / 7 from Cohort 2, and 2 / 7 from Cohort 3) received belantamab before HBI0101 treatment. Patients exposed to belantamab (“belantamab (+)”) tended to have shorter PFS and higher progression rate (7 / 9, 78%) compared with unexposed (“belantamab (-)”) patients (6 / 11, 55%) ( Fig.23A). In addition, the OS of patients receiving “Belantamab (+)” (3 / 9, 33%) was lower than that of patients receiving “Belantamab (-)” (8 / 11, 73%) ( Fig. 23B ). The ORR was higher in the “Belantazumab (-)” group compared with the “Belantazumab (+)” group (91% and 55%, respectively) ( Fig.23C ). Notably, when the inventors observed the "depth of response", they found that "Belanta (-)" patients achieved significantly deeper responses than "Belanta (+)" patients (sCR / CR, p=0.002; VGPR, p=0.02; by unpaired t-test). However, there were no significant differences in the BCMA expression levels on PCs (determined by MFI) and the percentage of BCMA-positive PCs between the two groups. Fig.23D and Fig.23E The expression of BCMA in patients is shown.

[0367] These results represent the complete CART product cycle: development of a new CART therapy, proof of concept in vitro and in vivo, regulatory approval, local production in a GMP facility, and delivery to patients ( Figure 24A-24B ). The main advantages of such approaches over commercial products are the availability of DP and shortened “vein-to-vein” delivery. Moreover, the significance of these results extends far beyond the clinical level. Affordable, locally produced CARTs represent a major step forward in expanding access to this cutting-edge advanced cell therapy.

[0368] Embodiment 18

[0369] BCMA expression in AL-MM-PC

[0370] Primary light-chain amyloidosis (AL) is a rare monoclonal plasma cell (PC) disorder characterized by systemic deposition of misfolded immunoglobulin light chain (LC) protein products as insoluble fibrils in multiple organs. Because AL is a disease of malignant PC origin, most available treatments are directed toward multiple myeloma. However, due to the broad clinical spectrum of organ failure in AL, the same treatment regimens can be extremely toxic in these patients (1-4), and multiple myeloma-directed clinical trials often exclude AL patients.

[0371] Herein, the present disclosure describes the in vitro applicability of the anti-BCMACAR constructs of the present disclosure on AL primary cells, as well as the safety and efficacy in four relapsed / refractory (RR) primary AL patients treated in the Phase I clinical trial (NCT04720313) described in Example 9 above.

[0372] As a preclinical evaluation of HBI0101-based CART therapy for MM and amyloidosis, the percentage of BCMA+ cells in the BM of MM patients and AL patients was evaluated, and the expression level of BCMA on AL- and MM-PCs was measured by flow cytometry ( Fig.25A (i)). Although BM samples from AL- and MM- patients showed similar percentages of BCMA+ cells, Fig.25A (ii) indicates that the mean fluorescence intensity (MFI) of BCMA on AL-PC is significantly lower (mean MFI of AL patients = 1.9, n = 18, MFI of MM patients = 3.8, n = 39 p < 0.05). However, based on the preclinical data of the MM clinical study disclosed above, the inventors showed that MM-PCs with an average MFI of BCMA expression of about 2.1 were eradicated after incubation with BCMA. CART cells, and consistent with a recent article on BCMA targeting in patients with AL amyloidosis [Oliver-Caldes A, 9 (12) (2021)], it is expected that this level will be sufficient to be recognized as PC by BCMA-CART cells and may represent a potential target for the treatment of AL.

[0373] Embodiment 19

[0374] In vitro evaluation of the efficacy of HBI0101 against primary AL-PC

[0375] The efficacy of HBI0101 CART against MM-PC in vitro was demonstrated in Examples 9-17 above. Encouraged by the results in MM patients, the inventors next tested whether HBI0101-based CART could also effectively eradicate AL primary PC. After co-culture with HBI0101 overnight, it was observed that HBI0101 almost completely eliminated AL-PC ( Fig.25B ), and this effect was already evident after one hour of co-culture ( Fig.26 ). In contrast, AL-PCs were not affected by non-transduced (NT) control cells, suggesting that HBI0101 cells are able to recognize AL-PCs and exert specific BCMA-directed anti-tumor functions. In this regard, non-tumor BM-MNCs were not affected by the presence of HBI0101, as indicated by 7AAD staining ( Fig.26 Moreover, HBI0101 cells underwent significant activation after incubation with ALBM-MNCs compared with NT cells, as evidenced by upregulation of 4-1BB markers and increased secretion levels of pro-inflammatory cytokines IFN-γ and TNF-α ( Fig.25C (i) Fig.25C (ii) Fig.25C(iii)) (p<0.05). Therefore, the inventors concluded that the anti-BCMA function mediated by HBI0101 is limited to CD38++CD138++ cells without affecting other BM cell populations.

[0376] To further confirm the observation that PC clearance by HBI0101 cells was apoptosis-mediated, the intracellular levels of cleaved caspase-3 were analyzed. Fig.25D It was demonstrated that apoptosis of AL- or MM-magnetically enriched CD138+ BM-PCs was significantly increased after incubation with HBI0101 cells but not NT cells ( Fig. 27 ). In addition, Figure 28 further shows that HBI0101 cell activation and proinflammatory cytokine secretion are specifically mediated by BCMA-CAR when stimulated with AL- or MM-CD138+ cells, because NT cells show significantly lower levels of 4-1BB ( Fig.28A ) and barely detectable levels of IFN-γ and TNF-α ( Figure 28A-28C ). Data demonstrating the specificity of HBI0101 for myeloma cells expressing BCMA are provided in Examples 9-17 above and also in Figure 29A-29B In summary, these data support proof-of-concept for the potential efficacy of HBI0101 CAR T in the treatment of AL.

[0377] Embodiment 20

[0378] Generation of HBI0101 CART cells and treatment of AL patients.

[0379] In view of the in vitro results and the clinical evaluation of HBI0101 in AL patients, the inventors produced autologous BCMA-CART cells (obtained by leukocyte separation) for patients 1-4. After 10 days of production, all four patients were injected with fresh BCMA-CART cells. Although CART manufacturing starts from different single collection sources, the process shows robustness, and the final drug (DP) meets the release criteria (Table 7). As shown in Figure 30, all four clinical batches have similar culture expansion patterns (Day 7 to Day 0) and DP characteristics. Fig. 30C (i)- Fig. 30C (ii) Fig.30D (i)- Fig.30D (ii) Depletion and differentiation status of DP on the day of release (day 0), respectively.

[0380] Table 7. Release test criteria

[0381]

[0382]

[0383] Competent retrovirus; GaLV: Gibbon ape leukemia virus

[0384] fg: femtogram (10 -15 g); PCR: polymerase chain reaction; RCR: replication-competent retrovirus.

[0385] Embodiment 21

[0386] AL patients treated with HBI0101

[0387] The study is designed to evaluate the safety and efficacy of HBI0101 in patients with multiple myeloma and additional plasma cell dyscrasias, including amyloidosis (AL). Enrolled patients must be refractory to at least three lines of therapy, including a proteasome inhibitor, an immunomodulatory agent (IMiD), and an anti-CD38 antibody, and have no other available registered therapies.

[0388] As described in Example 9, the Phase I clinical trial consists of three ascending cell doses. In this clinical trial (NCT04720313), three patients were treated in different safety groups, and the fourth patient was treated on a compassionate basis. Table 8 summarizes the baseline characteristics, medical history, and previous treatments of the patients. All patients were refractory to their last treatment regimen, three were quintuple refractory, and two were refractory to anti-BCMA belantamab mefadotin. All patients had progressive disease at the time of enrollment. No one received any bridging therapy. Fig.10 The full study protocol is further outlined.

[0389] Before patients are enrolled in the HBI0101 study, candidates are screened for eligibility. Lymphocytes are collected using the Sprectra Optia apheresis device on day 10 prior to infusion. Immediately thereafter, patients are hospitalized for baseline assessments, while HBI0101 production is started. Patients are then T-cell depleted with 25 mg / m2 fludarabine and 250 mg / m2 cyclophosphamide on days -5 to -2, and infused with manufactured HBI0101 on day 0, two days after the lymphodepletion "take-off." After infusion of HBI0101, hospitalization for two weeks for safety follow-up is mandatory. Follow-up continues until progression or death as routinely performed.

[0390] Table 8. Characteristics of patients at enrollment

[0391]

[0392] FLC: free light chain; BMPC: bone marrow plasma cell content; FISH: fluorescence in situ hybridization; NYHA: New York Heart Association; BNP: brain natriuretic peptide; Trop T: troponin T (high sensitivity); ALKP: alkaline phosphatase; PS: performance status; ASCT: autologous stem cell transplantation.

[0393] Patient 1: A 61-year-old male with MM and AL with cardiac, renal and autonomic involvement, previously treated with 8 prior lines of therapy. At the time of CART, clinical NYHA 3 was evident and MAYO stage 3A disease, with proBNP of 7500pg / ml. In April 2021, the patient was included in the first safety cohort of the trial and was infused with 150x10 6 HBI0101 cells. The patient did not experience CRS (Table 9) or worsening of his cardiac exhaustion and remained stable before discharge. No further adverse events (AEs) or organ decompensation were found after HBI0101 therapy. The patient remained hypogammaglobulinemic and developed grade 3 Pseudomonas pneumonia 8.5 months later, requiring hospitalization, which resolved later with antibiotic treatment.

[0394] Patient 2: A 59-year-old female with AL diagnosed in 2017, with cardiac, renal, and liver involvement. In July 2021, after six prior lines of treatment, the patient was enrolled in the second safety cohort and infused with 450x10 6 CART cells. During the infusion of CART, the patient suffered from NYHA grade 4 heart failure, and liver function tests worsened, alkaline phosphatase levels increased, and severe generalized edema before infusion was present, and the condition was stable after supportive treatment. After infusion, the patient developed a two-day grade 2 CRS (Table 9), which required a single dose of tocilizumab. The worsening of heart failure was significant before and during hospitalization, requiring high-dose diuretics, and the patient remained stable before discharge. After discharge, on day 45, the patient developed liver decompensation and ascites. There was no sign of hepatic or portal vein obstruction. Decompensation gradually disappeared, and the liver organs responded, with alkaline phosphatase decreasing and ascites eventually disappearing. At the same time, the patient developed a fever, which was shown to be secondary to spinal osteomyelitis, which eventually resolved and required long-term antibiotic treatment.

[0395] Patient 3: An 82-year-old male diagnosed with AL FLC K amyloidosis in 2006 with renal (3gr of proteinuria) and gastrointestinal involvement without cardiac involvement. After six lines of therapy, in November 2021, the patient was included in the third safety cohort and infused with 800x10 6 HBI0101 cells. The patient developed grade 3 CRS and required 3 doses of tocilizumab (Table 9). No renal failure was noted, and he remained stable before discharge, although a grade 3 infection was documented.

[0396] Patient 4: The last patient received compassionate care for myelodysplastic syndrome and low blood counts. A 61-year-old male was diagnosed with FLC L cardiac, autonomic, soft tissue, and renal AL in 2017. The last evaluation before CART infusion showed clinical NYHA stage 3, MAYO stage 3A disease with proBNP of 2773 pg / ml. After obtaining informed consent (the patient was fully aware of the risks of CART treatment for both diseases) and authorization from the ethics committee in December 2021, the patient received 450x10 6 infusion of HBI0101 cells. The patient developed a transient grade 3 CRS (Table 9) and required a single dose of tocilizumab. At the time of CRS, worsening heart failure was noted, but this was a response to tocilizumab and supportive care. No renal failure was found, and after 24 hours, patient 4 remained stable until discharge. Before treatment, the patient's blood cell count showed grade 1 neutropenia, grade 2 anemia, and grade 4 thrombocytopenia. After infusion of HBI0101, these symptoms worsened to grade 4 neutropenia, grade 3 anemia, and grade 4 thrombocytopenia. Although neutropenia and anemia returned to grade 2, grade 4 thrombocytopenia persisted. Repeat bone marrow biopsy 30 days after treatment showed severe cell reduction, which meant that CART toxicity was greater than MDS worsening.

[0397] No patient experienced immune effector cell neurotoxicity (ICAN) or any new treatment-related AEs, although one early infection (osteomyelitis) was observed 2 months after CART treatment and one late pneumonia was observed 8 months. All AEs were short and easily treatable. All patients presented with pan-hypogammaglobulinemia and received IVIG supplementation. It should be emphasized that although initial cardiac deterioration occurred during and after CART in patient 2 (before and after infusion) and patient 4, it was clinically controllable. Currently, the median follow-up time is 5.2 months (2.5-9.5), and all patients are alive. Table 9 summarizes the detailed AEs and CART-related toxicities.

[0398] Patient outcomes

[0399] As shown in Table 10 and Fig.31A As shown in Figure 2, all four patients achieved hematological CR with dFLC of 0-8 mg / L. In addition, the uninvolved FLC values ​​also decreased below the normal range compared with the corresponding values ​​before CART treatment ( Fig.31B). 30 days after HBI0101 infusion, both affected and unaffected FLC decreased, reflecting the powerful effect of HBI0101 on malignant and normal PC. About 30 days after HBI0101 treatment, BM MRD assessments of patients 1, 3, and 4 reached 10-5 negative. Although patient 2 was unable to undergo MRD testing at the time, the MRD assessed on day 180 after CART infusion showed MRD negative. The optimal response time ranged from 17 to 57 days. Despite the different HBI0101 infusion doses, no patient progressed and the duration of response in all patients was ongoing. Although the patients' follow-up time was short, the organ responses of all four patients were already significant. The proBNP levels of all heart disease patients were significantly reduced, and their NYHA status was clinically improved (Table 10). Although patient 2 initially experienced liver decompensation and cardiac dysfunction that lasted for three months, she recovered over time and showed responses of the liver and heart organs at six months, as shown by improved NYHA clinical stage and resolution of ascites. In fact, all patients with cardiac disease had an improvement in NYHA clinical stage, and the three patients with renal involvement had an improvement in peripheral edema, with a reduction in proteinuria. Although quality of life (QoL) questionnaires were not performed in this trial, it is clear that the improvement in clinical symptoms was significant and correlated with subjective QoL improvement. All four patients developed pan-hypogammaglobulinemia ( Fig. 31C ), and received IVIG supplementation. Fig.31D Figure 2 shows the expression level of BCMA on BM PCs of all patients before HBI0101 infusion. Figure 31E-Figure 31F Figure 3 shows a decrease in the percentage of BM PCs 30 days after HBI0101 infusion. In addition, PET-CT scans of patient 1 with MM 30 days after HBI0101 infusion showed a significant decrease in the size and intensity of most tumor sites compared to the lesions detected by PET-CT before CART infusion ( Figure 31G ). Table 10 summarizes the detailed efficacy results.

[0400] Table 9. Adverse events and CART-related toxicities

[0401]

[0402] *Starting from Level 4 due to MDS. **Duration for resolution to Level 2 or higher.

[0403] CRS: cytokine release syndrome; ICANS: immune effector cell neurotoxicity; CHF: congestive heart failure; GI: gastrointestinal.

[0404] Table 10. Efficacy results

[0405]

[0406] iFLC: involved free light chain; dFLC: delta free light chain; MRD: minimal residual disease; DOR: duration of response; BNP: brain natriuretic peptide. NYHA: New York Heart Association.

[0407] Embodiment 22

[0408] In vivo dynamics of HBI0101 CART

[0409] In vivo expansion of HBI0101 cells was observed in all four infused patients ( Fig.32A ). After CART infusion, the median time that CAR could be detected in peripheral blood by qPCR was 24±10 days, and T cells were still detectable in all 4 patients at 27±10 days. The peak growth rate of CART cells in peripheral blood was observed 6-10 days after CART infusion ( Fig.32B Despite receiving low and medium doses of CAR T cells (150- and 450 × 106), patients 1 and 4 showed the greatest in vivo CAR T cell expansion ( Fig.32A In contrast, patients 2 and 3 who received medium and high doses of CART cells (450 and 800 × 106, respectively) showed lower in vivo expansion ( Fig.32A In line with this observation, higher numbers of CART cells were detected in the bone marrow of patients 1 and 4 one month after CART cell infusion, whereas almost no CART cells were detected in patients 2 and 3 ( Fig.32C ). In addition, the dynamics of dFLC levels in the serum of all four AL patients were analyzed before and after CART cell infusion, and a significant decrease was observed in the first month of treatment. The reduction in dFLC levels was accompanied by the expansion of CART in peripheral blood ( Fig.32D ). A similar trend was observed with measurement of serum BCMA (sBCMA) levels, another biomarker for MM and AL monitoring [Ali SA et al. Blood. 128:1688–700. (2016), Munshi NC et al. N Engl J Med; 384:705–16., Raje N et al. N Engl J Med 2019; 380:1726-37. (2019)]( Fig.33 Collectively, these data indicate that reductions in dFLC and sBCMA serum levels correlate with successful expansion of HBI0101 in vivo.

[0410] Embodiment 23

[0411] Follow-up of clinical trial NCT04720313

[0412] The inventors conducted an additional follow-up of the Phase Ia / b study (NCT04720313) to explore the effect of 150-800×10 6 Safety and efficacy at escalating doses across the range of CAR+ cells. The median follow-up (mFU) was 146 days (range, 18-314 days), with median progression-free survival (mPFS) and overall survival (mOS) not yet reached at the higher dose of 800x10^6CAR+| cells. The overall response rate for all groups was 83%, with 800x10^6 cells being the highest in the study. 6 The response rate of the group was 90% ( Fig.34A ). 800x10 6 The OS% of the group ( Fig.34B ) and PFS%( Fig.34C ) are significantly better than other previously reported prior art groups.

[0413] No immune effector cell-associated neurotoxicity syndrome (ICANS) events were recorded. Although 90% (38 / 42) of MM patients and 80% (4 / 5) of AL patients experienced varying degrees of CRS, they were clinically controllable. The vast majority of CRS events began on the day of infusion. The median duration of CRS was 2 days (range 1-7) in MM patients and 4 days (range 1-5) in AL patients. In ≥ grade 2 CRS events, a median dose of toximab was required (range 1-4). 2 / 42 MM and 1 / 5 AL patients required steroids, while 1 / 42 MM and 3 / 5 AL patients required vasopressors. 23 / 42 MM patients experienced grade 3-4 thrombocytopenia, 25 / 42 patients experienced anemia, 42 / 42 patients experienced neutropenia and lymphopenia, and 27 / 42 MM patients experienced febrile neutropenia. Hypoglobulinemia persisting for more than 28 days occurred in 30 / 42 patients with MM and 3 / 5 patients with AL.

[0414] In general, 800x10 6 The doses showed significantly improved results, particularly increased efficacy, without affecting toxicity. It is noteworthy that higher doses of HBI0101 are tolerable due to the clinically proven safety profile, and thus explain the significantly improved efficacy of HBI0101. Based on the data provided here, it is clear that H8BB CAR T cell-based therapies provide significant value for the treatment of MM and other plasma cell-related pathologies. DETAILED DESCRIPTION

[0415] The CAR T cell strategy is revolutionizing the treatment of CD19+ lymphomas. Applying this approach to other hematological malignancies, such as multiple myeloma, requires the identification and design of suitable chimeric receptors that target specific antigens. Herein, the present invention designs and evaluates the therapeutic function of four different BCMA-specific CARs based on the same antibody chains that form the targeting portion. Two of the evaluated CARs incorporate the CD28 portion (IC28 and H828), while the other two (ICBB and H8BB) are based on 4-1BB. Initial testing indicated that the IC28 CAR was the least functional ( Figure 1B ), which prompted the inventors to focus on other constructs.

[0416] Compared with the CAR constructs evaluated herein, H8BB CAR showed the highest biological activity in most cases by upregulation of cytokine secretion, cytotoxicity and activation. It is puzzling that although the H8BB and H828 constructs disclosed herein mediated almost complete regression of human tumors in xenograft experiments, the ICBB construct did not show significant biological activity. Several reasons can explain this—in fact, both H8BB and H828 constructs contain hinge regions and transmembrane regions derived from CD8, while ICBB constructs use shorter hinges (21aa, vs. 46aa) and TMs from CD28 molecules. Although little is known about the role of the TM region in CAR function, several studies have shown that the nature and length of the hinge need to be tailored to the targeted antigen [Guedan S et al., Mol. Ther. Methods. Clin. Dev. (2018); 12: 145-156; Lindner SE et al., Sci. Adv. (2020). The lack of ICBB-CAR function in vivo may also be related to the tonic signaling and nonspecific activity observed in several assays (as seen in cytokine secretion assays or upregulation of activation markers with antigen-negative targets - respectively). Figure 2A and Figure 3D, which may ultimately lead to functional decline [Long AH et al., Nat. Med. (2015); 21:581-590].

[0417] When the H8BB of the present disclosure is compared with the H828 construct of the prior art, the present disclosure clearly shows that the former generally exhibits higher activity at lower PD1 levels. Both are effective in vivo, with the H8BB-CAR group significantly superior to the H828-CAR group (survival rates of 88% and 55%, respectively, log-rank test, p=0.09). Therefore, this seems to prove, at least in part, the long-term advantage of 4-1BB-based CARs over CD28-based receptors, as previously described

[12] . In addition, it is well known that MM has a high relapse rate and a long duration of response to novel agents or immune agents, and these findings may be of great significance to the clinical implementation of this therapy.

[0418] Therefore, this work reinforces the need to empirically evaluate CARs to determine their optimal configuration and presents an optimized BCMA-CAR that demonstrates long-term in vivo efficacy. In addition, such protective effects may be influenced by the nature of the receptor used—its basic structure as shown herein or its origin (e.g., mouse versus human) [Wang D et al., (2021); 137:2890-2901]—by enhancing specificity and reducing "off-target" effects. Importantly, given that BCMA is expressed by plasma cells from the bone marrow of patients with different plasma cell lesions ( Fig. 7A ), anti-BCMACAR T cell therapy can be used to treat more vulnerable patients with MM plasma cell lesions other than, such as light chain amyloidosis. Considering the very encouraging data collected so far about the safety and effectiveness of H8BB in vitro and in vitro, the inventors aim to evaluate the therapeutic potential of the treatment based on H8BB CAR T cells in patients with plasma cell lesions. An R / R MM treatment program based on academic, GMP-grade, H8BBCAR engineered T cells has been successfully generated, and the program has been approved by the Israeli Ministry of Health. As disclosed in Example 9, clinical studies are initiated to enroll R / R malignant plasma cell patients treated with autologous H8BB-CAR T cells (NCT04720313) in a dose escalation study, first assessing the safety of the method, and then assessing its efficacy. According to the data provided herein, it is clear that the therapy based on H8BB CAR T cells as disclosed herein provides significant value for the treatment of MM and other plasma cell-related pathologies.

[0419] In general, these data demonstrate that the H8BB-based CAR T cells disclosed herein are more specific in response to stimulation with cognate antigens than ICBB-CART cells (which show "off-target" activity) or H828-CAR T cells (which are found to be continuously activated regardless of antigenic stimulation). These data are related to the fact that H828 CAR T cells exhibit a significantly more significant exhaustion profile than the H8BB CAR T cells disclosed herein ( Figure 4A). In addition, compared with ICBB CAR T cells, H8BBCAR T cells exhibit reduced tonic signaling, which may seriously affect the "off-target" activity specificity of the cells. In summary, the present disclosure provides improved CAR molecules and CAR T cells that exhibit excellent therapeutic effects.

[0420] Therefore, the first aspect of the present disclosure relates to a chimeric antigen receptor (CAR) molecule, which comprises the following components: (i) at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds to B cell maturation antigen (BCMA); (ii) at least one hinge domain and transmembrane domain derived from differentiation 8α (CD8α) protein cluster (also known as T cell surface glycoprotein CD8α chain). It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragments, derivatives and variants thereof. The CAR molecule also comprises (iii) at least one intracellular T cell signaling domain. More specifically, the domain comprises at least one domain of a tumor necrosis factor (TNF) receptor family member, and optionally at least one domain of a T cell receptor (TCR) molecule.

[0421] Therefore, the present disclosure provides a CAR molecule.As used herein, chimeric antigen receptor (CAR) refers to a recombinant polypeptide comprising at least an extracellular antigen binding domain, a transmembrane domain, and an intracellular cytoplasmic signaling domain comprising a functional stimulation domain. These receptors are chimeric because they couple extracellular antigen binding ability and intracellular T or B cell activation function in a single receptor molecule. CAR has been designed to give its expressed B or T cells a new ability to recognize a specific antigen of interest, thereby promoting an immune response thereto. For example, the technology is used in immunotherapy for specifically identifying a specific cancer cell antigen of interest, so as to more effectively direct immune cells to those target cells and destroy them.

[0422] As used herein, CAR refers to artificial T cell receptors (also referred to as chimeric T cell receptors, chimeric immune receptors). These are engineered receptors that transplant any specificity onto immune effector cells. Typically, these receptors are used to transplant the specificity of monoclonal antibodies onto T cells.

[0423] The original design (also called first generation) linked the antibody-derived scFv to the CD3ζ intracellular signaling domain of the T-cell receptor via the hinge and transmembrane domains.

[0424] The second generation CAR adds the intracellular signaling domain from various costimulatory protein receptors (e.g., CD28, 41BB, ICOS) to the cytoplasmic tail of CAR to provide additional signals to T cells. Recently, the third generation CAR combines multiple signaling domains, such as CD27, CD28, 4-1BB, ICOS or OX40, to enhance efficacy.

[0425] It will be appreciated that the disclosed CAR molecules can be further improved by the addition of at least one additional signaling domain.

[0426] The term "chimeric protein" refers to a protein produced by the connection / fusion of two or more genes that originally encoded different proteins. Translation of this chimeric / fusion gene produces one or more polypeptides that have functional properties derived from each of the original proteins. Recombinant chimeric / fusion proteins are artificially produced by recombinant DNA technology. Chimeric or chimera generally refers to a hybrid protein made of polypeptides with different functions, sources or physicochemical patterns.

[0427] As described above, the CAR T molecules disclosed herein are specifically directed against BCMA protein. B cell maturation antigen (BCMA), also known as TNFRSF17 or CD269, is a member of the tumor necrosis factor receptor (TNFR) superfamily. BCMA ligands include B cell activation factor (BAFF) and proliferation-inducing ligand (APRIL), wherein APRIL has a higher affinity for BCMA. BCMA is preferentially expressed by mature B lymphocytes, expressed least in hematopoietic stem cells or non-hematopoietic tissues, and is essential for the survival of long-lived bone marrow plasma cells (PC), but not the homeostasis of the entire B cell. Membrane-bound BCMA can undergo γ-secretase-mediated shedding from the cell surface, resulting in reduced circulation of soluble BCMA (sBCMA) and reduced activation of surface BCMA by APRIL and BAFF. Overexpression and activation of BCMA are associated with MM. In addition, the application of BCMA as a biomarker for MM has been supported by its prognostic value. In addition, in some embodiments, BCMA as used herein refers to human BCMA, which comprises an amino acid sequence as shown in Q02223. In yet other embodiments, BCMA is encoded by the nucleic acid sequence shown in Genebank Accession No. Z14954.1. In yet other embodiments, BCMA comprises the amino acid sequence shown in SEQ ID NO: 25, and any variants or derivatives thereof.

[0428] In some embodiments, at least one target binding domain of a CAR molecule of the present disclosure comprises: (i) at least one target recognition element; and / or (ii) at least one adapter component that recognizes and binds to at least one labeled target recognition element.

[0429] In some embodiments, such adaptor components may comprise at least one moiety that specifically recognizes and binds to at least one tag of a labeled target recognition element.

[0430] Thus, in certain embodiments, the target binding portion of the CAR molecule of the present disclosure may comprise an antibody or antigen-binding fragment thereof, or any aptamer to two or more antigens (e.g., a bispecific or trispecific antibody), or alternatively, a different antibody or any other affinity molecule targeting the BCMA molecule.

[0431] In some embodiments, the adapter component includes at least one part that specifically recognizes and binds to at least one tag of a labeled target recognition element. According to such specific embodiments, the CAR molecules of the present disclosure may be applicable to various target recognition elements, which are identified by tags and labeled by adapter components, thereby forming a recognition pair. These CAR molecules may also be referred to as universal CARs herein. In some specific embodiments, the recognition pair may include a biotin / avidin affinity pair. For example, the target recognition component may be labeled with biotin and attached to the adapter component of the disclosed CAR comprising streptavidin. However, it should be understood that any other binding pair is suitable for this purpose, such as leucine zipper adapters (zipCAR and zipFv), peptide new epitopes (PNE) and anti-PNE, fluorescein (FITC) and anti-FITC, 10 amino acids (5B9 tags) and anti-5B9, FLAG, HA, SpyTag / SpyCatcher, leucine zipper, SNAP-tag, CLIP-tag, HALo-tag, SpyTag, SnoopTag, Isopep-tag, etc.

[0432] Further, in some embodiments, the target recognition domain and / or element of the CAR molecule of the present disclosure includes any affinity molecule that recognizes and binds to the BCMA target molecule and / or any other additional target. The affinity molecule may include any ligand of the target molecule, any aptamer that specifically recognizes BCMA or any other target molecule, any peptide (e.g., peptide segment body) that specifically interacts with a specific antigen, a receptor molecule that specifically interacts with a specific antigen, a protein containing a ligand binding portion of a receptor that specifically binds to a specific antigen or an antigen binding scaffold, or at least one antibody or any antigen binding fragment thereof. As used herein, "aptamer" refers to a peptide aptamer in some embodiments, which is a small peptide with a single variable loop region, which is connected to a protein scaffold that binds to a specific molecular target (e.g., a protein) at both ends, and it binds to their target only through the variable loop region, and generally has high specificity.

[0433] In some embodiments, the target recognition domain of the disclosed CAR molecules comprises at least one antibody, or any antigen-binding fragment, portion, or chimera thereof, that is specific for BCMA.

[0434] The CAR molecules provided herein include at least one target binding domain, which in some embodiments may be any target recognition element, such as at least one antibody or any antigen binding fragment or domain thereof, as discussed herein above. In yet other embodiments, the target recognition element of the CAR molecules disclosed herein includes at least one antibody or any antigen binding fragment, part or chimera thereof.

[0435] Exemplary categories of antigen binding domains that can be used in the context of the present invention include antibodies, antigen binding portions of antibodies (e.g., single chain variable fragments (scFv)), peptides that specifically interact with a specific antigen (e.g., peptidomimetics), receptor molecules that specifically interact with a specific antigen, proteins comprising a ligand binding portion of a receptor that specifically binds to a specific antigen, or antigen binding scaffolds. The antigen binding domain according to the present invention can recognize and bind to a specific antigen or epitope. Therefore, it should be noted that the terms "binding specificity", "specifically binds to an antigen", "specifically immunoreacts", "specifically targets" or "specifically recognizes", when referring to an antigen or a specific epitope, refer to the binding reaction that determines the presence of the epitope in a heterogeneous population of proteins and other biological products. The term "epitope" means a portion of any molecule that can be bound by an antibody and can also be recognized by the antibody. Epitopes or "antigenic determinants" are generally composed of chemically active surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics as well as specific charge characteristics. Further, as described above, an "antigen binding domain" may comprise or consist of an antibody or an antigen binding fragment of an antibody, such as a single chain variable fragment (scFv). As used herein, the term "antibody" refers to any antigen binding molecule or molecular complex comprising at least one complementary determining region (CDR) that specifically binds to or interacts with a specific antigen or any epitope thereof. The term "antibody" includes immunoglobulin molecules, which include four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, and multimers thereof (e.g., IgM). Each heavy chain includes a heavy chain variable region (abbreviated herein as HCVR or V H ) and a heavy chain constant region. The heavy chain constant region comprises three domains, CH1, CH2 and CH3. Each light chain comprises a light chain variable region (abbreviated herein as LCVR or V L ) and a light chain constant region. The light chain constant region comprises a domain (CL1). H Area and V L The V domains are further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). H and V L It consists of three CDRs and four FRs, arranged in the following order from amino terminus to carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0436] A typical antibody consists of two immunoglobulin (Ig) heavy chains and two Ig light chains. In humans, antibodies are encoded by three separate loci, the immunoglobulin heavy locus (IgH) on chromosome 14, which contains the gene segments of the immunoglobulin heavy chains, the immunoglobulin kappa locus (IgK) on chromosome 2, which contains the gene segments of part of the immunoglobulin light chains, and the immunoglobulin lambda locus (IgL) on chromosome 22, which contains the gene segments of the immunoglobulin light chains.

[0437] The antibody and BCR heavy chains contain 51 variable (V) gene segments, 27 diversity (D) gene segments, and 6 joining (J) gene segments. The antibody and BCR light chains contain 40 Vκ, 31 Vλ, 5 Jκ, and 4 Jλ gene segments.

[0438] In addition, as used herein, "antigen binding fragment" of an antibody, etc., includes any naturally occurring, enzymatically obtainable, synthetic or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. Antigen binding fragments of an antibody can be derived from a complete antibody molecule, for example, using any suitable standard technique, such as proteolytic digestion or involving manipulation and expression of DNA encoding variable and optionally constant domains of an antibody for recombinant genetic engineering techniques. Such DNA is known and / or easy to obtain from, for example, commercial sources, DNA libraries (including, for example, phage-antibody libraries), or can be synthesized. DNA can be sequenced and manipulated by chemical methods or by molecular biology techniques, for example, one or more variable and / or constant domains are arranged into a suitable configuration, or codons are introduced, cysteine ​​residues are produced, modified, added or deleted amino acids, etc.

[0439] Non-limiting examples of antigen-binding fragments include: (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv (scFv) molecules; (vi) dAb fragments; and (vii) minimal recognition units consisting of amino acid residues that mimic the hypervariable region of an antibody (e.g., isolated complementary determining regions (CDRs)). Other engineered molecules, such as domain-specific antibodies, single domain antibodies, domain-deleted antibodies, chimeric antibodies, CDR-grafted antibodies, double antibodies, three antibodies, four antibodies, mini antibodies, nanobodies (e.g., monovalent nanobodies, bivalent nanobodies, etc.), small modular immunopharmaceuticals (SMIPs) and shark variant IgNAR domains are also encompassed within the expression "antigen-binding fragment" as used herein.

[0440] Single domain antibodies, also called nanobodies (also called camelid single domain antibodies or VHHs), have previously been obtained by immunizing dromedaries, camels, llamas, alpacas, sharks, mice, rabbits and humans.

[0441] The antigen-binding fragment of an antibody generally comprises at least one variable domain. The variable domain may be of any size or amino acid composition and generally comprises at least one CDR adjacent to or within a frame with one or more framework sequences. L Domain-related V H In the antigen-binding fragment of the structural domain, V H Domain and V L The domains can be positioned relative to each other in any suitable arrangement. For example, the variable region can be a dimer and contain V H -V H 、V H -V L or V L -V L Alternatively, the antigen-binding fragment of the antibody may contain a monomer V H or V L Structural domain.

[0442] In some other embodiments of the CAR molecules disclosed herein, the antigen binding fragment, part or chimera of such antibodies include at least one of a single chain variable fragment (scFv) and / or a nano antibody. As used herein, a single chain variable fragment (scFv) includes a variable region of an immunoglobulin heavy chain (VH) and a light chain (VL), connected to a short linker peptide. The single chain variable fragment lacks the constant Fc region found in a complete antibody molecule. However, despite the removal of the constant region and the introduction of a joint, scFv retains the specificity of the original immunoglobulin.

[0443] The antibodies suitable for use in the present invention may also be bispecific antibodies (or trispecific antibodies. As described above, the antibodies suitable for use in the present invention may also be variable neoantigen receptor antibodies (V-NARs), as well as any humanized forms thereof.

[0444] In some embodiments, the antibody is a mouse anti-BCMA antibody c11d5.3, also described in (U.S. Pat. No. 9,034,324B2, Susan L. KALled, Concord, MA and Yan-Ming Hsu), or any fragment thereof. The antibody comprises a heavy chain sequence and a light chain sequence as shown in SEQ ID NO: 3 and SEQ ID NO: 5.

[0445] In some specific embodiments of the CAR molecules disclosed herein, the antibody specifically recognizes and binds to BCMA protein or any fragment thereof. More specifically, such antibodies include an immunoglobulin heavy chain (HC) and an immunoglobulin light chain (LC), the immunoglobulin heavy chain including an amino acid sequence as shown in SEQ ID NO:3 and any derivatives or variants thereof, and the immunoglobulin light chain including an amino acid sequence as shown in SEQ ID NO:5 and any derivatives or variants thereof.

[0446] In yet other embodiments, at least one target binding domain of the CAR molecule of the present disclosure comprises the amino acid sequence shown in SEQ ID NO: 11, and any derivatives or variants thereof.

[0447] The second component of the disclosed CAR molecule comprises a hinge region and / or a transmembrane domain.

[0448] Hinge region or hinge domain as used herein refers to an extracellular flexible structure that connects the targeting moiety to the plasma membrane of a T cell. These sequences are generally derived from IgG subclasses (such as IgG1 and IgG4), IgD and CD8 domains.

[0449] In some other embodiments, the "transmembrane region" or transmembrane domain (TMD, also referred to herein as TM) of the disclosed CAR molecule is a functional region of a protein that spans the phospholipid bilayer of a biological membrane, such as the plasma membrane of a cell. Integral membrane proteins typically include two or more such domains, alternating with intracellular domains and extracellular domains arranged on both sides of the membrane. TMD may be mainly composed of non-polar amino acid residues, and typically adopts an alpha helical conformation. The amino acids of the transmembrane domain interact with the fatty acyl groups of membrane phospholipids, thereby anchoring the protein in the membrane.

[0450] In some embodiments, the hinge region may comprise between about 10 to 100, 20 to 90, 30 to 80, 30 to 70, 30 to 60 amino acid residues, specifically, about 25 to 50 aa, specifically, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 amino acid residues.

[0451] In some embodiments, the hinge region of the disclosed CAR molecule may include any sequence from the differentiation 8 alpha (CD8 alpha) protein cluster. Cluster of differentiation 8 (CD8), also known as Ly-2 or Leu-2 and T cell surface glycoprotein CD8 alpha chain, is a double-chain and transmembrane glycoprotein expressed on the surface of circulating T cells. CD8 acts as a co-receptor for the T cell receptor (TCR). Like TCR, CD8 binds to major histocompatibility complex (MHC) molecules, but is specific for class I MHC proteins presented by antigen presenting cells (APCs). There are two subtypes of CD8 protein, α and β, each encoded by a different gene. CD8 exists as a disulfide-linked dimer, which may be an α / β heterodimer or an α / α homodimer. In some embodiments, CD8 alpha as used herein refers to human CD8 alpha homodimers. In some embodiments, human CD8 alpha is shown by Uniprot accession number # P01732-1. Further, in some embodiments, human CD8α comprises an amino acid sequence as shown in SEQ ID NO: 26. In some embodiments, the hinge region of the disclosed CAR molecule may comprise an amino acid sequence as shown in SEQ ID NO: 9, or any fragment, derivative, and variant thereof. Further, in some embodiments, the hinge region of the disclosed SEQ ID NO: 9 further comprises at least one residue, and is therefore an example of a hinge region fragment. In some embodiments, the hinge region of SEQ ID NO: 9 further comprises a lysine residue. In yet other embodiments, such a hinge region is as shown in SEQ ID NO: 35.

[0452] Further, in some alternative embodiments, the hinge region of the disclosed CAR molecule may include an IgG4 hinge region. In some embodiments, a suitable hinge region may include an amino acid sequence as shown in SEQ ID NO: 38. Further, in some embodiments, the second component of the disclosed CAR molecule may include a transmembrane domain.

[0453] In some embodiments, the TM region may comprise about 30 to 15 amino acid residues, specifically, about 25 to 17 aa, specifically, 25, 24, 23, 22, 21, 20, 19, 18, 17 amino acid residues.

[0454] In some embodiments, the transmembrane domain may be derived from the CD8α protein.

[0455] In yet other specific embodiments, the TM region used in the disclosed CAR molecules may comprise an amino acid sequence as shown in SEQ ID NO: 10, or any fragment, derivative, and variant thereof.

[0456] In some alternative embodiments, the TM region of the disclosed CAR molecule may comprise a TM region derived from a CD28 molecule. A non-limiting embodiment of such a TM is a TM comprising an amino acid sequence as shown in SEQ ID NO: 39.

[0457] In yet other embodiments, the hinge and transmembrane domains of the CAR molecule of the present disclosure comprise the amino acid sequence shown in SEQ ID NO: 6, and any derivatives or variants thereof.

[0458] As shown in the disclosed embodiments, the CAR T molecules of the present disclosure, specifically the H8BB CAR molecules, show significant advantages over the CARs of the prior art, such as H828 CAR T, which share similar target binding domains, and / or similar TM regions and / or hinge regions, which are derived from the same molecules, specifically CD8αtm and hinges. However, it should be noted that the hinge region of the disclosed CART, specifically, as shown in SEQ ID NO: 9, is different from the hinge region of H828 CAR T, which comprises a hinge region as shown in SEQ ID NO: 22. Further, in some embodiments, the hinge region of the CAR molecules of the present disclosure comprises an amino acid sequence as shown in SEQ ID NO: 35.

[0459] Further, the third component of the CAR molecule of the present disclosure is at least one signal transduction domain. As used herein, the term signal transduction domain refers to the functional intracellular part of the receptor protein in some embodiments, which acts to transmit the detected stimulus information in the cell, thereby regulating cell activity through a specific signal transduction pathway. According to some embodiments, the domain is an intracellular domain connected to a transmembrane domain, specifically, a TM domain used by the CAR molecule of the present disclosure.

[0460] Further, in some embodiments, at least one intracellular T cell signaling domain of the CAR molecule of the present disclosure comprises at least one tumor necrosis factor (TNF) receptor family member. Tumor necrosis factor receptor (TNFR) superfamily members are membrane-bound or soluble receptors that interact with membrane-bound and / or soluble ligands of the TNF superfamily. Most members of the TNF / TNFR superfamily are expressed by immune cells. TNFR members affect cell proliferation, survival, differentiation and apoptosis of reactive cells via the activation of their ligands.

[0461] TNF-like receptors are type I transmembrane proteins characterized by a cysteine-rich domain (CRD), which is a hallmark of the TNFR superfamily. These pseudorepeats are defined by intrachain disulfide bonds generated by highly conserved cysteine ​​residues within the receptor chain. Members of the tumor necrosis factor (TNF) / tumor necrosis factor receptor (TNFR) superfamily play a key role in maintaining the homeostasis of the immune system. The biological functions of this system include beneficial and protective effects in inflammation and host defense, as well as a key role in organogenesis. At the same time, members of this superfamily are responsible for host damage effects in sepsis, cachexia, and autoimmune diseases. The TNFR superfamily includes, for example, TNFR1 (sometimes also referred to as p55 / p60), TNFR2 (also referred to as p75 / p80), and B cell activating factor receptor (BAFFR). In addition, the tumor necrosis factor (TNF) family includes, for example, TNFα (TNFα), TNFβ (TNFβ), CD40 ligand (CD40L), Fas ligand (FasL), TNF-related apoptosis-inducing ligand (TRAIL) and LIGHT (homologous to lymphotoxin, exhibits inducible expression, and competes with HSV glycoprotein D for HVEM, a receptor expressed by T lymphocytes), some of the most important cytokines involved in physiological processes, systemic inflammation, tumor lysis, apoptosis and initiation of acute phase responses.

[0462] In some embodiments, the TNF receptor family member that can be used as the signal transduction intracellular domain of the CAR molecule of the present disclosure is 4-1BB. Therefore, in some embodiments, the CAR molecule of the present disclosure includes an intracellular domain derived from 4-1BB. 4-1BB (TNFRSF9, CD137) is an activation-induced T cell co-stimulatory molecule and is a member of the TNFR superfamily. 4-1BB is expressed on a subpopulation of resting CD8+T cells and is upregulated on CD4+ and CD8+T cells after activation. After binding to the trimer 4-1BBL (TNFSF9, CD137L) on APCs, 4-1BB recruits TNFR-related factor family members (TRAF1, TRAF2 and TRAF3) to its cytoplasmic region, forming a 4-1BB signal body, and leading to downstream activation of NF-κB, MAPK and ERK. The agitation of 4-1BB upregulates the expression of anti-apoptotic proteins Bcl-xL and Bfl-1. In addition, the activation of 4-1BB increases IL-2 and IFN-γ in CD8+ cells and IL-2 and IL-4 in CD4+ cells. T cells expressing CAR incorporate the 4-1BB domain and have been shown to express granzyme B, IFN-γ, TNF-α, GM-CSF, and anti-apoptotic protein Bcl-xL. In addition, the 4-1BB TM and cytoplasmic domains are integrated into CAR, resulting in improved persistence and anti-tumor activity, as well as prolonged T cell division.

[0463] In some embodiments, 4-1BB as used herein refers to human 4-1BB. In some embodiments, human 4-1BB is as shown in Uniprot accession number #Q07011. In some other embodiments, human 4-1BB comprises an amino acid sequence as shown in SEQ ID NO: 28, and any variants and derivatives thereof.

[0464] In some other optional embodiments, at least one intracellular T cell signal transduction domain of the CAR molecule of the present disclosure also includes at least one TCR molecule or any fragment thereof. More specifically, T cell receptor (TCR) is a protein complex found on the surface of T cells or T lymphocytes, which is responsible for identifying antigen fragments as peptides bound to major histocompatibility complex (MHC) molecules. When TCR is engaged with antigenic peptides and MHC (peptide / MHC), T lymphocytes are activated by signal transduction, that is, a series of biochemical events mediated by related enzymes, co-receptors, specialized adapter molecules and activated or released transcription factors.

[0465] The core TCR complex consists of two TCR chains and six cluster of differentiation 3 (CD3) chains. The human genome expresses four TCR genes, called TCRα, TCRβ, TCRγ and TCRδ, forming two different heterodimers: TCRα / TCRβ or TCRγ / TCRδ. Most mature T cells express TCRα and TCRβ subtypes, commonly referred to as T cells (or αβT cells), while a small portion (0.5-5%) of T lymphocytes (γδT cells) express TCRγ and TCRδ subtypes. Both heterodimers form multiprotein complexes with CD3δ, γ, ε and ζ chains. However, in both complexes, there are three dimers of CD3 protein, namely δε and γε heterodimers and ζζ homodimers. These CD3 proteins bind to TCR via non-covalent hydrophobic interactions, which are necessary for the complete positioning of TCR on the cell surface. TCR mediates recognition of antigenic peptides bound to MHC molecules (pMHC), while CD3 molecules transmit activation signals to T cells.

[0466] In a more specific embodiment, the CAR molecule of the present disclosure may include at least one region, which is derived from at least one domain of TCR, specifically a cluster of differentiation 3 (CD3) ζ chain. Therefore, in some embodiments, the CAR molecule of the present disclosure covers an intracellular domain, which also includes a domain derived from CD3-ζ. The T cell surface glycoprotein CD3ζ chain is also called the T cell receptor T3ζ chain or CD247 (differentiation cluster 247), which is a protein encoded by the CD247 gene in humans. More specifically, the CD3 (differentiation cluster 3) T cell co-receptor helps activate cytotoxic T cells. It consists of a protein complex and consists of four different chains. In mammals, the complex contains a CD3γ chain, a CD3δ chain, and two CD3ε chains. These chains bind to the T cell receptor (TCR) and the ζ chain (ζ chain) to generate activation signals in T lymphocytes. TCR, ζ chain, and CD3 molecules together constitute the TCR complex. T cell receptor ζ forms a T cell receptor-CD3 complex together with T cell receptor α / β and γ / δ heterodimers and CD3-γ, -δ and -ε. The ζ chain plays an important role in coupling antigen recognition to several intracellular signal transduction pathways, and is therefore included in the CAR T molecules of the present disclosure. In some embodiments, CD3ζ as used herein refers to human CD3ζ. In some embodiments, human CD3ζ is as shown in Uniprot accession number #P20963-1. Further, in some embodiments, the human CD3ζ used in the present disclosure may include an amino acid sequence as shown in SEQ ID NO: 27, and any derivative or variant thereof.

[0467] In some specific and non-limiting embodiments, at least one intracellular T cell signaling domain of the CAR molecule of the present disclosure comprises the amino acid sequence shown in SEQ ID NO: 12, or any variants and derivatives thereof.

[0468] In some other specific embodiments, the CAR molecule of the present disclosure comprises an amino acid sequence as shown in SEQ ID NO: 1, or any variant and derivative thereof. It should be noted that in some embodiments, the CAR T of the present disclosure is also referred to herein as H8BB CAR, and HBI0101 (clinical grade as used herein) CART.

[0469] It should be further understood that the present disclosure further encompasses any of the disclosed CAR T molecules, specifically, ICBB CAR molecules comprising the amino acid sequence shown in SEQ ID NO: 36. Further, the present disclosure also encompasses IC28 CAR molecules comprising the amino acid sequence shown in SEQ ID NO: 37.

[0470] In some other embodiments, according to some other or additional embodiments, the expression of the CAR molecules disclosed herein by at least one cell of the T lineage leads to several features that distinguish the disclosed CAR molecules from the CAR molecules of any prior art, and further, defines that the disclosed CAR molecules are superior to the CAR molecules of the prior art. More specifically, in some embodiments (I), the disclosed CAR molecules show an increase in specificity for the target, or are characterized by this. In particular, the specificity for any cell expressing the target BCMA increases.

[0471] In some embodiments, specificity as used herein refers to the ability of a CAR molecule to activate T cells expressing a specific antigen in response to a specific antigen while not inducing a response or inducing a negligible response to cells expressing a different antigen.

[0472] In yet some additional or alternative embodiments, expression of the CAR molecules disclosed herein by at least one cell of the T lineage results in (ii) reduced tonic signaling. Therefore, in some embodiments, the disclosed CAR molecules exhibit reduced tonic signaling, or are characterized by this. More specifically, as used herein, the term "tonic signaling" can be defined as constitutive or chronic activation of T cells in the absence of a ligand. Physiologically, low-level continuous tonic signaling via interactions between endogenous TCRs and self-peptide-loaded MHC molecules constitutes an important mechanism for regulating T cell homeostasis. In contrast, tonic signaling mediated by T cell transplantation CAR structures appears to be more complex. Tonic signaling may be affected by, for example, Figures 2 and Figure 3C The impact of the CAR configuration is shown.

[0473] Further, in some additional or alternative embodiments, the CAR molecules disclosed herein are expressed by at least one cell of the T lineage, resulting in (iii) reduced off-target activation. Therefore, in some embodiments, the disclosed CAR molecules show reduced off-target activation, or are characterized by this. More specifically, as shown in Figures 2 and 4, off-target activation refers herein to non-specific cytokine secretion in control co-cultures with antigen-negative targets (such as K562) or without any targets. Off-target activation may be affected by CAR configuration.

[0474] In some additional or alternative embodiments, the expression of the CAR molecules disclosed herein by at least one cell of the T pedigree leads to (iv) increased expression of activation markers in response to specific stimuli. Therefore, in some embodiments, the disclosed CAR molecules show increased expression of activation markers, or are characterized by increased expression of activation markers. In some other embodiments, the disclosed CAR molecules increase the activation of T cells. T cells are generated in the thymus and are programmed to be specific to a specific foreign particle (antigen). Once they leave the thymus, they circulate throughout the body until they recognize their antigens on the surface of antigen presenting cells (APCs). The T cell receptors (TCRs) on CD4+ helper T cells and CD8+ cytotoxic T cells bind to antigens because the antigens are located in a structure called MHC complex on the surface of APCs. This triggers the initial activation of T cells. CD4 molecules and CD8 molecules then also bind to MHC molecules to stabilize the entire structure. This initial binding between T cells specific for an antigen and the antigen MHC that matches it initiates the entire response. This usually occurs in secondary lymphoid organs.

[0475] In addition to the binding of TCR to the MHC loaded with antigen, both helper cells and cytotoxic T cells require many secondary signals to be activated and respond to threats. In the case of helper T cells, the first of these is provided by CD28. This molecule on T cells binds to one of the two molecules on APC—B7.1 (CD80) or B7.2 (CD86)—and initiates T cell proliferation. This process results in the production of millions of T cells that recognize antigens. In order to control the response, B7 stimulates CD28 to induce the production of CTLA-4 (CD152). This molecule competes with CD28 for B7, thus reducing the activation signal of T cells and slowing down the immune response. Cytotoxic T cells are less dependent on CD28 activation, but require signals from other costimulatory molecules, such as CD70 and 4-1BB (CD137). T cells must strongly and specifically recognize foreign antigens to produce an effective immune response, and those recognized T cells are given survival signals by several molecules, including ICOS, 4-1BB and OX40. These molecules are present on the surface of T cells and are stimulated by their corresponding ligands, which are usually found on APCs. Unlike CD28 and TCR, ICOS, OX40 and 4-1BB are not constitutively expressed on T cells. Similarly, their corresponding ligands are expressed on APCs only after pathogen recognition. This is very important because it ensures that T cells are activated only by APCs that encounter pathogens and respond. In the absence of costimulation, the interaction of TCR with peptide-MHC closes T cells, so it does not produce inappropriate responses. Once T cells have received both specific antigen signals and general signals, they will receive more instructions in the form of cytokines. These determine which type of responder the cell will become—in the case of helper T cells, it will push them to Th1 type (cells exposed to cytokine IL-12), Th2 type (IL-4) or IL-17 type (IL-6, IL-23). ​​Each of these cells performs a specific task in tissues and further develops immune responses. As described above, the increase in T cell activation can be reflected by, for example, an increase in activation marker expression. Activation markers herein refer to molecules that are upregulated when T cells are activated, each at a different stage of the activation process. For example, the earliest activation marker is CD69, which is an inducible cell surface glycoprotein expressed after activation by TCR or IL-2 receptor (CD25). It plays a role in the proliferation and survival of activated T lymphocytes.

[0476] According to some embodiments, the increase in activation marker expression may include, for example, increased expression of at least one of leukocyte antigen 37 (CD37), CD25 (also known as the alpha chain of the high affinity IL-2 receptor), and cluster of differentiation 69 (CD69). It should be further understood that the specific stimulus used herein is the presence of BCMA-positive target cells. Further, in some additional or alternative embodiments, the expression of the CAR molecule of the present disclosure by at least one cell of the T lineage results in (v) reduced expression of exhaustion markers in response to specific stimuli. As used herein, T cell exhaustion refers to a state of T cell dysfunction that occurs in many chronic infections and cancer processes. It is defined as poor effector function, persistent expression of inhibitory receptors, and a transcriptional state that is different from that of functional effector or memory T cells. "Dysfunction" is understood here as some T cells that, after activation and proliferation, do not perform their intended functions as effector T cells—typically, they cannot eliminate cancer cells or infected cells and control tumors or viruses, respectively. As initially described, antigen-specific T cells become "dysfunctional" during the chronic phase of high viral load infection, with a gradual loss of interleukin (IL)-2, tumor necrosis factor alpha (TNFα), and interferon gamma (IFNγ). Thus, in some embodiments, the disclosed CAR molecules exhibit, or are characterized by, reduced expression of exhaustion markers. More specifically, in some embodiments, the exhaustion marker may be at least one of programmed death-1 receptor (PD-1), lymphocyte activation gene-3 (LAG-3, also known as CD223 or FDC protein), T cell immunoglobulin and mucin domain-containing-3 (TIM3), T cell immunoreceptor with Ig domain and ITIM domain (TIGIT) in vivo and / or in vitro / ex vivo environments, also as Figure 3C Further, in some additional and non-limiting embodiments, exhaustion markers suitable for use in the present disclosure include inducible T cell co-stimulator (ICOS), cytotoxic T lymphocyte-associated protein-4 (CTLA-4), CD244 (2B4), CD160, killer cell lectin-like receptor subfamily G member 1 (KLRG1), and the like.

[0477] As described above, one of the main and advantageous properties displayed by the disclosed CAR molecules is the reduction of tonic signaling. More specifically, tonic signaling can be dependent on or independent of the associated Ag and has a major impact on CAR-based therapy. On the one hand, CAR tonic signaling can promote the expansion of T cells by providing a stimulatory signal. On the other hand, CAR tonic signaling can trigger terminal effector T cell differentiation, exhaustion and / or enhanced activation-induced cell death, thereby limiting in vivo persistence and anti-tumor potential. Therefore, as shown in the CAR T molecules disclosed herein, its reduction increases the specificity and effectiveness of the response.

[0478] As described above, the CAR molecules of the present disclosure show excellent properties, characterized by at least one reduced tonic signaling; reduced off-target activation; reduced expression of exhaustion markers in response to specific stimuli in vivo and / or in vitro / ex vivo environments, and increased specificity and activation marker expression in response to specific stimuli. As used herein, the increase associated with the various improved properties of the CAR molecules of the present disclosure means that such increase or enhancement may be an increase or improvement in indicating activity (e.g., specificity, expression of activation markers, etc.), between about 1% and 100% of the indicated parameter, specifically, 5% to 100%, more specifically, about 1% to about 5%, about 5% to 10%, about 10% to 15%, about 15% to 20%, about 20% to 25% %, about 25% to 30%, about 30% to 35%, about 35% to 40%, about 40% to 45%, about 45% to 50%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 75% to 80%, about 80% to 85%, about 85% to 90%, about 90% to 95%, about 95% to 99%, or about 99% to 99.9%, 100% or more. In yet other embodiments, the terms "inhibit", "mitigate", "reduce", "lower" or "attenuate" herein relate to various properties of the CAR molecules disclosed herein (e.g., expression of exhaustion markers, reduction of tonic signaling), and relate to a delay, inhibition or reduction of the indicated parameter by about 1% to 99.9%, specifically, about 1% to about 5%, about 5% to 10%, about 10% to 15%, about 15% to 20%, about 20% to 30%, about 30% to 40%, about 30% to 50%, about 30% to 60%, about 30% to 60%, about 30% to 70%, about 30% to 70%, about 30% to 80%, about 30% to 80%, about 30% to 90%, about 30% to 50%, about 30% to 80%, about 30% to 5 ... % to 25%, about 25% to 30%, about 30% to 35%, about 35% to 40%, about 40% to 45%, about 45% to 50%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 75% to 80%, about 80% to 85%, about 85% to 90%, about 90% to 95%, about 95% to 99% or about 99% to 99.9%, 100% or more. More specifically, the terms "increase", "enhance" and "enhance" as used herein refer to behaviors that gradually become larger in size, amount, number or intensity. Alternatively, "inhibit", "mitigate", "reduce", "lower" or "weaken" as used herein refer to behaviors that gradually become smaller in size, amount, number or intensity.In particular, an indicated activity (e.g., increased specificity and / or increased expression of activation markers, or decreased expression of exhaustion markers and / or tonic signaling) is increased or alternatively decreased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 200%, 300%, 400%, 500%, 600%, 70%, 800%, 900%, 1000% or more compared to a suitable control, e.g., in the absence of a CAR molecule of the present disclosure, or compared to other CAR molecules, e.g., any other (e.g., reference, H828) CAR molecule disclosed herein.

[0479] More specifically, the CAR molecules disclosed herein show significantly reduced exhaustion. In some embodiments, the reduced exhaustion is reflected by the regularity of various exhaustion marker expressions. More specifically, as demonstrated in the examples, the exhaustion curve of HBI0101 (H8BB) CART cells in resting cells is significantly lower than that of H828 CART cells; that is, compared with the H828 CART cells of the prior art, the expression of PD1, LAG3, TIM3 and TIGIT T cell exhaustion markers on the surface of HBI0101 (H8BB) CART cells was reduced by 79% (ranging between 72%-86%), 68% (ranging between 59%-74%), 77% (ranging between 69%-84%), and 43% (ranging between 37%-47%).

[0480] The exhaustion curve of HBI0101 (H8BB) CART cells activated with BCMA-expressing NCI-H929 cells was significantly lower than the exhaustion curve of H828 CART cells activated with the same BCMA-expressing NCI-H929 cells; that is, compared with the target-activated prior art H828 CART cells, the expression of PD1, LAG3, TIM3 and TIGIT T cell exhaustion markers on the surface of target-activated HBI0101 (H8BB) CART cells was reduced by 64% (range 59%-69%), 54% (range 43%-66%), 58% (range 50%-63%) and 55% (range 50%-58%), respectively.

[0481] The exhaustion pattern of HBI0101 (H8BB) CART cells after activation with BCMA-expressing K562-BCMA overexpressing cells is significantly lower than the exhaustion pattern of H828 CART cells activated with the same BCMA-expressing NCI-H929 cells; that is, compared with the target-activated H828 CART cells, the expression of PD1, LAG3, TIM3 and TIGITT cell exhaustion markers on the surface of target-activated HBI0101 (H8BB) CART cells was reduced by 55% (ranging between 47%-63%), 41% (ranging between 31%-43%), 55% (ranging between 50%-61%), and 38% (ranging between 33%-42%), respectively. Therefore, in some embodiments, the CAR T cells of the present disclosure show a reduction of about 30% to about 90%, about 35% to 80%, and about 38% to 80% in the expression of exhaustion markers, namely PD1, LAG3, TIM3, and TIGIT. Specifically, about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more, for example, 95%, 100%. More specifically, in some embodiments, PD1 expression is reduced by about 79%, 64%, 55%. In certain embodiments, the expression of LAG3 is reduced by about 68%, 54%, 41%. In some other embodiments, the expression of TIM3 is reduced by about 77%, 58%, 55%. In some other embodiments, the expression of TIGIT is reduced by about 43%, 55% or 38%. It should be understood that in some embodiments, the reduction indicated herein is compared with the CAR T cells (eg, H828 CART cells) of the prior art. Further, as shown in the examples, the CAR T cells of the present disclosure show an increase in cytotoxicity to target cells expressing BCMA. In some embodiments, compared with the prior art (H828) CAR T cells, cytotoxicity is increased by about 50% to about 100% or more, specifically, about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% cytotoxicity. In some embodiments, an increase of about 57%, or 75% or more.

[0482] In some other embodiments, compared with the prior art (H828) CAR T cells, the increase in activation markers can be in the range of about 50% to about 100%. Specifically, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, the expression of activation markers (such as CD69) increases by about 69% or more.

[0483] In some embodiments, at least one cell of the T lineage of a subject suffering from an immune-related disorder expresses a CAR molecule of the present disclosure, resulting in modulation of the subject's immune response.

[0484] Further, in some embodiments, such immune-related disorders may be any immune-related disorder associated with increased expression of BCMA markers. In yet other embodiments, such immune-related disorders may be at least one plasma cell condition. In some embodiments, such conditions may include at least one proliferative disorder, and / or at least one deposition disorder, and / or at least one autoimmune disease.

[0485] In some other alternative embodiments, the CAR molecules of the present disclosure may be applicable to inflammatory conditions, autoimmune conditions, infectious diseases caused by pathogens, neurodegenerative diseases, congenital conditions, allergic conditions, cardiovascular diseases, immunodeficiency (acquired or hereditary) and metabolic conditions. Specific embodiments applicable to the present disclosure or any aspect thereof are disclosed below in conjunction with other aspects of the present invention.

[0486] The present disclosure provides CAR T molecules composed of amino acid residues, and therefore polypeptides. As used herein, the term "polypeptide" refers to amino acid residues connected by peptide bonds. The polypeptide sequence is usually reported from the N-terminus containing free amino groups to the C-terminus containing free carboxyl groups, and may include any amino acid polymer chain. In some embodiments, the polypeptide has a naturally occurring amino acid sequence. In some embodiments, the polypeptide has an amino acid sequence that does not exist naturally. In some embodiments, the amino acid sequence of the polypeptide is included in parts that appear independently of each other in nature (ie, from two or more different organisms, e.g., human and non-human parts). In some embodiments, the polypeptide has an engineered amino acid sequence because it is designed and / or produced by the action of human hands. More specifically, "amino acid sequence" or "peptide sequence" is the order of amino acid residues connected by peptide bonds in peptide and protein chains. The sequence is usually reported from the N-terminus containing free amino groups to the C-terminus containing amides. If the amino acid sequence represents the primary structure of a protein, it is usually referred to as a peptide or protein sequence. However, a distinction must be made between the terms "amino acid sequence" or "peptide sequence" and "protein", as a protein is defined as a sequence of amino acids folded into a specific three-dimensional configuration and typically undergoes post-translational modifications such as phosphorylation, acetylation, glycosylation, mannosylation, amidation, carboxylation, sulfhydryl bond formation, cleavage, and the like.

[0487] It should be understood that the present invention encompasses the use of any variant or derivative of the polypeptide of the present invention, specifically any polypeptide comprising at least one amino acid sequence represented by any one of SEQ ID NO: 1, or any fragment thereof, for example, a CAR T molecule of SEQ ISNO; 40 does not contain a leader sequence or any portion thereof, as shown in SEQ ID NO: 2-12, or any derivative thereof, and any polypeptide substantially identical or homologous to a polypeptide encoded by a nucleic acid sequence of the present invention, as described above. The term "derivative" is used to define an amino acid sequence (polypeptide), including any insertion, deletion, substitution and modification of an amino acid sequence (polypeptide) that does not alter the activity of the original polypeptide, for example, as described above, at least one of the following in vivo and / or in vitro / ex vivo environments: increased specificity, reduced tonic signaling, reduced off-target activation, increased expression of activation markers in response to a specific stimulus, and / or reduced expression of exhaustion markers in response to a specific stimulus, as discussed above. The term "derivative" also refers to homologs, variants and analogs thereof. Protein orthologs or homologs having sequence homology or identity with the protein of interest according to the present invention, in particular the receptors, chimeras and antibodies described herein, in particular may share at least 50%, at least 60%, in particular 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more compared to the complete sequence of the protein of interest according to the present invention, in particular any one of SEQ ID NO: 1, or any fragment thereof, for example, the CAR T molecule of SEQ IS NO: 40 does not comprise the leader sequence or any part thereof, as shown in SEQ ID NO: 2-12, or any derivative thereof.

[0488] In some embodiments, derivatives refer to polypeptides that differ from the polypeptides specifically defined in the present invention by insertion, deletion or substitution of amino acid residues. It should be understood that the terms "insertion", "deletion" or "substitution" as used herein refer to any addition, deletion or substitution of amino acid residues of the polypeptide disclosed by the present invention as described above, between 1 to 50 amino acid residues, between 20 to 1 amino acid residues, and specifically between 1 to 10 amino acid residues. More specifically, insertion, deletion or substitution may be any one of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids. It should be noted that the insertion, deletion or substitution included in the present invention may occur at any position of the modified peptide, as well as any N' or C' end thereof. With regard to amino acid sequences, those skilled in the art will recognize that a single substitution, deletion or addition change, addition or deletion of a single amino acid or a small percentage of amino acids in a coding sequence of a nucleic acid, peptide, polypeptide or protein sequence is a "conservatively modified variant", wherein the change results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are supplementary to polymorphic variants, interspecies homologs and alleles of the present invention, and do not exclude them. For example, substitutions may be made wherein an aliphatic amino acid (G, A, I, L or V) is substituted with another member of the group, or substitutions may be made such as one polar residue being substituted with another, such as arginine being substituted with lysine, glutamic acid being substituted with aspartic acid, or glutamine being substituted with asparagine. Each of the following eight groups contains other exemplary amino acids that are conservative substitutions of each other:

[0489] 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine ​​(C), Methionine (M).

[0490] More specifically, an amino acid "substitution" is the result of replacing one amino acid with another amino acid having similar structural and / or chemical properties, i.e., a conservative amino acid substitution. Amino acid substitutions can be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the residues involved. For example, non-polar "hydrophobic" amino acids are selected from the group consisting of valine (V), isoleucine (I), leucine (L), methionine (M), phenylalanine (F), tryptophan (W), cysteine ​​(C), alanine (A), tyrosine (Y), histidine (H), threonine (T), serine (S), proline (P), glycine (G), arginine (R) and lysine (K); "polar" amino acids are selected from the group consisting of arginine (R), lysine (K), aspartic acid (D), glutamate (E), asparagine (N), glutamine (Q); "positively charged" amino acids are selected from the group consisting of arginine (R), lysine (K) and histidine (H), and wherein "acidic" amino acids are selected from the group consisting of aspartic acid (D), asparagine (N), glutamate (E) and glutamine (Q).

[0491] Variants of the disclosed polypeptides may have at least 80% sequence similarity or identity at the amino acid level with a protein of interest (such as various polypeptides of the present invention), typically at least 85% sequence similarity or identity, 90% sequence similarity or identity, or at least 95%, 96%, 97%, 98% or 99% sequence similarity or identity. It should be understood that the percentage of similarity or identity refers to the similarity or identity to the entire sequence shown in any one of SEQ ID NO: 1 or any fragment thereof, for example, the CAR T molecule of SEQ IS NO: 40 does not include the leader sequence or any portion thereof, as shown in SEQ ID NO: 2-12, and any variants or derivatives thereof.

[0492] Another aspect of the present disclosure relates to a nucleic acid molecule comprising at least one nucleic acid sequence encoding at least one CAR molecule, or any box, vector or vector comprising the nucleic acid molecule. In some embodiments, such encoded CAR molecules include the following components. First (i), at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds BCMA; second (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragment, derivative and variant thereof. The CAR molecule also includes at least one intracellular T cell signal transduction domain as a third component (iii). More specifically, the domain includes at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0493] In some embodiments, the disclosure provides any nucleic acid molecule encoding any of the CAR molecules defined in the disclosure.

[0494] Further, in some embodiments, the nucleic acid molecules of the present disclosure may be flanked by at least one of their 5' and 3' ends: (i) homology arms for integration into genomic target sites by homologous recombination; and / or (ii) recognition sites for site-specific nucleases, site-specific integrases, or site-specific recombinases. As used herein, the term "flank" refers to a nucleic acid sequence located between two defined regions. For example, as described above, the flanks of the nucleic acid molecules of the present disclosure encoding CAR are at least one homology arm and / or recognition site, located at 5' (or upstream) and / or 3' (or downstream) of the nucleic acid molecules of the present disclosure. As used herein, homology arms are genomic DNA fragments located at 5' and / or 3' of a nucleic acid sequence, also referred to herein as 5'- and 3'-homologous arms (or simply 5' and 3' arms, or left and right arms), located at the flanks of at least one nucleic acid sequence of interest (e.g., in a donor box). The arms are homologously recombined with complementary sequences flanking the target nucleic acid sequence to achieve successful genetic modification of the target nucleic acid sequence.

[0495] The present invention relates to providing nucleic acid molecules encoding the disclosed CAR, which in some embodiments may be used for the methods, cells, compositions and uses described in all aspects of the present invention, and / or contained in a box. The term "nucleic acid box" refers to a polynucleotide sequence comprising at least one regulatory sequence, which is operably linked to a sequence encoding a nucleic acid sequence, which encodes the CAR Ts disclosed herein. All elements contained in the box of the present invention are operably linked together. When it comes to regulatory sequences and structural nucleotide sequences, the term "operably linked" means that the nucleic acid sequence is linked in a manner that can regulate the expression of the connected structural nucleotide sequence. It should be understood that any nucleic acid box provided herein comprises a nucleic acid sequence disclosed herein (e.g., a sequence encoding the CAR T of the present invention, as shown in SEQ ID NO: 13, and any homologs and variants thereof, or a coding sequence of any fragment thereof, as shown in SEQ ID NO: 14-20, and any homologs and variants thereof). According to some embodiments, such a nucleic acid box may also include any control sequence that promotes transcription and / or translation of the CAR T molecules disclosed herein. As a non-limiting example, such sequences include promoter sequences, specifically DNA regulatory regions that can bind to RNA polymerase in cells and initiate transcription of downstream (3' direction) coding sequences. For the purpose of defining the present invention, promoter sequences are limited by a transcription initiation site at their 3' end, and extend upstream (5' direction) to include the minimum number of bases or elements necessary for initiating transcription at a detectable level above background. A transcription initiation site will be found within the promoter sequence, as well as a protein binding domain responsible for binding RNA polymerase. Eukaryotic promoters will typically, but not always, contain a "TATA" box and a "CAT" box. Various promoters, including inducible promoters, can be used to drive various vectors of the present invention.

[0496] In some embodiments, the promoter applicable to the present invention may be inducible or constitutive.In some other embodiments, a minimal promoter may be used, and in addition, endogenous promoters or heterologous promoters are also applicable to expression cassettes disclosed herein.In some embodiments, the box of the present disclosure may further include a signal peptide leader sequence, for example, a signal peptide leader sequence derived from CD8, as used herein, specifically SEQ ID NO:2, and any derivatives and variants thereof.In some other embodiments, the nucleic acid molecules encoding the CAR provided by the present invention may further include at least one degradation determinant sequence, at least one 2A peptide sequence or CHYSEL site, at least one mRNA stable sequence, at least one stop codon (or stop codon), at least one 3-frame stop codon sequence, at least one protein stable sequence, at least one polyadenylation sequence, at least one transcription enhancer, splicing donor and / or splicing acceptor site and any transcription and / or translation element.

[0497] The present invention provides nucleic acid molecules, sequences encoding immune effectors of interest and engineered CARTs disclosed herein, boxes and methods thereof, cells, purposes and compositions.Terms "nucleic acid", "nucleic acid sequence" or "polynucleotide" and "nucleic acid molecules" refer to polymers of nucleotides, including but not limited to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), DNA / RNA hybrids, including regular and / or irregular alternating deoxyribose moieties and polynucleotide chains of ribose moieties (i.e., wherein alternating nucleotide units have -OH, then -H, then -OH, then -H, etc. at the 2' position of the sugar moiety) and the modification of these kinds of polynucleotides, including various entities or parts at any position with nucleotide units.These terms should also be understood to include analogs of RNA or DNA made of nucleotide analogs as equivalents, and single-stranded (such as sense or antisense) and double-stranded polynucleotides suitable for the embodiments.The preparation of nucleic acids is well known in the art.Further, it should be understood that the present invention includes any carrier or vehicle as its additional aspect, which includes any nucleic acid molecules of the present invention or any box described in the present invention.

[0498] Further, in some embodiments, the nucleic acid molecules of the present invention or any box used in the present invention can be included in a nucleic acid vector. In more specific embodiments, such vectors can be any one of a viral vector, a non-viral vector, and a naked DNA vector.

[0499] As used herein, a vector is a nucleic acid molecule of a specific sequence that can be incorporated into a vector and then introduced into a host cell to produce a transformed host cell. The vector may include a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. The vector may also include one or more selectable marker genes and other genetic elements known in the art, including promoter elements that guide nucleic acid expression. Many vectors, such as plasmids, cosmids, minicircles, phages, viruses, etc., can be used to transfer nucleic acids into target cells and can be applied to the present invention. The vector containing nucleic acid can be kept in a free form, such as a plasmid, a small circular DNA, a virus such as a cytomegalovirus, adenovirus, etc., or it can be integrated into the target cell genome by homologous recombination or random integration, such as a retrovirus-derived vector, such as AAV, MMLV, HIV-1, ALV, etc. The vector can be directly provided to the subject cell. In other words, the cell is contacted with a vector containing a nucleic acid molecule and / or a cassette of the present invention containing a nucleic acid sequence encoding an immune effector of interest and the engineered CAR T disclosed herein, so that the vector is taken up by the cell. Methods for contacting cells with plasmid nucleic acid vectors, such as electroporation, calcium chloride transfection, and lipofection, are well known in the art. DNA can be introduced as naked nucleic acid, as a nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by a virus (e.g., adenovirus, AAV). More specifically, in some embodiments, the vector may be a viral vector. In some specific embodiments, such viral vectors may be any of a recombinant adeno-associated vector (rAAV), a single-stranded AAV (ssAAV), a self-complementary rAAV (scAAV), a simian vacuolating virus 40 (SV40) vector, an adenoviral vector, a helper-dependent adenoviral vector, a retroviral vector, and a 1'lentiviral vector. As described above, in some embodiments, a viral vector may be applicable to the present invention. The term "viral vector" refers to a replicating or replication-defective viral particle capable of transferring a nucleic acid molecule into a host. The term "virus" refers to any obligate intracellular parasite without a protein synthesis or energy production mechanism. The viral genome may be RNA or DNA, containing a protein coating structure of a lipid membrane. Examples of viruses that can be used to practice the present invention include Baculoviridae, Parvoviridae, Picornaviridae, Mixoviridae, Poxviridae, Adenoviridae, Picornaviridae. The term recombinant virus includes chimeric (or even multimeric) viruses, i.e., vectors constructed using complementary coding sequences from more than one viral subtype.

[0500] In some embodiments, the nucleic acid molecules and / or boxes of the present invention may be contained in a retroviral vector. As used herein, a retroviral vector consists of a proviral sequence that can accommodate a nucleic acid molecule encoding an engineered CAR T disclosed herein to allow both to be incorporated into a target cell. The vector may also contain viral and cellular gene promoters to enhance the expression of nucleic acid molecules encoding an immune effector of interest and an engineered CAR T disclosed herein in target cells. The retroviral vector is stably integrated into the genome of the divided target cell so that the introduced gene is delivered and expressed in all daughter cells. It contains a reverse transcriptase that can be integrated into the host genome.

[0501] In some specific non-limiting embodiments, the pMSGV1 retroviral vector has been used for the CART molecules disclosed herein. More specifically, the pMSGV1 retroviral vector contains a mouse stem cell virus long terminal repeat sequence and an RNA processing signal, similar to the MFG class retroviral vector. The retroviral vector backbone pMSGV1 used in the present disclosure is a derivative of the vector pMSGV (MSCV-based splicing gagv vector), which utilizes the mouse stem cell virus (MSCV) long terminal repeat (LTR) [Hawley et al., Gene Ther. 1:136–138 (1994), and contains an extended gag region and env splice site from vector SFGtcLuc+ITE4 [Lindemann et al., Mol. Med. 1997; 3:466–476 (1997)]. Vector pMSGV was generated from pMINV [Hawley et al., Ann. NY Acad. Sci. 795:341–345. (1996)] by replacing the 756-bp SpeI / XhoI fragment with the 798-bp SpeI / XhoI fragment from SFGtcLuc+ITE4, and replacing the 1955-XhoI / Bam fragment containing the PGK-IRES-NEO cassette with a 47-XhoI / Bam polylinker containing unique Xho, EcoRI, SalI, SacII and BamHI sites. The vector pMSGV1 was derived from pMSGV by replacing the 43-bp PmlI / XhoI fragment of pMSGV with the 76-bp PmlI / XhoI fragment from the vector Gcsap [Onodera et al., J. Virol. 72:1769-1774 (1998)]. The latter modification incorporates a naturally occurring Cossack sequence to improve translation efficiency. In some alternative embodiments, the nucleic acid molecules and / or expression cassettes of the present invention may be contained in an adeno-associated virus (AAV). The term "adenovirus" is synonymous with the term "adenoviral vector". AAV is a single-stranded DNA virus with a small (~20 nm) protein capsule, belonging to the Parvoviridae family, and specifically refers to adenoviridae viruses. The term adenovirus refers collectively to animal adenoviruses of the genus Mammoadenovirus, including but not limited to human, bovine, ovine, equine, canine, porcine, murine and simian adenovirus subgenera. Specifically, human adenovirus includes subgenus AF and its individual serotypes, and individual serotypes and subgenus AF include but are not limited to human adenovirus 1, 2, 3, 4, 4a, 5, 6, 7, 8, 9, 10, 11 (Ad 11A and Ad IIP), 12, 13, 14, 15, 16, 17, 18, 19, 19a, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34a, 35, 35p, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 and 91 types.AAV is often referred to as a dependent virus because it cannot replicate without a helper virus co-infection (usually an adenovirus or herpes virus infection). AAV infection produces only a mild immune response and is considered non-pathogenic, a fact also reflected in the lower biosafety level requirements for recombinant AAV (rAAV) work compared to other popular viral vector systems. Due to its low immunogenicity and the absence of cytotoxic responses, AAV-based expression systems offer the possibility of expressing nucleic acid sequences encoding immune effectors of interest and engineered CAR T disclosed herein in quiescent cells for months. The production system of rAAV vectors usually consists of a DNA-based vector containing a transgenic expression cassette, flanked by inverted terminal repeat sequences. The construct size is limited to approximately 4.7-5.0 kb, which corresponds to the length of the wild-type AAV genome. rAAV is produced in a cell line. The expression vector is co-transfected with a helper plasmid that mediates the expression of the AAVrep gene important for viral replication and the cap gene encoding the protein that forms the capsid. Recombinant adeno-associated viral vectors can transduce dividing and non-dividing cells, and different rAAV serotypes can transduce different cell types. These single-stranded DNA viral vectors have high transduction rates and have the unique property of stimulating endogenous homologous recombination without causing double-stranded DNA breaks in the host genome.

[0502] It should be understood that many intermediate steps of the AAV wild-type infection cycle rely on specific interactions of the capsid protein with infected cells. When rAAV is used as a gene delivery tool, these interactions are key determinants for the efficient transduction and expression of nucleic acid molecules encoding immune effectors of interest and engineered CAR T disclosed herein. In fact, significant differences in the transduction efficiency of different serotypes for specific tissues and cell types have been described.

[0503] It is believed that the rate-limiting step of AAV-mediated transgene expression is the formation of double-stranded DNA. Recent reports have demonstrated the use of rAAV constructs with self-complementary structures (scAAV), in which the two halves of the single-stranded AAV genome can form intramolecular double strands. Compared with conventional single-stranded AAV expression constructs (ssAAV), this method reduces the effective genome size that can be used for gene delivery to about 2.3 kB, but results in a significant shortening of the start time of expression. Therefore, in some embodiments, ssAAV can be used as a viral vector by the methods of the present invention.

[0504] In some other embodiments, HDAd vectors may be suitable for the CAR molecules, coding sequences, cells, compositions and methods disclosed herein. Helper-dependent adenovirus (HDAd) vectors HDAd have innovative features, including being completely free of viral coding sequences and the ability to mediate high levels of transgenic expression, and having negligible chronic toxicity. HDAd is constructed by removing all viral sequences except the packaging sequence and the reverse terminal repeat sequence from the adenoviral vector genome, thereby eliminating the problem of residual viral gene expression associated with early adenoviral vectors. HDAd can mediate efficient transduction, does not integrate into the host genome, and has a large cloning capacity of up to 37kb, which allows the delivery of multiple transgenes or entire genomic loci, or large cis-acting elements to enhance or regulate tissue-specific transgenic expression. One of the most attractive features of HDAd vectors is the long-term expression of transgenes. Further, in some embodiments, SV40 can be used as a suitable vector by the method of the present invention. The SV40 vector (SV40) is a modified vector derived from Simian Virus-40 (an icosahedral papillomavirus). Recombinant SV40 vectors are good candidates for gene transfer because they exhibit some unique characteristics: the SV40 virus is a well-known virus, non-replicating vectors are easy to manufacture, and can be produced at titers of 10(12) IU / ml. They can also effectively transduce quiescent and dividing cells, deliver persistent transgene expression to a variety of cell types, and are non-immunogenic. The disadvantages of the rSV40 vectors currently used for gene therapy are low cloning ability and the risk of random integration of the viral genome into the host genome. In yet other alternative embodiments, lentiviral vectors can be used in the present invention. Lentiviral vectors are derived from lentiviruses of the retroviral subclass. Commonly used retroviral vectors are "defective", i.e., they cannot produce the viral proteins required for productive infection. Instead, the replication of the vector requires growth in a packaging cell line. In order to generate viral particles containing nucleic acid molecules, vectors and / or boxes according to the present invention, the retroviral nucleic acid containing the nucleic acid is packaged into a viral capsid by a packaging cell line. Different packaging cell lines provide different envelope proteins (ecotropic, amphoteric or heterotropic) incorporated into the capsid, which determine the specificity of the virus particles to cells (ecotropic to mice and rats; amphoteric to most mammalian cell types including humans, dogs and mice; heterotropic to most mammalian cell types except mouse cells). Appropriate packaging cell lines can be used to ensure that cells are targeted by packaged virus particles. Methods for introducing retroviral vectors of the nucleic acid molecules, vectors and / or cassettes of the present invention comprising nucleic acid sequences encoding CAT-T of the present invention into packaging cell lines and collecting virus particles produced by packaging cell lines are well known in the art.According to the present invention, non-viral vectors refer to all physical and chemical systems other than viral systems, generally including chemical methods such as cationic liposomes and polymers, or physical methods such as gene guns, electroporation, particle bombardment, ultrasound utilization and magnetofection. Such systems are less efficient than viral systems in gene transduction, but their cost-effectiveness, availability, and more importantly, reduced induction of the immune system compared to viral systems, and no restrictions on the size of the transgenic DNA, make them attractive for gene delivery.

[0505] For example, physical methods for in vitro and in vivo gene delivery are based on facilitating entry of DNA into target cells by transient penetration of cell membranes through mechanical, electrical, ultrasonic, hydrodynamic, or laser-based energy.

[0506] In more specific embodiments, the carrier can be a naked DNA carrier. More specifically, such carriers can be, for example, plasmids, minicircles or linear DNA. When injected directly, independent naked DNA can promote gene (2-19kb) transfer to skin, thymus, myocardium, and especially skeletal muscle and hepatocytes. It can also achieve long-term expression. Although naked DNA injection is a safe and simple method, its efficiency for gene delivery is quite low.

[0507] Minicircles are modified plasmids in which the bacterial origin of replication (ori) is removed so that they cannot replicate in bacteria. Linear DNA or Doggybone is a double-stranded linear DNA construct that encodes only an antigen expression cassette, comprising an antigen, a promoter, a polyA tail, and telomeric ends. It should be understood that all DNA vectors disclosed herein are also applicable to all nucleic acid molecules, vectors, and / or boxes used in the methods and compositions of the present invention as described herein. Further, it must be understood that the present invention further provides any vector or vehicle comprising any nucleic acid molecule, vector, and / or nucleic acid box disclosed herein, as well as any host cell expressing the nucleic acid molecule and / or nucleic acid box disclosed herein.

[0508] Another aspect of the present disclosure relates to a gene editing system, the gene editing system comprising:

[0509] First (i), at least one nucleic acid molecule according to the present disclosure, or any box, vector or vehicle comprising the at least one nucleic acid molecule; and

[0510] Second (ii), at least one gene editing component or a nucleic acid sequence encoding the gene editing component. In some specific embodiments, at least one nucleic acid molecule of the gene editing system provided by the present disclosure encodes at least one CAR molecule, and the at least one CAR molecule comprises the following components: (i), at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds BCMA; and optionally (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragment, derivative and variant thereof; and (iii) at least one intracellular T cell signal transduction domain. More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0511] As discussed herein, such systems also include any gene editing components discussed below that enable and facilitate the insertion of a nucleic acid sequence encoding any CAR molecule of the present disclosure into a target site within the genome of any target cell.

[0512] In some embodiments, the gene editing component of the gene editing system disclosed herein can be any of a site-specific nuclease, a class switch recombination, a site-specific integrase, and a site-specific recombinase.

[0513] In some embodiments, the gene editing component useful in the systems of the present disclosure may be CRISPR / Cas.

[0514] More specifically, in some embodiments, a site-specific nuclease is used to insert a CAR T encoding nucleic acid sequence (e.g., in a nucleic acid box) into a suitable target genomic locus. The nuclease may be one of the following: CRISPR / Cas9 / Cpf1 / CTc (1 / 2 / 3), SpCas9, SaCas9, engineered Cas9, ZFN, TALEN, homing endonuclease, Mega nuclease, Mega-TALEN. The nuclease may be encoded on a DNA vector, such as a plasmid, a minicircle, or a viral vector. Alternatively, an mRNA encoding a nuclease may be delivered, or the nuclease may be delivered as a protein. A guide RNA or a DNA vector encoding a guide RNA may be provided. Nuclease-catalyzed integration may utilize homologous arms flanking the DNA to be inserted, or utilize recognition sites of site-specific nucleases when these site-specific nucleases are encoded before or after the DNA to be inserted. Delivery of nucleases or vectors encoding nucleases may be performed in vivo or ex vivo using autologous or allogeneic cells, which will be discussed below.

[0515] As described above, in some embodiments, the nuclease for targeted insertion of the nucleic acid sequence encoding the desired CAR molecule disclosed herein may include at least one component of the CRISPR-Cas system. The clustered regularly spaced short palindromic repeats (CRISPR) system is a bacterial immune system that has been modified for genome engineering. The CRISPR-Cas system is divided into two categories. Class 1 systems use a complex of multiple Cas proteins to degrade exogenous nucleic acids. Class 2 systems use a single large Cas protein for the same purpose. More specifically, Class 1 can be divided into Types I, III, and IV, and Class 2 can be divided into Types II, V, and VI.

[0516] It should be understood that the present disclosure contemplates the use of any known CRISPR system, in particular any CRISPR system disclosed herein. The CRISPR-Cas system evolved in prokaryotes to protect against phage attack and undesired plasmid replication by targeting exogenous DNA or RNA. In bacterial immunity, the CRISPR-Cas system targets DNA molecules according to short homologous DNA sequences, which are called spacers, which were previously extracted from exogenous pathogen sequences by bacteria and inserted between repeat sequences as a memory system. These spacers are transcribed and processed, and this RNA is named crRNA or guide RNA (gRNA), which guides CRISPR-related (Cas) proteins to match (and / or complement) sequences (called protospacers) in exogenous DNA and then cut. Spacers or other suitable constructs or RNA can be reasonably designed and produced to target any DNA sequence. In addition, the recognition element can be individually designed to recognize and target any desired target, including targets outside bacteria.

[0517] In some specific embodiments, the CRISPR-Cas protein used in the present disclosure may be a CRISPR 2 class system. In some other specific embodiments, such a 2 class system may be any one of a CRISPR type and a V type system. In certain embodiments, the Cas applicable to the present invention may be any Cas protein of a CRISPR type system. Type II CRISPR-Cas systems include "HNH" type systems (streptococcal-like; also known as Nmeni subtypes, for Neisseria meningitidis serogroup Astr. Z2491, or CASS4), in which, in addition to the ubiquitous Cas1 and Cas2, Cas9, a single, very large protein, appears to be sufficient to produce crRNA and cut target DNA. Cas9 contains at least two nuclease domains, namely a RuvC-like nuclease domain near the amino terminus and a HNH (or McrA-like) nuclease domain in the middle of the protein. It should be understood that any type II CRISPR-Cas system is applicable to the present invention, specifically any one of type II-A or type B. Therefore, in some additional and alternative embodiments, the at least one Cas gene used in the methods and systems of the present invention may be at least one Cas gene of a type II CRISPR system (type II-A or type II-B). In more specific embodiments, the at least one cas gene of a type II CRISPR system used in the methods and systems of the present invention may be a cas9 gene.

[0518] According to such embodiments, the CRISPR-Cas protein used in the system of the present invention is CRISPR-associated endonuclease 9 (Cas9). Cas9's cleavage of double-stranded DNA (dsDNA) is a hallmark of the "Type II CRISPR-Cas" immune system. The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that exploits the complementarity of RNA:DNA to the target site (protospacer). After recognition between Cas9 and the target sequence, double-stranded DNA (dsDNA) cleavage occurs, generating a double-strand break (DSB).

[0519] As used herein, CRISPR II-type systems need to include two basic components: "guide" RNA (gRNA) and CRISPR-associated nuclease (Cas9). gRNA is an RNA molecule consisting of a "scaffold" sequence (also called tracrRNA) necessary for Cas9 binding and a "spacer" or "targeting" sequence of about 20 nucleotides long, which defines the genomic target to be modified. As used herein, guide RNA (gRNA) refers to the annealing of a synthetic fusion or endogenous tracrRNA to a targeting sequence (also called crRNA), providing the scaffold / binding ability and targeting specificity of the Cas9 nuclease. Also known as "single guide RNA" or "sgRNA" or specificity-conferring nucleic acid (SCNA).

[0520] In yet other specific embodiments, the Class 2 system according to the present invention may be a CRISPR type V system. In a more specific embodiment, the RNA-guided DNA-binding protein nuclease may be a CRISPR-associated endonuclease X (CasX) system or a CRISPR-associated endonuclease 14 (Cas14) system or a CRISPR-associated endonuclease F (CasF, also known as Cas12j) system. The V-type CRISPR-Cas system is characterized by a single RNA-guided nuclease containing a RuvC domain. Like the type II CRISPR-Cas system, the CRISPR type V system as used herein needs to include two basic components: gRNA and a CRISPR-associated endonuclease (CasX / Cas14 / CasF). gRNA is a short synthetic RNA consisting of a "scaffold" sequence necessary for CasX / Cas14 / CasF binding and a "spacer" or "targeting" sequence of approximately 20 nucleotides long, which defines the genomic target to be modified.

[0521] It should be noted that the gRNA used herein may comprise between about 3 nucleotides to about 100 nucleotides, specifically, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more. More specifically, between about 10 nucleotides to 70 nucleotides or more.

[0522] It should be noted that any CRISPR / Cas protein can be used by the gene editing system of the present disclosure. In some embodiments of the present disclosure, the endonuclease can be Cas9, CasX, Cas12, Cas13, Cas14, Cas6, Cpf1, CMS1 protein, or any variant thereof derived from or expressed from the following: Methanococcus maritima C7, Corynebacterium diphtheriae, Corynebacterium efficacious YS-314, Corynebacterium glutamicum (ATCC 13032), Corynebacterium glutamicum (ATCC 13032), Corynebacterium glutamicum R, Corynebacterium Kroppenstedt (DSM 44385), Mycobacterium abscessus (ATCC 19977), Nocardia dermatitis IFM10152, Rhodococcus erythropolis PR4, Rhodococcus justinii RFIA1, Rhodococcus opacus B4 (uid36573), Acidococcus cellulolyticus 11B, Arthrobacter chlorophenol A6, Cribelafollicularis (DSM 17836), Thermomonas curvatum (DSM43183), Bifidobacterium dentate Bd1, Bifidobacterium longum DJO10A, Snaeckia reducta (DSM 20476), Heper's Goddess EX H 1, Bacteroides fragilis NCTC 9434, Capnocytophaga flavophila (DSM 7271), Flavobacterium psychrophilum JIP02 86, Akkermansia muciniphila (ATCC BAA 835), Roseola photosyntheticum (DSM 13941), Roseola flexuviphila RS1, Synechocystis PCC6803, Mycobacterium Pei191, uncultured termite colony 1 bacterial phylotype Rs D17, Succinic acid-producing Bacillus S85, Bacillus cereus (ATCC 10987), Listeria innocua, Lactobacillus casei, Lactobacillus rhamnosus GG, Lactobacillus salivarius UCC118, Streptococcus agalactiae-5-A909, Streptococcus agalactiae NEM316, Streptococcus agalactiae 2603, Streptococcus dysgalactiae equisimilis GGS124, Streptococcus equi zooepidemicus MGCS10565, Streptococcus gallolyticus UCN34 (uid46061), Streptococcus gordonii variant CH1, Streptococcus mutans NN2025 (uid46353), Streptococcus mutans, Streptococcus pyogenes M1 GAS, Streptococcus pyogenes MGAS5005, Streptococcus pyogenes MGAS2096, Streptococcus pyogenes MGAS9429, Streptococcus pyogenes MGAS10270, Streptococcus pyogenes MGAS6180, Streptococcus pyogenes MGAS315, Streptococcus pyogenes SSI-1, Streptococcus pyogenes MGAS10750, Streptococcus pyogenes NZ131, Streptococcus thermophilus CNRZ1066, Streptococcus thermophilus LMD-9, Streptococcus thermophilus LMG 18311, Clostridium botulinum A3 Loch Maree, Clostridium botulinum B Eklund 17B, Clostridium botulinum Ba4657, Clostridium botulinum FLangeland, Clostridium cellulolyticum H10, Fingoldia grandis (ATCC 29328), Eubacterium rectale (ATCC 33656), Mycoplasma gallisepticum, Mycoplasma motile 163K, Mycoplasma penetrantum, Mycoplasma synoviae 53, Streptobacter, Echinobacterium moniliformis (DSM 12112), Bradyrhizobium BTAil, Nitrobacter hansenii X14, Rhodopseudomonas palustris BisB18, Rhodopseudomonas palustris BisB5, Microbacterium parvum DS-1, and Roseobacter zeae. DFL 12, Azoacetobacter Pal 5FAPERJ, Azoacetobacter Pal 5JGI, Azospirillum B510 (uid46085), Rhodospirillum crimsonii (ATCC 11170), Diaphorobacter TPSY (uid29975), Vermibacter eisenii EF01-2, Neisseria meningitidis 053442, Neisseria meningitidis α14, Neisseria meningitidis Z2491, Desulfovibrio halogenifer DSM2638, Campylobacter jejuni subspecies delay 269 97, Campylobacter jejuni subspecies delay 81116, Campylobacter jejuni subspecies delay, Campylobacter gull RM2100, Helicobacter hepatica, Wallia succinate, Tolumonas auensis DSM 9187, Pseudomonas atlanticus T6c, Shewanella sepia (ATCC 700345), Legionella pneumophila Paris, Actinobacillus succinogenes 130Z, Pasteurella multocida, Francisella tularensis U 112, Francisella tularensis holarctica, Francisella tularensis FSC 198, Francisella tularensis, Francisella tularensis WY96-3418, or Treponema denticola (ATCC 35405).

[0523] In some embodiments, a site-specific recombinase / integrase is used to insert a CAR T encoding nucleic acid sequence (e.g., in a nucleic acid box) into a suitable genomic locus. The recombinase / integrase may be one of the following: PhiC31, HK022, Cre, Flp, etc. The recombinase / integrase may be encoded on a DNA vector such as a plasmid, a minicircle, or a viral vector. Alternatively, an mRNA encoding a recombinase / integrase may be delivered, or the recombinase / integrase may be delivered as a protein. The delivery of a nuclease or a vector encoding a recombinase / integrase may be performed in vivo or ex vivo using autologous or allogeneic cells.

[0524] Another aspect of the present disclosure relates to genetically engineered cells of T cell lineages expressing at least one CAR molecule, or any cell population comprising at least one genetically modified cell as disclosed herein. More specifically, in some embodiments, the CAR expressed by the engineered cell comprises the following components: first (i), at least one target binding domain. It should also be noted that at least one target binding domain specifically recognizes and binds BCMA. The second component (ii) is at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragment, derivative and variant thereof. The CAR molecule also comprises at least one intracellular T cell signal transduction domain as a third component (iii). More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0525] In some embodiments, the present disclosure provides any genetically engineered cell that expresses any CAR molecule defined in the present disclosure.

[0526] In some embodiments, the genetically engineered cells of the present disclosure may be any hematopoietic cell. In some embodiments, such cells may be any lymphocyte. In yet other embodiments, such cells may be any cell of the T pedigree. In some specific embodiments, such cells are at least one T cell and / or at least one NK T cell.

[0527] As shown in this aspect, the present invention provides an engineered cell, which can be any lymphocyte, specifically any lymphocyte of the T lineage. "Lymphocytes" are mononuclear non-phagocytic leukocytes found in blood, lymph and lymphoid tissues. They are divided into two categories, B lymphocytes and T lymphocytes, which are responsible for humoral immunity and cellular immunity, respectively, according to individual development and function. Most are small lymphocytes with a diameter of 7-10 μm, with a round or slightly serrated heterochromatic nucleus that almost fills the entire cell, and a thin edge of basophilic cytoplasm containing a small amount of particles. When "activated" by contact with antigens, small lymphocytes begin macromolecular synthesis, the cytoplasm enlarges, until the cell diameter is 10-30 μm, and the nucleus becomes incompletely metachromatic; they are called large lymphocytes or lymphoblasts. These cells then proliferate and differentiate into B and T memory cells and various effector cell types: B cells differentiate into plasma cells, and T cells differentiate into helper cells, cytotoxic cells, and suppressor cells.

[0528] As indicated in the present disclosure, the genetically engineered cells expressing the CAR molecules disclosed herein may be cells of the T lineage. "T cells" or "T lymphocytes" as used herein are characterized by the presence of T cell receptors (TCRs) on the cell surface. It should be noted that T cells include helper T cells ("effector T cells" or "Th cells"), cytotoxic T cells ("Tc", "CTL" or "killer T cells"), memory T cells and regulatory T cells, as well as natural killer T cells, mucosal-associated invariants and γδ T cells.

[0529] More specifically, thymocytes are hematopoietic progenitor cells present in the thymus. Thymopoiesis is the process by which thymocytes in the thymus differentiate into mature T lymphocytes. The thymus provides an inductive environment that allows the development and selection of physiologically useful T cells. The processes of β-selection, positive selection, and negative selection form the thymocyte population into a peripheral T cell pool that is able to respond to foreign pathogens and has immune tolerance to self-antigens.

[0530] Thymocytes are divided into a number of different stages of maturation based on the expression of cell surface markers. The earliest thymocyte stage is the double negative (DN) stage (negative for both CD4 and CD8), which has recently been better described as lineage negative and can be divided into four substages. The next major stage is the double positive (DP) stage (positive for both CD4 and CD8). The final stage of maturation is the single positive (SP) stage (positive for either CD4 or CD8).

[0531] More specifically, the maturation stages of thymocytes may include the following substages: double negative 1 (DN1) or ETP (early T lineage progenitors) are characterized by CD44+CD25-CD117+ defined surface markers, thymocytes are located in the cortex, and loss of proliferation, B and myeloid potential is observed; double negative 2 (DN2) is characterized by CD44+CD25+CD117+ defined surface markers, thymocytes are located in the cortex; double negative 3 (DN3) is characterized by CD44-CD25+ defined surface markers, thymocytes are located in the cortex, and TCR-β rearrangement and β selection are observed; double negative 4 (DN4) is characterized by CD44-CD25 defined surface markers, thymocytes are located in the cortex; double positive is characterized by CD4+CD8+ defined surface markers, thymocytes are located in the cortex, and TCR-α rearrangement, positive selection, negative selection are observed; single positive is characterized by CD4+CD8- or CD4-CD8+ defined surface markers, thymocytes are located in the medulla, and negative selection is observed.

[0532] In humans, circulating CD34+ hematopoietic stem cells (HSC) are present in the bone marrow. They produce precursors of T lymphocytes, which inoculate the thymus (thus becoming thymocytes) and differentiate under the influence of Notch and its ligands. In the early stage, double negative thymocytes express CD2, CD5 and CD7 (and can be recognized by them). Still in the double negative stage, CD34 expression stops and CD1 is expressed. The expression of CD4 and CD8 makes them double positive and matures into CD4+ or CD8+ cells. It should be understood that the cells of the T lineage disclosed herein can be any thymocyte disclosed herein in any stage / substage and / or expressing any disclosed marker.

[0533] In some embodiments of the present invention, host cells are T cells. For the purposes of this article, T cells may be any T cells, such as cultured T cells, such as primary T cells, or T cells from cultured T cell lines, such as Jurkat, SupT1, etc., or T cells obtained from mammals. If obtained from mammals, T cells can be obtained from a variety of sources, including but not limited to blood, bone marrow, lymph nodes, thymus, or other tissues or liquids. T cells may also be enriched or purified. T cells may be human T cells. T cells may be T cells separated from the human body. T cells may be any type of T cells, and may be at any stage of development, including but not limited to CD4+ / CD8+ double positive T cells, CD4+ helper T cells, such as TH1 and TH2 cells, CD8+T cells (such as cytotoxic T cells), tumor infiltrating cells, memory T cells, untreated T cells, etc. T cells may be CD8+T cells or CD4+T cells.

[0534] In an embodiment of the present invention, the host cell is a natural killer (NK) cell. NK cells are a type of cytotoxic lymphocytes that play a role in the innate immune system. NK cells are defined as large granular lymphocytes, and constitute the third type of cells differentiated from common lymphocyte progenitor cells, which also produce B and T lymphocytes. NK cells differentiate and mature in bone marrow, lymph nodes, spleen, tonsils, and thymus. After maturation, NK cells enter the circulation as large lymphocytes with unique cytotoxic granules. NK cells can recognize and kill some abnormal cells, such as, for example, some tumor cells and virus-infected cells, and are considered to be important in the innate immune defense against intracellular pathogens. As described above with respect to T cells, NK cells can be any NK cells, such as cultured NK cells, such as primary NK cells, or NK cells from cultured NK cell lines, or NK cells obtained from mammals. If obtained from mammals, NK cells can be obtained from a variety of sources, including but not limited to blood, bone marrow, lymph nodes, thymus or other tissues or liquids. NK cells can also be enriched or purified. The NK cells are preferably human NK cells (eg, isolated from a human).

[0535] Further, in some alternative embodiments, the genetically engineered cell may be a B pedigree. Embodiments of the present invention also provide a cell colony comprising at least one host cell described herein (e.g., T pedigree). The cell colony may be a heterogeneous colony comprising a host cell, the host cell comprising any one of the nucleic acid sequences, boxes, vectors, and gene editing systems described herein and / or genetically engineered by it, and in addition comprises at least one other cell, such as a host cell (e.g., T cell) not comprising any recombinant expression vector, or cells other than T cells, such as B cells, macrophages, neutrophils, erythrocytes, hepatocytes, endothelial cells, epithelial cells, myocytes, brain cells, etc. Alternatively, the cell colony may be a substantially homogeneous colony, wherein the colony mainly comprises a host cell (e.g., consisting essentially of it), the host cell comprising a recombinant expression vector, a box, a gene editing system. The colony may also be a cell clone colony, wherein all cells of the colony are clones of a single host cell comprising a recombinant expression vector, so that all cells of the colony comprise a recombinant expression vector. In one embodiment of the invention, the cell population is a clonal population comprising genetically edited host cells and / or comprising nucleic acid sequences, cassettes and vectors as described herein.

[0536] The present disclosure provides cells, specifically cells of the T lineage, which are genetically engineered to express the CAR T molecules disclosed herein. However, it should be noted that the present disclosure also includes any host cell that contains a nucleic acid sequence, cassette or vector disclosed herein, is transfected, transformed and / or modified and / or edited by a nucleic acid sequence, cassette or vector disclosed herein.

[0537] The term "host cell" includes cells into which heterologous (e.g., exogenous) nucleic acids or proteins have been introduced. It will be understood by those skilled in the art that these terms refer not only to specific test cells, but also to the progeny of such cells. Because certain modifications may occur in offspring due to mutations or environmental influences, such progeny may actually be different from parental cells, but are still included in the scope of the term "host cell". As used herein, when exogenous or heterologous DNA, such as nucleic acid molecules of the present invention or any box, vector and / or gene editing system of the present invention are introduced into cells, the cell has been "transformed" or "transfected" by exogenous or heterologous DNA. The transforming DNA may be integrated (covalently linked) into the genome of the cell. For the purposes of the present invention, a stably transformed cell is a cell in which the transformed DNA has been integrated into a chromosome, thereby being inherited by daughter cells through chromosome replication. The ability of eukaryotic cells to establish cell lines or clones consisting of daughter cell groups containing transforming DNA demonstrates this stability. It should be understood that in some embodiments, the host cell of the present invention may be any engineered T cell of the present invention or any cell population at least partially comprising the T cell of the present invention. Still further, the present invention further encompasses any cell population comprising at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99.9% or more, specifically 100%), specifically 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99.9% or more, specifically 100% of the host cells, specifically the genetically engineered T cells of the present invention.

[0538] Another aspect of the present disclosure relates to a composition comprising at least one CAR molecule, any nucleic acid molecule comprising at least one nucleic acid sequence encoding the CAR molecule, or any box, vector, vector or gene editing system comprising the nucleic acid molecule, any host cell expressing the CAR molecule, and / or any genetically engineered cell expressing the T pedigree of the CAR or a cell population comprising at least one genetically engineered cell of the T pedigree. More specifically, such CAR molecules include the following components. First (i), at least one target binding domain; wherein at least one target binding domain in the target binding domain specifically recognizes and binds to BCMA. The second component (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragment, derivative and variant thereof. The CAR molecule also comprises at least one intracellular T cell signal transduction domain as a third component (iii). More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0539] It should be noted that, according to an optional embodiment, the composition of the present disclosure further comprises at least one of a pharmaceutically acceptable carrier, a diluent, an excipient and an additive.

[0540] Further, it should be understood that in some embodiments, the composition of the present invention may include any CAR molecule defined in the present disclosure. In some other or additional embodiments, the composition disclosed herein may include any nucleic acid molecule as defined in the present disclosure. In some other alternative or additional embodiments, the composition disclosed herein may include any gene editing system defined in the present disclosure. In some other alternative or additional embodiments, the composition disclosed herein may include any cell or cell population as defined in the present disclosure.

[0541] The composition of the present invention may include an effective amount of nucleic acid molecules and / or its box or any vector thereof or any cell comprising it or any CAR T molecule as described in the present invention. The term "effective amount" relates to the amount of the active agent present in the composition, specifically, the nucleic acid molecules, vectors and / or boxes of the present invention as described herein, which need to provide the desired level of active agent in the bloodstream of the individual to be treated or at the site of action (e.g., thymus or bone marrow) to produce the expected physiological response when such compositions are administered. The exact amount will depend on many factors, such as the activity of the active agent, the composition, the delivery device used, the physical properties of the composition, the intended patient use (i.e., the number of doses administered per day), patient considerations, etc., and can be easily determined by those skilled in the art based on the information provided herein. The "effective amount" of genetically engineered CAR T cells disclosed herein, or any nucleic acid molecule of the present invention or any box of the present invention and its gene editing system, can be administered in a single administration, or by multiple administrations of the total effective amount, preferably within 24 hours. Standard clinical procedures can be used to determine the appropriate dosage and timing. It should be understood that an "effective amount" may be the result of experience and / or individual (case-by-case) determination by the health care professional and / or individual conducting the treatment. Further, administration and dosage are determined by the attending physician's good medical practice and may depend on the age, sex, weight and general condition of the subject in need.

[0542] It should be understood that the effective amounts discussed herein are applicable to each embodiment of each aspect of the present disclosure, specifically, to any CAR molecule, CAR T cell expressing the CAR molecule of the present disclosure, and / or any nucleic acid sequence encoding the disclosed CAR molecule, any construct, or gene editing system comprising the same, any dosage form thereof, dosage unit form thereof, composition, kit, use and method thereof.

[0543] In some embodiments, the active ingredient of the therapeutic composition and / or dosage form disclosed herein is a T cell genetically engineered to express the HBI101 CAR molecule disclosed herein (also referred to herein as the H8BB CAR molecule). As shown in the clinical studies disclosed herein, various effective amounts of these cells are used. In some embodiments, the effective amount of HBI101 CAR T cells can be about 50x10 6 cells to about 1500x10 6 cells, specifically, 50x10 6 , 60x10 6 ,70x10 6 ,80x10 6 ,90x10 6 , 100x10 6 , 110x10 6 , 120x10 6、130x10 6 、140x10 6 、150x10 6 、160x10 6 、170x10 6 、180x10 6 、190x10 6 、200x10 6 、210x10 6 、220x10 6 、230x10 6 、240x10 6 、250x10 6 、260x10 6 、270x10 6 、280x10 6 、290x10 6 、300x10 6 、310x10 6 、320x10 6 、330x10 6 、340x10 6 、350x10 6 、360x10 6 、370x10 6 、380x10 6 、390x10 6 、400x10 6 、410x10 6 、420x10 6 、430x10 6 、440x10 6 、450x10 6 、460x10 6 、470x10 6 、480x10 6 、490x10 6 、500x10 6 、510x10 6 、520x10 6 、530x10 6 、540x10 6 、550x10 6 、600x10 6 、650x10 6 、700x10 6 、750x10 6 、800x10 6 、850x10 6 、900x10 6,950x10 6 , 1000x10 6 , 1050x10 6 , 1100x10 6 , 1150x10 6 , 1200x10 6 , 1250x10 6 , 1300x10 6 , 1350x10 6 , 1400x10 6 , 1450x10 6 , 1500x10 6 / HBI101CAR T cells / per dose. More specifically, the amount and / or number of HBI101 CAR T cells may be about 100x10 6 About 1000x10 6 Between about 90x10 6 About 900x10 6 Between about 150x10 6 About 800x10 6 Furthermore, in some embodiments, the effective amount and / or number of cells is 800 x 10 6 . HBI101 CAR T cells, per dose. In yet other embodiments, the effective amount and / or number of cells is 450x10 6 . HBI101 CAR T cells, per dose. Further, in some embodiments, the effective amount and / or number of cells is 150x10 6 . HBI101 CAR T cells, per dose. Further, in some embodiments, the effective amount and / or number of cells can be about 0.5x10 6 About 50x10 6 HBI101 CAR T cells / kg body weight. Specifically, about 1 to about 40, about 2x10 6 About 30x10 6 , about 2x10 6 About 25x10 6 , about 2x10 6 About 20x10 6 , about 2x10 6 About 15x10 6 , about 2x10 6 About 14x10 6 , about 2x10 6 About 13x10 6 , about 2x10 6 About 12x10 6, about 2x10 6 About 11x10 6 , about 2x10 6 About 10x10 6 HBI101 CAR T cells / kg body weight. In some specific and non-limiting embodiments, the effective amount of cells is 11x10 6 HBI101 CAR T cells / Kg body weight. In some other specific and non-limiting embodiments, the effective amount of cells is 10x10 6 HBI101CAR T cells / Kg body weight. Furthermore, in some embodiments, the effective amount may be 12x10 6 HBI101 CAR T cells / Kg body weight. In addition, as demonstrated by the clinical data disclosed herein, in some embodiments, 800x10 6 The dose provided a significant increase in efficacy without affecting toxicity. More specifically, as shown in Figure 34, about 58% of patients showed complete remission, OS was about 95% (at day 380 of the study), and PFS was about 70%. These results show that, in particular, when compared to prior art CAR T derived from C11D5-3 anti-BCMA antibody (e.g., in references [2], [5], and

[10] ), the use of lower doses of cells showed reduced efficacy. Therefore, in some embodiments, the effective amount as used herein refers to 800x10 6 daily dose.

[0544] According to good medical practice, the pharmaceutical composition of the present invention can be systemically administered and administered by the method of the present invention, for example, by parenteral administration, such as intrathymic administration, intramedullary administration and intravenous administration. However, it should be noted that the present invention can further encompass additional modes of administration. In other embodiments, the pharmaceutical composition can be introduced into a site by any suitable route, including intraperitoneal, subcutaneous, transdermal, topical, intramuscular, intraarticular, subconjunctival or mucosal, such as oral, intranasal or intraocular administration.

[0545] Local administration to the area in need of treatment can be achieved by, for example, local infusion during surgery, topical application, direct injection into specific organs (bone marrow, spleen, lymph nodes), etc. More specifically, the compositions described herein for use in any method of the invention can be suitable for administration by parenteral, intraperitoneal, transdermal, oral (including buccal or sublingual), rectal, topical (including buccal or sublingual), vaginal, intranasal, and any other appropriate route. Such formulations can be prepared by any method known in the pharmaceutical art, for example, by associating the active ingredient with a carrier or excipient.

[0546] More specifically, the pharmaceutical composition for treating a subject in need thereof according to the present invention can be conveniently present in a unit dosage form and can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of associating the active ingredient with a pharmaceutical carrier or excipient. Generally speaking, the preparation of the formulation is by uniformly and closely associating the active ingredient, specifically, the carrier, nucleic acid molecule or any box thereof of the present invention, with a liquid carrier or a finely dispersed solid carrier or both, and then, if necessary, molding the product. The composition can be formulated into any of many possible dosage forms, such as but not limited to tablets, capsules, liquid syrups, soft gels, suppositories and enemas. The composition of the present invention can also be formulated as a suspension in an aqueous, non-aqueous or mixed medium. The aqueous suspension may further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain a stabilizer. The pharmaceutical composition of the present invention also includes, but is not limited to, emulsions and preparations containing liposomes. It should be understood that, in addition to the ingredients specifically mentioned above, the preparation may also contain other conventional agents in the art that have been discussed for the type of preparation. In addition, a pharmaceutical formulation is a composition comprising one or more nucleic acid molecules, vectors and / or expression cassettes and / or cells in a pharmaceutically acceptable vehicle. A "pharmaceutically acceptable carrier" may be a carrier approved by a regulatory agency of a federal or state government, or a carrier listed in the U.S. Pharmacopoeia or other recognized pharmacopoeia for use in mammals, such as humans. When referring to the compositions of the present invention, the term "vehicle" refers to a diluent, adjuvant, excipient or carrier with which the compounds of the present invention are formulated for administration to a mammal. Such pharmaceutical vehicles may be lipids, such as liposomes, such as liposomal dendrimers; liquids, such as water and oils, including those of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc., saline; gum arabic, gelatin, starch paste, talc, keratin, silica gel, urea, etc. In addition, adjuvants, stabilizers, thickeners, lubricants and colorants may be used. The pharmaceutical composition can be formulated into a solid, semisolid, liquid or gaseous preparation, such as a tablet, capsule, powder, granule, ointment, solution, suppository, injection, inhalant, gel, microsphere and aerosol. Therefore, the nucleic acid molecules encoding the CAR of the present invention or any engineered cells of the T pedigree and the administration of the system of the present invention can be achieved in various ways, including oral, oral, rectal, parenteral, intraperitoneal, intradermal, transdermal, intradermal and other administrations. The active agent can affect the whole body after administration, or can be positioned by using regional administration, intramural administration or using an implant for retaining the active agent at the implantation site. The active agent can be formulated to act immediately, or it can be formulated to be continuously released.

[0547] In many embodiments, the compositions of the present invention can be administered in the form of a combination therapy, i.e., in combination with one or more additional therapeutic agents. Combination therapy may include administering a single pharmaceutical dosage form comprising at least one composition of the present invention and an additional therapeutic agent; and administering at least one composition of the present invention and one or more additional drugs in its separate pharmaceutical dosage form. In addition, when separate dosage formulations are used, the composition of the present invention and one or more additional agents may be administered simultaneously or at separate staggered times, i.e., sequentially. Further, they may be administered simultaneously or separately by the same or different routes of administration. Therefore, in some additional embodiments, the CAR T molecules, nucleic acid sequences, boxes, systems, and cells disclosed herein may be suitable for enhancing the immune response of subjects with immune-related disorders, specifically, any disorder involving B cells or B cell malignancies, and may be used in combination therapy with any therapeutic agent, such as a chemotherapeutic agent.

[0548] As used herein, "chemotherapeutic agent" or "chemotherapeutic drug" (also known as chemotherapy) refers to a drug treatment intended to eliminate or destroy (kill) cancer cells or any other proliferative disease cells. The underlying mechanism of activity of some chemotherapeutic drugs is based on the destruction of rapidly dividing cells, because many cancer cells grow and reproduce faster than normal cells. Due to their mode of activity, chemotherapeutic agents also damage cells that normally divide rapidly, such as bone marrow cells, digestive tract cells, and hair follicles. Damage or destruction of normal cells can lead to common side effects of chemotherapy: bone marrow suppression (reduced blood cell production, therefore also suppressing immunity), mucositis (inflammation of the lining of the digestive tract), and alopecia (hair loss).

[0549] There are various different types of chemotherapeutic drugs available. In addition to the drugs of the present disclosure, chemotherapeutic drugs can be used alone or in combination with another chemotherapeutic drug or other forms of cancer treatment, for example, other biological drugs (antibodies, ligands, receptors), radiation therapy or surgery.

[0550] Chemotherapeutic drugs affect cell division or DNA synthesis and function, and can generally be classified into several groups according to their structure or biological function. More specifically, chemotherapeutic agents are classified as alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other anti-tumor agents, such as DNA alkylating agents, anti-tumor antibiotics, tubulin stabilizers, tubulin destabilizers, hormone antagonists, protein kinase inhibitors, HMG-CoA inhibitors, CDK inhibitors, cell cycle protein inhibitors, caspase inhibitors, metalloproteinase inhibitors, antisense nucleic acids, triple helix DNA, nucleic acid aptamers, and molecularly modified viruses, bacteria or exotoxin agents. It should be understood that any combination therapy disclosed herein, using any specified compound of CART, DNA cassettes, systems and cells disclosed herein, and any therapeutic agent discussed above, are included in the present disclosure.

[0551] Further, in some embodiments, the construct encoding the disclosed CAR molecule of the present disclosure, also referred to herein as HBI0101 (prepared at clinical grade), can be produced by transiently transfecting Phoenix-ECO cells (ATCC) with a plasmid encoding the γ-retroviral vector MSGV1-HBI0101 using JetPrime reagent (Tamar), followed by transduction of PG13 cells (ATCC) with HBI0101-Phoenix-ECO cell-free vector supernatant. The PG13-transduced population is then subcloned by limiting dilution, and PG13-HBI0101 is amplified to generate a seed bank. The certified PG13 seed bank is sent to the Indiana University Vector Production Facility (IU-VPF) in Indianapolis, which has generated a master cell bank (MCB) and a GMP-certified HBI0101 clinical-grade retroviral supernatant for transduction of autologous T cells in MM patients.

[0552] In addition, for ex vivo transduction of cells, peripheral blood mononuclear cells are isolated from the blood of a subject (e.g., AL and / or multiple myeloma patient), and CD3 activated peripheral blood mononuclear cells are used for further production. Blood is collected from AL or / and multiple myeloma (0253–20-HMO) patients and treated, for example, and peripheral blood mononuclear cells (PBMCs) are separated using a Ficoll gradient. PBMCs are isolated at 1x10 per mL. 6 The cells were suspended at a concentration of 10 cells in T cell culture medium (e.g., TCM) containing AIM-V (e.g., Gibco) supplemented with 5% human serum (e.g., Valley), 1% Glutamax (e.g., Gibco). IL2 (e.g., 300 IU / mL; e.g., Proleukin, Novartis) and anti-CD3 monoclonal antibody OKT-3 (e.g., 50 ng / mL; Miltenyi Biotech) were added to TCM and cultured for 2 days. Tissue culture untreated 24-well plates (e.g., R / N; Takara) were coated with 10 mg / mL RectroNectin in PBS (e.g., Lonza) overnight at 4°C, followed by blocking with 2.5% human albumin in PBS for 30 minutes and then washed. Retroviral supernatant was thawed, diluted 1:20 with TCM, added to the wells, and centrifuged at 2,000 g for 2 hours at 32°C. The supernatant was then aspirated and 0.5x10 6CD3 activated PBMC / mL was inoculated into each well of TCM containing 300IU / mL IL2, centrifuged at 1,000g for 10 minutes, and incubated overnight at 37°C. Activated but untransduced (NT) cells were generated and used as T cell controls. On the 6th and 10th day of culture, BCMA CART cells were labeled with human recombinant BCMA protein via flow cytometry to determine transduction efficacy (e.g., activity; ACRO).

[0553] Furthermore, in some embodiments, for clinical-grade production of HBI0101 cells, the same protocol as described above for cell production for ex vivo applications can be used. The source of starting materials, the use of clinical-grade culture media and reagents, and production under GMP conditions are modified to generate CART cells suitable for clinical use.

[0554] More specifically, in some embodiments, leukocytes are collected by leukocyte removal using the Spectra Optia apheresis system on the 10th day. Cells are separated into peripheral mononuclear cells (eg, PBMCs) and T cells are stimulated with anti-CD3 and IL-2. On the 8th day, the stimulated T cells are transduced overnight with 1 / 25 or 1 / 50 diluted HBI0101 retroviral supernatant. Then, the cells are inoculated into a GRex100 device filled with AIM-V culture medium (Gibco), which is supplemented with 5% human AB serum (Access Cell Culture or Valley), 1% glutamine (Gibco) and 300IU / mL IL-2 for seven days of expansion. In some embodiments, culture medium and IL-2 are supplemented every 2-3 days. On the day of patient infusion, cells are washed 3 times with saline (Kedrion) containing 1% human albumin, and then formulated into a final drug product (DP) with a concentration of 15x106CART cells / mL in saline containing 2.5% human albumin. DP infusion volume varies depending on cell dose.

[0555] In addition, in some embodiments, quality control tests of in-process (IP) and finished product (EOP) HBI0101 units are performed along the manufacturing process. In some embodiments, quality control tests may include: i) Determine the transduction percentage, evaluated by flow cytometry using BCMA-FITC recombinant protein (e.g., ACROBiosystems), and performed on day 7, day 2, and day 0; ii) In vitro efficacy of CART cells, measured by ELISA (R&D) after stimulation of myeloma cell lines, release of interferon-γ, and performed on day 2; iii) Determine the vector copy number (CPN) by real-time (RT) PCR of genomic DNA of transduced cells on day 2; iv) PCR analysis of genomic DNA of transduced cells using GALV primer sets confirms that there is no replication-competent retrovirus (RCR) on day 2, as detailed in 3; v) Characterization of different cell subpopulations is performed by flow cytometry on day 0, using the following antibody mixture: anti-CD3 (e.g., Beckman Coulter), anti-CD4 (e.g., Biolegend), anti-CD8 (e.g., BD), anti-CD56 (e.g., Biolegend), anti-CD19 (e.g., Biolegend), and anti-CD14 (e.g., Beckman Coulter); vi) pH of DP was assessed on day 0. All test parameters represent the release criteria for the final DP, the specifications of which are further detailed in Table 5. In addition, and in accordance with Annex 1 Advanced Therapy Medicinal Products (ATMP) Guidelines, IP and EOP HBI0101 cells were tested in accordance with Fig. 12B Sterility testing was performed according to the schedule detailed in . Sterility testing was performed by an outsourced GMP certified facility (HyLab).

[0556] Another aspect of the present disclosure relates to a method for treating, preventing, ameliorating, inhibiting or delaying the onset of an immune-related disorder in a mammalian subject. In some embodiments, the method comprises the step of administering to the subject an effective amount of at least one of the following:

[0557] (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one box, vector vector or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell (specifically, a cell of the T lineage) expressing the CAR, or such a cell population; and (d) a composition comprising at least one of (a), (b) and (c). More specifically, in some embodiments of the disclosed method, such CAR molecules comprise the following components. First (i), at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; second (ii), at least one hinge domain and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises an amino acid sequence as shown in SEQ ID NO:9, and any fragments, derivatives and variants thereof. The CAR molecule also comprises at least one intracellular T cell signaling domain as a third component (iii). More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0558] In some embodiments, at least one target binding domain of the CAR molecule of the disclosed method comprises: (i) at least one target recognition element; and / or (ii) at least one adapter component that recognizes and binds to at least one labeled target recognition element.

[0559] In some embodiments, such adaptor components may comprise at least one moiety that specifically recognizes and binds to at least one tag of a labeled target recognition element.

[0560] In some additional embodiments, the target recognition domain of the CAR molecule of the disclosed method comprises at least one antibody, or any antigen-binding fragment, portion, or chimera thereof, specific for the target BCMA.

[0561] In yet other embodiments, the antigen-binding fragment, portion, or chimera of an antibody used as the target recognition domain of the CAR molecule of the disclosed method comprises at least one of a scFv and / or a nanobody.

[0562] In a more specific embodiment, the antibody used as the target recognition domain of the CAR molecule of the disclosed method specifically recognizes and binds to the BCMA protein. In a more specific embodiment, the antibody comprises an immunoglobulin HC containing an amino acid sequence as shown in SEQ ID NO: 3 and any derivatives and variants thereof, and an immunoglobulin LC containing an amino acid sequence as shown in SEQ ID NO: 5 and any derivatives and variants thereof.

[0563] In a more specific embodiment, at least one target binding domain of the CAR used by the disclosed methods comprises the amino acid sequence shown in SEQ ID NO: 11, and any derivatives and variants thereof.

[0564] Further, in some embodiments, the hinge and transmembrane domains of the CAR used by the presently disclosed methods comprise the amino acid sequence shown in SEQ ID NO: 6, and any derivatives and variants thereof.

[0565] In some other embodiments, at least one intracellular T cell signaling domain of the CAR used by the disclosed method includes at least one TNF receptor family member. In some embodiments, such TNF receptor family members are 4-1BB. Therefore, the CAR molecule used by the disclosed method includes at least one intracellular T cell signaling domain derived from 4-1BB protein. In some other embodiments, the CAR molecule used by the disclosed method includes at least one intracellular T cell signaling domain derived from TCR molecules. More specifically, the CAR molecule used by the disclosed method includes at least one intracellular T cell signaling domain derived from CD3ζ chain.

[0566] In some specific embodiments, at least one intracellular T cell signaling domain of the CAR molecule used by the presently disclosed method comprises the amino acid sequence shown in SEQ ID NO: 12, and any derivatives and variants thereof.

[0567] In yet other specific and non-limiting embodiments, the CAR molecule used by the CAR method of the present disclosure comprises an amino acid sequence as shown in SEQ ID NO: 1, or any variants and derivatives thereof, for example, the CAR T molecule of SEQ IS NO: 40 does not contain a leader sequence.

[0568] Furthermore, in some embodiments of the disclosed methods, expression of a CAR molecule by at least one cell of the T lineage of a subject treated with the methods of the invention results in at least one of the following alternative or additional effects.

[0569] In some alternative or additional embodiments, the expression of CAR molecules by at least one cell of the T pedigree of a subject treated with the methods of the present disclosure results in (i) increased specificity for the target. In particular, the specificity for any cell expressing the target BCMA increases. In some other or alternative embodiments, the expression of CAR molecules by at least one cell of the T pedigree of a subject treated with the methods of the present invention results in (ii) reduced tonic signaling. Further, in some additional or alternative embodiments, the expression of CAR molecules by at least one cell of the T pedigree of a subject treated with the methods of the present invention results in (iii) reduced off-target activation. In some additional or alternative embodiments, the expression of CAR molecules by at least one cell of the T pedigree of a subject treated with the methods of the present invention results in (iv) increased activation marker expression in response to specific stimulation. According to some embodiments, such activation markers may be, for example, at least one of CD137, CD25, CD69. It should be further understood that specific stimulation as used herein is the presence of BCMA-positive target cells. Further, in some additional or alternative embodiments, the expression of CAR molecules by at least one cell of the T pedigree of the subject treated with the method of the present invention leads to (v) reduced exhaustion marker expression in response to a specific stimulus. More specifically, in some embodiments, the exhaustion marker may be at least one of PD-1, LAG-3, TIM3, TIGIT. In some other alternative or additional embodiments, the expression of CAR molecules by at least one cell of the T pedigree of the subject treated with the method of the present invention leads to an increased survival rate of the subject treated with (vi). Further, in some additional and / or alternative embodiments, the expression of CAR molecules by at least one cell of the T pedigree of the subject treated with the method of the present invention leads to a reduced recurrence rate in the subject treated with (vii). In addition, in some specific alternative and / or additional embodiments, the expression of CAR molecules by at least one cell of the T pedigree of the subject treated with the method of the present invention leads to a long-term effect in the subject treated with (viii). More specifically, in some embodiments, the disclosed CAR molecules and CAR T cells thereof, and any compositions, systems and methods thereof, result in an increase in the survival rate of the treated subject. As used herein, the increase in survival rate refers to any increase in overall survival rate, progression-free survival or disease-free survival rate. Further, in some embodiments, overall survival rate (also referred to herein as OS) is the length of time that patients diagnosed with the disease still survive from the diagnosis date of the disease (eg, cancer) or the start of treatment. In clinical trials, measuring overall survival rate is a way to observe the effect of new therapies. In some other embodiments, progression-free survival (also referred to herein as PFS) is the length of time that patients live with the disease but the condition does not worsen during and after the treatment of a disease (such as cancer).In clinical trials, measuring progression-free survival is a way to observe how new therapies work. In yet other embodiments, the disclosed CAR molecules and CAR T cells thereof, as well as any compositions, systems and methods thereof, result in an increase in DFS. Disease-free survival (also referred to herein as DFS, recurrence-free survival and RFS). In cancer, after the primary treatment of cancer is completed, the length of time that the patient survives without any signs or symptoms of the cancer. In clinical trials, measuring disease-free survival is a way to observe the effects of new therapies.

[0570] In yet other embodiments, the disclosed CAR molecules and CAR T cells thereof, as well as any compositions, systems and methods thereof, result in a reduced relapse rate. As used herein, the term "relapse" relates to the recurrence of a condition, disease or disorder that affected a person in the past, or any signs and symptoms of a disease after a period of improvement. For example, the term relates to the recurrence of a disease treated with any therapeutic compound, such as the HBI101 CAR T cells of the present disclosure.

[0571] In some embodiments, the reduction in relapse rate is determined according to the International Myeloma Working Group (IMWG). More specifically, clinical relapse of multiple myeloma requires one or more of the following: the appearance of new soft tissue plasmacytomas or bone lesions; a significant increase in the size of existing plasmacytomas or bone lesions. A confirmed increase is defined as an increase of 50% (at least 1 cm), which is measured continuously by the sum of the products of the cross-diameters of measurable lesions, hypercalcemia (>11.5 mg / dL) [2.65 mmol / L], a decrease in hemoglobin of >2 g / dL [1.25 mmol / L], and an increase in serum creatinine of 2 mg / dL or more [177 mmol / L or more].

[0572] Further, in some embodiments, the disclosed CAR molecules and CAR T cells thereof, as well as any compositions, systems and methods thereof, provide long-term effects as demonstrated in the examples. More specifically, in some embodiments, long-term effects refer to higher proliferation capacity and sustained long-term survival benefits to T cells, including the growth of central memory T cells (Tcm), significantly enhanced respiratory capacity, increased fatty acid oxidation and enhanced mitochondrial biogenesis. T cell memory is an important component of immune response. After antigen-driven amplification and effector T cells die after antigen clearance, some remaining T cells differentiate into two different types of memory T cells: central memory (Tcm) (labeled as CD45RO+CCR7+ cells) and effector memory T cells (Tem) (labeled as CD45RO+CCR7- cells). The first cell is located in lymphoid organs and bone marrow and has a high proliferation capacity, while the second cell is present in peripheral tissues in a pre-activated form, enabling them to immediately recognize pathogens. Untreated cells and memory T cells rely mainly on mitochondrial oxidation of free fatty acids to develop and maintain. In contrast, activated effector T cells shift toward glycolysis or upregulate both oxidative phosphorylation and aerobic glycolysis to meet the metabolic demands of proliferation.

[0573] In some embodiments, the therapeutic methods of the present disclosure may use any molecule in the CAR molecules defined by the present disclosure. In some other or additional embodiments, the methods of the present disclosure may use any nucleic acid molecule in the nucleic acid molecules defined by the present disclosure. In some other alternative or additional embodiments, the methods of the present disclosure may use any gene editing system defined by the present disclosure. In some other alternative or additional embodiments, the methods of the present disclosure may use any cell or cell population in a cell or cell population as defined by the present disclosure. In some other alternative or additional embodiments, the methods of the present disclosure may use any composition in the composition defined by the present disclosure.

[0574] As described herein, the present disclosure provides methods that allow for in vivo as well as ex vivo or in vitro genetic engineering of T lineage cells to express the CAR T molecules of the present invention. In the case of ex vivo or in vitro cell engineering, the engineered cells are transferred back to the subject by adoptive transfer.

[0575] The term "adoptive transfer" as defined herein applies to all treatments consisting of the transfer of immune system components, specifically, cells that are already capable of producing a specific immune response. In such options, targeted insertion of nucleic acid sequences encoding CAR Ts disclosed herein is performed in cells of autologous or allogeneic origin and then specifically administered to a subject by adoptive transfer.

[0576] In some embodiments, the cells expressing, comprising, transducing or transfecting the nucleic acid molecules of the present invention or any boxes provided by the present invention can be cells of autologous origin. When it comes to cell sources, the term "autologous" refers to cells derived from or transferred from the same subject to be treated by the methods of the present invention. When it comes to cell sources, the term "allogeneic" refers to cells from or transferred from different subjects (referred to herein as donors) of the same species.

[0577] In some embodiments of the methods of treatment disclosed herein, at least one cell of the T lineage expressing the CAR molecule is administered to the subject, and / or the subject is genetically engineered with at least one nucleic acid box or any vector or vector comprising the box, or with a cell population comprising cells of the T lineage expressing the CAR molecule disclosed herein. According to such embodiments, the genetic engineering of the cell is performed in vitro or in vitro. In yet other embodiments, such cells are of autologous or allogeneic origin.

[0578] In some alternative embodiments, the genetic engineering of T lineage cells is performed in the treated subject. In such cases, the subject treated by the treatment method disclosed herein is administered a nucleic acid molecule comprising at least one nucleic acid sequence encoding the CAR T molecule disclosed herein, or any box, vector or gene editing system comprising it. As described above, gene editing of cells of the T lineage to express the CAR molecules disclosed herein is performed in the treated subject. In some other embodiments, the appropriate vector for such methods is any one of a viral vector, a non-viral vector and a naked DNA vector.

[0579] It should be understood that any vector disclosed herein (e.g., viral vector) in conjunction with other aspects of the disclosure may also be suitable for genetic engineering of T-lineage cells, either ex vivo, in vitro, or alternatively, in vivo in a treated subject.

[0580] In addition, as discussed herein, in some embodiments of the treatment methods disclosed herein, the insertion of a nucleic acid sequence encoding a CAR into the genome of a cell line cell of a subject is mediated by a site-specific nuclease. Such a nuclease is at least one PEN. It should be understood that the use of PEN as discussed herein can be applied to the introduction of a CAR encoding nucleic acid sequence into a T cell genome in vivo or in vitro / in vitro. In yet other specific embodiments, the PEN comprises at least one CRISPR / Cas protein system. Therefore, in the case of genetic engineering of T cells in vivo, according to such embodiments, the method further comprises the step of administering to the subject being treated at least one of the following items:

[0581] (a) at least one CRISPR / cas protein, or any nucleic acid molecule encoding the Cas protein; and (b) at least one nucleic acid sequence, the at least one nucleic acid sequence comprising at least one gRNA, the at least one gRNA targeting inserting the nucleic acid sequence encoding the CAR into the genomic sequence, or any nucleic acid sequence encoding gRNA; or any kit, composition or medium comprising at least one of (a) and (b). However, it should be understood that when the genetic engineering of T lineage cells is performed in vitro / ex vivo, and the subject is administered with genetically engineered cells expressing the CAR molecules disclosed herein, the editing of the cell (autologous or allogeneic cells) is performed by contacting the cell with at least one CRISPR / cas protein and gRNA, as described above.

[0582] Further, in some embodiments, the treatment methods disclosed herein are applicable to any pathological condition, in particular, a condition associated with BCMA protein expression in B-lineage cells. In yet other embodiments, the treatment methods may be applicable to any condition associated with regulated expression, stability and / or activity of BCMA protein. In some specific embodiments, the disclosed methods are applicable to conditions associated with and / or characterized by overexpression of BCMA protein.

[0583] Still further, in some embodiments, such disorder is at least one of: at least one plasma cell disorder, at least one proliferative disorder, at least one deposition disorder, and / or at least one autoimmune disease, or any B cell-mediated or associated disorder.

[0584] In some embodiments, the disclosed methods are applicable to treating at least one plasma cell pathology. Plasma cell pathology refers herein to any condition involving plasma cells. For example, multiple myeloma, myeloma, and myeloid plasmacytoma are malignant diseases of the germinal center B cells based on the bone marrow, characterized by clonal proliferation of plasma cells, and associated serum and / or urine monoclonal proteins.

[0585] In some embodiments, the plasma cell disorder may include any of multiple myeloma (MM), amyloidosis (AL), monoclonal gammopathy of undetermined significance (MGUS), plasmacytoma (PL), and / or Waldenstrom's macroglobulinemia (WDS).

[0586] Furthermore, as used herein, monoclonal gammopathy of undetermined significance (MGUS) is an asymptomatic pro-neoplastic plasma cell disease characterized by serum M-protein less than 30 g / L, bone marrow clonal plasma cells less than 10%, and the absence of plasma cell myeloma-related end-organ damage (hypercalcemia, renal insufficiency).

[0587] In some embodiments, the plasmacytoma (PL) is a plasma cell dyscrasia, wherein the plasmacytoma grows within the soft tissue or within the axial skeleton.

[0588] As used in this article Macroglobulinemia (WDS) is a neoplastic condition affecting lymphoplasmacytoid cells and plasma cells. It is characterized by high levels of a circulating antibody, immunoglobulin M (IgM), which is produced and secreted by cells involved in the disease. WDS is an "indolent lymphoma" (characterized by slow growth and spread) and a lymphoproliferative disorder that shares clinical features with indolent non-Hodgkin lymphoma. It is generally classified as a plasma cell dyscrasia, similar to other plasma cell dyscrasias, such as those that lead to multiple myeloma.

[0589] Multiple myeloma (MM) and amyloidosis (AL) are described in more detail below.

[0590] As described above, the treatment methods disclosed herein may be applicable to any condition associated with the expression (e.g., regulated expression, specifically overexpression) of BCMA protein. Examples of such conditions include B cell tumor conditions as described above. However, it should be understood that in some embodiments, the condition may be any proliferative condition, or any neoplastic condition. In some embodiments, the disclosed methods may be applicable to any tumor, benign tumor, in situ tumor or malignant tumor. As used herein to describe the present invention, "proliferative conditions", "cancer", "tumor" and "malignant tumor" all equally relate to the proliferation of tissues or organs. If the tissue is part of the lymphatic or immune system, the malignant cells may include non-solid tumors of circulating cells. Malignant tumors of other tissues or organs may produce solid tumors. In general, the methods, compositions and kits of the present invention may be applicable to patients suffering from any of non-solid tumors and solid tumors.

[0591] The malignant tumor considered in the present invention can be any of lymphoma, leukemia, myeloma, carcinoma, melanoma and sarcoma. Therefore, in some embodiments, any method of the present invention disclosed herein (assuming that they directly or indirectly involve the expression of B cells and / or BCMA), system and composition can be applied to any malignant tumor disclosed in the present disclosure.

[0592] More specifically, myeloma as mentioned herein is a cancer of plasma cells, which are a class of white blood cells that are usually responsible for producing antibodies. Collections of abnormal cells accumulate in bones, where they cause bone damage, and accumulate in the bone marrow, where they interfere with the production of normal blood cells. Most myeloma cases are also characterized by the production of paraproteins, an abnormal antibody that can cause kidney problems and interfere with the production of normal antibodies that lead to immunodeficiency. Hypercalcemia (high calcium levels) is often encountered.

[0593] Lymphoma is a cancer in the lymphocytes of the immune system. Typically, lymphomas occur as solid tumors of lymphoid cells. These malignant cells often originate in the lymph nodes, where they appear as enlargements (tumors) of the nodes. It can also affect other organs, in which case it is called extranodal lymphoma. Non-limiting examples of lymphomas include Hodgkin's disease, non-Hodgkin's lymphoma, and Burkitt's lymphoma.

[0594] Leukemia refers to a progressive malignant disease of the blood-forming organs and is generally characterized by abnormal proliferation and development of white blood cells and their precursors in the blood and bone marrow. Leukemias are generally classified clinically based on: (1) the duration and characteristics of the disease, whether acute or chronic; (2) the cell type involved; myeloid (myelocytic), lymphoid (lymphoblastic), or monocytic; and (3) an increase or absence of an increase in the number of abnormal cells in the leukemic or leukopenic (subleukemic) blood.

[0595] Furthermore, carcinoma as used herein refers to an invasive malignant tumor composed of transformed epithelial cells. Alternatively, it refers to a malignant tumor composed of transformed cells of unknown tissue origin, but it has specific molecular or histological features associated with epithelial cells, such as the production of cytokeratin or intercellular bridges.

[0596] Melanoma, as used herein, is a malignant tumor of melanocytes. Melanocytes are cells that produce the dark pigment melanin, which is responsible for the skin color. They are found primarily in the skin, but also in other parts of the body, including the intestines and eyes. Melanoma can occur in any part of the body that contains melanocytes.

[0597] Sarcomas are cancers that arise from transformed connective tissue cells. These cells originate from the mesoderm, or middle layer, of the embryo that forms bone, cartilage, and fat tissue. This is in contrast to cancers that originate from the epithelium. The epithelium lines the surfaces of structures throughout the body and is the origin of breast, colon, and pancreatic cancers.

[0598] It should be understood that the CAR molecules, nucleic acid molecules, cells, gene editing systems, compositions and methods disclosed herein are applicable to any type and / or stage and / or grade of any malignant condition discussed herein or any metastasis thereof. Further, it must be understood that the methods, compositions and systems of the present invention are applicable to invasive as well as non-invasive cancers. When referring to "non-invasive" cancers, it should be noted that cancers that do not grow into or invade normal tissues within or outside the primary location. When referring to "invasive cancers", it should be noted that cancers that invade and grow in normal, healthy adjacent tissues.

[0599] Still further, in some embodiments, the methods, compositions, and systems of the present disclosure are applicable to any type and / or stage and / or grade of any metastasis, metastatic cancer, or state of any cancerous condition disclosed herein.

[0600] As used herein, the term "metastatic cancer" or "metastatic state" refers to a cancer that has spread from the location where it first started (the primary cancer) to another location in the body. Tumors formed by metastatic cancer cells originating from a primary tumor or other metastatic tumors that spread using the blood and / or lymphatic system are referred to herein as metastatic tumors or metastases.

[0601] Thus, in some embodiments, additional malignancies useful in the present invention may include, but are not limited to, hematological malignancies (including lymphomas, leukemias, myeloproliferative disorders, acute lymphocytic leukemia; acute myeloid leukemia), dysplastic and aplastic anemias (both virally induced and spontaneous), myelodysplastic syndromes, all types of paraneoplastic syndromes (both immune-mediated and spontaneous), and solid tumors (including gastrointestinal tract, colon, lung, liver, breast, prostate, pancreas, and Kaposi's sarcoma. The present invention may also be used to treat or inhibit solid tumors, such as tumors of the lips and oral cavity, pharynx, larynx, paranasal sinuses, major salivary g...

Claims

1. A chimeric antigen receptor (CAR) molecule, the CAR comprising: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to B cell maturation antigen (BCMA); (ii) at least one hinge domain and at least one transmembrane domain derived from the cluster of differentiation 8 alpha (CD8α) protein, wherein the hinge region of the domain comprises the amino acid sequence as shown in SEQ ID NO: 9 and any fragments, derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain comprising at least one domain of a member of the tumor necrosis factor (TNF) receptor family, and optionally at least one domain of a T cell receptor (TCR) molecule.

2. The CAR molecule of claim 1, wherein the at least one target binding domain comprises: (i) at least one target recognition element; and / or (ii) at least one adapter component, wherein the at least one adapter component recognizes and binds to at least one labeled target recognition element.

3. The CAR molecule according to any one of claims 1 and 2, wherein the target recognition domain and / or element comprises at least one antibody specific for the BCMA or any antigen-binding fragment, portion or chimera thereof.

4. The CAR molecule of claim 3, wherein the antigen-binding fragment, portion or chimera of the antibody comprises at least one of a single-chain variable fragment (scFv) and / or a nanobody.

5. The CAR molecule according to any one of claims 3 to 4, wherein the antibody specifically recognizes and binds to the BCMA protein or any fragment thereof, the antibody comprises an immunoglobulin heavy chain (HC) and an immunoglobulin light chain (LC), the immunoglobulin heavy chain comprises the amino acid sequence shown in SEQ ID NO: 3 and any derivatives and variants thereof, and the immunoglobulin light chain comprises the amino acid sequence shown in SEQ ID NO: 5 and any derivatives and variants thereof.

6. The CAR molecule according to any one of claims 1 to 5, wherein the at least one target binding domain comprises the amino acid sequence shown in SEQ ID NO: 11 and any variants and derivatives thereof.

7. The CAR molecule according to any one of claims 1 to 6, wherein the hinge domain and the transmembrane domain comprise the amino acid sequence shown in SEQ ID NO: 6, and any variants and derivatives thereof.

8. The CAR molecule of any one of claims 1 to 7, wherein at least one of the following: the at least one tumor necrosis factor (TNF) receptor family member is 4-1BB, and wherein the TCR molecule comprises a cluster of differentiation 3 (CD3) ζ chain.

9. The CAR molecule according to any one of claims 1 to 8, wherein the at least one intracellular T cell signaling domain comprises the amino acid sequence shown in SEQ ID NO: 12 and any derivatives and variants thereof.

10. The CAR molecule according to any one of claims 1 to 9, wherein the CAR comprises the amino acid sequence shown in SEQ ID NO: 1, and any variants and derivatives thereof.

11. A CAR molecule according to any one of claims 1 to 10, wherein expression of the CAR by at least one cell of the T lineage results in at least one of the following: (i) increased specificity; (ii) reduced tonic signaling; (iii) reduced off-target activation; (iv) increased expression of activation markers in response to specific stimuli; and (v) reduced expression of exhaustion markers in response to specific stimuli in vivo and / or in vitro / ex vivo environments.

12. A nucleic acid molecule comprising at least one nucleic acid sequence encoding at least one CAR molecule, or any box, vector or vehicle comprising said nucleic acid molecule, said CAR comprising: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge domain and at least one transmembrane domain derived from a CD8α protein, wherein the hinge region of the domain comprises the amino acid sequence as shown in SEQ ID NO: 9 and any derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

13. The nucleic acid molecule of claim 12, wherein the CAR molecule is according to any one of claims 2 to 11.

14. A nucleic acid molecule according to any one of claims 12 to 13, wherein the nucleic acid molecule is flanked by at least one of the following at least one of its 5' and 3' ends: (i) a homology arm for integration into a genomic target site by homologous recombination; and / or (ii) a recognition site for a site-specific nuclease, a site-specific integrase or a site-specific recombinase.

15. A gene editing system, comprising: (a) at least one nucleic acid molecule comprising at least one nucleic acid sequence encoding at least one CAR molecule, or any cassette, vector or vehicle comprising said nucleic acid molecule, said at least one nucleic acid molecule comprising: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge domain and at least one transmembrane domain derived from the CD8α protein, wherein the hinge region of the domain comprises the amino acid sequence as shown in SEQ ID NO: 9 and any derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; and (b) at least one gene editing component or a nucleic acid sequence encoding the gene editing component.

16. A genetically engineered cell of a T cell lineage expressing at least one CAR molecule, or any cell population comprising at least one such genetically modified cell, wherein the CAR comprises: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge domain and at least one transmembrane domain derived from the CD8α protein, wherein the hinge region of the domain comprises the amino acid sequence as shown in SEQ ID NO: 9 and any fragments, derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

17. The genetically engineered cell according to claim 16, wherein the CAR molecule is according to any one of claims 1 to 11.

18. The genetically engineered cell according to any one of claims 16 to 17, wherein the cell of the T lineage is at least one T cell and / or at least one NK T cell.

19. A composition comprising at least one of the following: at least one CAR molecule, any nucleic acid molecule comprising at least one nucleic acid sequence encoding the CAR molecule, or any cassette, vector, vector or gene editing system comprising the nucleic acid molecule, and / or any genetically engineered cell of the T lineage expressing the CAR or a cell population comprising at least one genetically engineered cell of the T lineage, and any combination thereof, wherein the CAR comprises: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge domain and at least one transmembrane domain derived from the CD8α protein, wherein the hinge region of the domain comprises the amino acid sequence as shown in SEQ ID NO: 9 and any fragments, derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; Optionally, the composition further comprises at least one of a pharmaceutically acceptable carrier, a diluent, an excipient and an additive.

20. The composition of claim 19, wherein the CAR molecule is according to any one of claims 1 to 11, the nucleic acid molecule is according to any one of claims 12 to 14, the gene editing system is according to claim 15, and the cell is according to any one of claims 16 to 18.

21. A method for treating, preventing, ameliorating, inhibiting or delaying the onset of an immune-related disorder in a mammalian subject, the method comprising the step of administering to the subject an effective amount of at least one of the following: (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell expressing said CAR, or said cell population; and (d) a composition comprising at least one of (a), (b) and (c); The CAR comprises: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge domain and at least one transmembrane domain derived from the CD8α protein, wherein the hinge region of the domain comprises the amino acid sequence as shown in SEQ ID NO: 9 and any fragments, derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

22. The method of claim 21, wherein the at least one target binding domain comprises: (i) at least one target recognition element; and / or (ii) at least one adapter component that recognizes and binds to at least one labeled target recognition element.

23. The method of any one of claims 21 and 22, wherein the target recognition domain and / or element comprises at least one antibody specific for the BCMA or any antigen-binding fragment, portion or chimera thereof.

24. The method of claim 23, wherein the antigen-binding fragment, portion or chimera of the antibody comprises at least one of a scFv and / or a nanobody.

25. The method according to any one of claims 23 to 24, wherein the antibody specifically recognizes and binds to the BCMA protein, the antibody comprises an immunoglobulin HC and an immunoglobulin LC, the immunoglobulin HC comprises the amino acid sequence shown in SEQ ID NO: 3 and any derivatives and variants thereof, and the immunoglobulin LC comprises the amino acid sequence shown in SEQ ID NO: 5 and any derivatives and variants thereof.

26. The method according to any one of claims 21 to 25, wherein the at least one target binding domain comprises the amino acid sequence as shown in SEQ ID NO: 11, and any derivatives and variants thereof.

27. The method according to any one of claims 21 to 26, wherein the hinge domain and the transmembrane domain comprise the amino acid sequence as shown in SEQ ID NO: 6, and any derivatives and variants thereof.

28. according to the method described in any one of claims 21 to 27, wherein the at least one TNF receptor family member is 4-1BB, and wherein the TCR molecule comprises CD3 ζ chain.

29. The method according to any one of claims 21 to 28, wherein the at least one intracellular T cell signaling domain comprises the amino acid sequence shown in SEQ ID NO:

12.

30. The method according to any one of claims 21 to 29, wherein the CAR comprises the amino acid sequence shown in SEQ ID NO: 1, or any variant and derivative thereof.

31. The method of any one of claims 21 to 30, wherein expression of the CAR by at least one cell of the subject's T lineage results in at least one of: (i) increased specificity; (ii) reduced tonic signaling; (iii) reduced off-target activation; (iv) increased expression of activation markers in response to a specific stimulus; (v) decreased expression of exhaustion markers in response to a specific stimulus; (vi) increased survival rate; (vii) decreased relapse rate; and (viii) long-term effects; in said subject.

32. The method of any one of claims 21 to 31, wherein the nucleic acid molecule is according to any one of claims 12 to 14, the gene editing system is according to claim 15, the cell is according to any one of claims 16 to 18, and the composition is according to any one of claims 19 to 20.

33. The method of any one of claims 21 to 32, wherein at least one cell of the T lineage expressing the CAR molecule is administered to the subject and / or the subject is genetically engineered with the at least one nucleic acid cassette or any vector or vehicle comprising the cassette or with the cell population.

34. The method of claim 33, wherein the cells are from an autologous or allogeneic source.

35. The method according to any one of claims 21 to 32, wherein a nucleic acid vector comprising the at least one cassette is administered to the subject, the vector being any one of a viral vector, a non-viral vector, and a naked DNA vector.

36. The method of claim 35, wherein the insertion of the nucleic acid sequence encoding the CAR into the genome of the cells of the T lineage of the subject is mediated by a site-specific nuclease, the nuclease being at least one PEN, wherein the PEN comprises at least one CRISPR / Cas protein system, and wherein the method further comprises the step of administering to the subject at least one of: (a) at least one CRISPR / Cas protein, or any nucleic acid molecule encoding such a Cas protein; and (b) at least one nucleic acid sequence comprising at least one gRNA, wherein the at least one gRNA targets the nucleic acid sequence encoding the CAR to be inserted into a genomic sequence; or any nucleic acid sequence encoding the gRNA; or Any kit, composition or vehicle comprising at least one of (a) and (b).

37. The method of any one of claims 21 to 36, wherein the immune-related disorder is a disorder associated with expression of the BCMA protein in cells of the B lineage.

38. The method of claim 37, wherein the disorder is at least one of: at least one proliferative disorder and / or at least one autoimmune disease, deposition disorder, or any B cell mediated disorder.

39. The method of claim 38, wherein the proliferative disorder is any B-cell malignancy.

40. The method of claim 39, wherein the B cell malignancy is multiple myeloma (MM) and any related conditions.

41. The method of claim 37, wherein the deposition disorder is amyloidosis and any related conditions.

42. A therapeutically effective amount of at least one of the following for use in a method of treating, preventing, ameliorating, inhibiting or delaying the onset of an immune-related disorder in a mammalian subject: (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell expressing said CAR, or said cell population; and (d) a composition comprising at least one of (a), (b) and (c); wherein the CAR comprises: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge domain and at least one transmembrane domain derived from the CD8α protein, wherein the hinge region of the domain comprises the amino acid sequence as shown in SEQ ID NO: 9 and any fragments, derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

43. An effective amount for use according to claim 42, wherein the CAR is according to any one of claims 1 to 11, the nucleic acid molecule is according to any one of claims 12 to 14, the gene editing system is according to claim 15, the cell is according to any one of claims 16 to 18, and the composition is according to any one of claims 19 to 20.

44. A method for targeted activation of cells of the T lineage against target cells expressing the BCMA protein and / or tissues containing the target cells, the method comprising the step of contacting the cells of the T lineage with an effective amount of at least one of the following: (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle or gene editing system comprising the nucleic acid molecule of (a); and (c) a composition comprising at least one of (a) and (b); wherein the CAR comprises: (i) at least one target binding domain; wherein at least one of the target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge domain and at least one transmembrane domain derived from the CD8α protein, wherein the hinge region of the domain comprises the amino acid sequence as shown in SEQ ID NO: 9 and any fragments, derivatives and variants thereof; and (iii) at least one intracellular T cell signaling domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

45. The method of claim 44, wherein said step of contacting said cells of said T lineage with said at least one nucleic acid cassette is performed in vivo, in vitro or ex vivo.

46. ​​The method of claim 45, wherein contacting the cells of the T lineage with the at least one nucleic acid box is performed in a subject suffering from at least one immune-related disorder, and the method further comprises administering to the subject an effective amount of the nucleic acid box, a vector comprising the nucleic acid box, a gene editing system comprising the nucleic acid molecule, or any combination thereof.

47. The method of claim 45, wherein contacting the cells of the T lineage with the at least one nucleic acid box is performed in vitro or ex vivo to obtain the engineered cells or the cell population of the T lineage.

48. The method of claim 47, wherein the method is used to target and activate cells of the T lineage against target cells expressing the BCMA protein and / or tissues containing the target cells in a subject suffering from an immune-related disorder, and wherein the method further comprises the step of introducing the genetically engineered cells into the subject.

49. The method of any one of claims 47 to 48, wherein the cells of the T lineage are from an autologous or allogeneic source.

50. The method of any one of claims 46 to 49, wherein the disorder is at least one of the following: at least one proliferative disorder, at least one deposition disorder, and / or at least one autoimmune disease.

51. The method according to any one of claims 44 to 50, wherein the CAR is according to any one of claims 1 to 11, the nucleic acid molecule is according to any one of claims 12 to 14, and the gene editing system is According to claim 15, the cell is according to any one of claims 16 to 8, and the composition is according to any one of claims 19 to 20.

Images