Method for rapidly obtaining powdery mildew resistant barley pure line plant and application

Abstract

The invention relates to a method for rapidly obtaining a powdery mildew resistant barley pure line plant and application, and belongs to the technical field of biological engineering. The invention provides a method for rapidly obtaining a powdery mildew resistant barley pure line plant. The method specifically comprises the following steps: hybridizing a male parent and a female parent to obtain F1, extracting microspores of the F1 plant, culturing the microspores to obtain a regenerated plant seedling, amplifying DNA of the regenerated plant seedling by using an amplification primer pair of a powdery mildew resistant molecular marker, and screening out the powdery mildew resistant barley pure line plant. According to the method disclosed by the invention, hybridized F1-generation plants of Fengshi barley No.7 and Fengshi 30 are subjected to microspore culture to obtain regenerated plants, and then the regenerated plants are identified by utilizing SNP molecular markers related to powdery mildew-resistant genes in the seedling stage of the regenerated plants, so that a powdery mildew-resistant pure-line barley breeding material is rapidly obtained, and a more efficient method is provided for barley powdery mildew-resistant breeding; compared with conventional hybridization breeding, time and labor are saved, and the breeding efficiency can be greatly improved.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a method for rapidly obtaining pure-line barley plants resistant to powdery mildew and an application thereof. Background Art

[0002] One-third of my country's barley is planted in the central and eastern agricultural areas, and two-thirds is distributed in the western agricultural and animal husbandry areas. It is an important raw material for the domestic wine industry, food industry and feed industry, as well as the main forage for livestock and poultry aquaculture in agricultural and pastoral areas. However, during the growth and development of barley, it often suffers from various diseases, resulting in reduced production or reduced quality, thus affecting the nutritional value of beer brewing and barley feed. At present, there are as many as 11 barley virus diseases reported in my country. The main ones that are more serious and have a greater impact on production are barley yellow mosaic, barley stripe mosaic, barley powdery mildew and barley fusarium head blight. Barley is easily invaded by pathogens during its growth and development, resulting in functional damage or influence, resulting in reduced production or reduced quality. Therefore, it is urgent to cultivate pure disease-resistant barley varieties to improve the yield and quality of barley.

[0003] Among the existing breeding methods, haploid breeding is one of the means of plant breeding. The pure line plants obtained by haploid induction after chromosome doubling can significantly shorten the breeding period compared with traditional breeding (6-8 generations of self-pollination). However, because the gamete cells undergo chromatid exchange and separation, the degree of variation of pure line plants is relatively large, and a large amount of manpower and material resources are required to select the target phenotype. How to quickly and efficiently cultivate pure line disease-resistant barley varieties, shorten the breeding period, and reduce the workload is an urgent problem to be solved.

[0004] Based on this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide a method for quickly obtaining pure-line barley plants resistant to powdery mildew and its application, so as to solve the problems of long breeding time and heavy workload of pure-line disease-resistant barley varieties in the prior art.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a method for rapidly obtaining pure-line barley plants resistant to powdery mildew, comprising the following steps:

[0008] (1) selecting a male barley with high resistance to powdery mildew and a female barley with high sensitivity to powdery mildew to hybridize to obtain F1 generation seeds;

[0009] (2) planting F1 generation seeds to obtain F1 generation plants, taking young panicles of the F1 generation plants at the heading stage, extracting microspores, and inoculating the microspores into an induction medium to obtain a microspore suspension;

[0010] (3) culturing the microspore suspension obtained in step (2) in the dark at 23-27° C. for 19-23 days to obtain callus tissue;

[0011] (4) transferring the callus obtained in step (3) to a differentiation medium and culturing the callus until the buds are 2 to 4 cm long to obtain differentiated buds;

[0012] (5) transferring the differentiated buds obtained in step (4) to a seedling medium and culturing them until the seedlings are 6 to 10 cm long to obtain regenerated plantlets;

[0013] (6) extracting DNA from the regenerated plant seedlings obtained in step (5), designing amplification primer pairs for molecular markers of powdery mildew resistance, using the amplification primer pairs to perform PCR amplification on the DNA of the regenerated plant seedlings, and screening the regenerated plant seedlings whose DNA can be amplified by the amplification primer pairs as pure lines of barley plants resistant to powdery mildew.

[0014] Preferably, the microspores extracted in step (2) are early or middle mononuclear microspores.

[0015] Preferably, the induction medium in step (2) is N6 medium as the basal medium, and the following components are added at final concentrations: ferrous sulfate 26.8-28.8 mg / L, maltose 85-95 g / L, kinetin 0.3-0.7 mg / L, 2,4-dichlorophenoxyacetic acid 0.8-1.2 mg / L, fatty acid methyl ester sulfonate 0.966-0.986 g / L, hydrolyzed casein 350-450 mg / L and glutamine 1500-1700 mg / L;

[0016] The pH of the induction medium is 5.6-6.

[0017] Preferably, the concentration of the microspore suspension in step (2) is 0.5 to 1.5×10 5 Pieces / mL.

[0018] Preferably, the differentiation medium in step (4) is a MS medium as a base medium, and the following components are added at final concentrations: 18-22 g / L maltose, 0.02-0.04 mg / L 6-benzylaminopurine, 0.5-1.5 mg / L kinetin, 0.02-0.04 mg / L 1-naphthylacetic acid, and 3-4 g / L agar;

[0019] The pH of the differentiation medium is 5.6-6.

[0020] Preferably, the seedling medium in step (5) is a medium based on MS medium, and the following components are added at final concentrations: sucrose 13-17 g / L, 1-naphthylacetic acid 0.02-0.03 mg / L, paclobutrazol 1.0-3.0 mg / L, and agar 2.5-3.0 g / L;

[0021] The pH of the seedling-strengthening culture medium is 5.6-6.

[0022] Preferably, the PCR amplification system includes the following components: 9-11 μL of 2×SYBR Green PCR Master Mix, 3-5 μL of upstream primers with a concentration of 0.2-0.6 nmol / μL, 3-5 μL of downstream primers with a concentration of 0.2-0.6 nmol / μL, and 1-3 μL of DNA template.

[0023] Preferably, the PCR amplification parameters are 95°C for 2-3 min, then 95°C for 10-20 s, 56°C for 25-35 s, 72°C for 55-65 s, 40 cycles, and finally extension at 72°C for 4-6 min.

[0024] The invention also provides application of the method in breeding pure-line barley plants resistant to powdery mildew.

[0025] The present invention has the following technical effects and advantages:

[0026] The present invention uses a high powdery mildew resistance variety Fengdamai No. 7 and a high powdery mildew sensitivity variety Hua 30 to hybridize, construct an F2 segregation population, select high resistance and high sensitivity powdery mildew plants in the F2 population for BSA mixed pool analysis, locate the powdery mildew resistance gene, and design SNP primers related to the powdery mildew resistance gene locus. Use Fengdamai No. 7 and Hua 30 hybrid F1 generation plants for microspore culture to obtain regenerated plants, and then use SNP molecular markers related to the powdery mildew resistance gene to identify in the seedling stage of the regenerated plants, and quickly obtain powdery mildew resistance pure line barley breeding materials. Provide a more efficient method for barley powdery mildew resistance breeding, which saves time and effort compared to conventional hybrid breeding, and can greatly improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the BAS analysis result of the mixed DNA of the F2 generation plants with high resistance to powdery mildew and plants with high sensitivity to powdery mildew;

[0028] Figure 2 This is the melting curve of the DNA amplification products of Fengdamai No. 7 and Hua 30. In the figure, the horizontal axis represents temperature, the vertical axis represents the fluorescence signal intensity, the green curve represents Fengdamai No. 7, and the blue curve represents Hua 30;

[0029] Figure 3 This is a melting curve diagram of DNA amplification products of different barley plants. The horizontal axis represents temperature and the vertical axis represents fluorescence signal intensity. DETAILED DESCRIPTION

[0030] The present invention provides a method for rapidly obtaining pure-line barley plants resistant to powdery mildew, comprising the following steps:

[0031] (1) selecting a male barley with high resistance to powdery mildew and a female barley with high sensitivity to powdery mildew to hybridize to obtain F1 generation seeds, wherein the male barley with high resistance to powdery mildew is preferably Fengdamai No. 7, and the female barley with high sensitivity to powdery mildew is preferably Hua No. 30;

[0032] (2) planting F1 generation seeds to obtain F1 generation plants, taking young panicles of the F1 generation plants at the heading stage, extracting microspores, and inoculating the microspores into an induction medium to obtain a microspore suspension;

[0033] (3) inoculating 1-2 mL of the microspore suspension obtained in step (2) into a culture dish, and culturing in the dark at 23-27° C. for 19-23 days to obtain callus tissue,

[0034] In step (3), the inoculation amount of the microspore suspension is preferably 1.5 mL, the temperature of the dark culture is preferably 25° C., and the dark culture time is preferably 21 days;

[0035] (4) transferring the callus obtained in step (3) to a differentiation medium and culturing the callus until the bud length is 2 to 4 cm, preferably 3 cm, to obtain differentiated buds;

[0036] (5) transferring the differentiated buds obtained in step (4) to a seedling medium and culturing them until the seedling length is 6 to 10 cm, preferably 8 cm, to obtain regenerated plant seedlings;

[0037] (6) extracting DNA from the regenerated plant seedlings obtained in step (5), designing amplification primer pairs for molecular markers of powdery mildew resistance, using the amplification primer pairs to perform PCR amplification on the DNA of the regenerated plant seedlings, and screening out the regenerated plant seedlings whose DNA can be amplified by the amplification primer pairs as pure lines of barley plants resistant to powdery mildew;

[0038] The molecular marker is preferably a SNP molecular marker, and further preferably a SNP mutation in Fengdamai No. 7 and Hua 30 in the powdery mildew resistant genome interval 536183004-609483089 where the powdery mildew resistant barley chromosome 4H is located;

[0039] The amplification primer pair contains a powdery mildew resistance gene SNP mutation, including an upstream primer P1 and a downstream primer P2;

[0040] The nucleotide sequence of the upstream primer P1 is shown in SEQ ID No.1;

[0041] SEQ ID No. 1 is: CGAACTGAAAGAAGACGGAGAC;

[0042] The nucleotide sequence of the downstream primer P2 is shown in SEQ ID No.2;

[0043] SEQ ID No. 2 is: GGCTAATAATCCTGCCGTGTTG.

[0044] In the present invention, the microspores extracted in step (2) are early or middle uninucleate microspores, preferably early uninucleate microspores.

[0045] In the present invention, the induction medium in step (2) is N6 medium as the base medium, and the following components are further added at final concentrations: ferrous sulfate 26.8-28.8 mg / L, preferably 27.8 mg / L; maltose 85-95 g / L, preferably 90 g / L; kinetin 0.3-0.7 mg / L, preferably 0.5 mg / L; 2,4-dichlorophenoxyacetic acid 0.8-1.2 mg / L, preferably 1 mg / L; fatty acid methyl ester sulfonate 0.966-0.986 g / L, preferably 0.976 g / L; hydrolyzed casein 350-450 mg / L, preferably 400 mg / L; glutamine 1500-1700 mg / L, preferably 1600 mg / L;

[0046] The pH of the induction medium is 5.6-6, preferably 5.8.

[0047] In the present invention, the concentration of the microspore suspension in step (2) is 0.5 to 1.5×10 5 / mL, preferably 1×10 5 Pieces / mL.

[0048] In the present invention, the differentiation medium in step (4) is a base medium based on MS medium, and the following components are added at final concentrations: 18-22 g / L maltose, preferably 20 g / L; 0.02-0.04 mg / L 6-benzylaminopurine, preferably 0.03 mg / L; 0.5-1.5 mg / L kinetin, preferably 1 mg / L; 0.02-0.04 mg / L 1-naphthylacetic acid, preferably 0.03 mg / L; 3-4 g / L agar, preferably 3.5 g / L;

[0049] The pH of the differentiation medium is 5.6-6, preferably 5.8.

[0050] In the present invention, the seedling medium in step (5) is a base medium with MS medium, and the following components are added at final concentrations: sucrose 13-17 g / L, preferably 15 g / L; 1-naphthylacetic acid 0.02-0.03 mg / L, preferably 0.025 mg / L; paclobutrazol 1.0-3.0 mg / L, preferably 2 mg / L; agar 2.5-3.0 g / L, preferably 2.75 g / L;

[0051] The pH of the seedling-strengthening culture medium is 5.6-6, preferably 5.8.

[0052] In the present invention, the PCR amplification system includes the following components: 2×SYBR GreenPCR MasterMix 9-11 μL, preferably 10 μL;

[0053] 3 to 5 μL of upstream primer at a concentration of 0.2 to 0.6 nmol / μL, preferably 0.4 nmol / μL, preferably 4 μL;

[0054] 3 to 5 μL of downstream primer at a concentration of 0.2 to 0.6 nmol / μL, preferably at a concentration of 0.4 nmol / μL, and preferably in a volume of 4 μL;

[0055] 1 to 3 μL of DNA template, preferably 2 μL.

[0056] In the present invention, the parameters of the PCR amplification are 95°C for 2 to 3 min, preferably for 10 min, then 95°C for 10 to 20 s, preferably for 15 s, 56°C for 25 to 35 s, preferably for 30 s, 72°C for 55 to 65 s, preferably for 60 s, 40 cycles, and finally extension at 72°C for 4 to 6 min, preferably for 5 min.

[0057] The invention also provides application of the method in breeding pure-line barley plants resistant to powdery mildew.

[0058] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0059] Example 1 Location of powdery mildew resistance genes

[0060] Feng Barley No. 7 is a fine barley variety cultivated by the Institute of Grain Crops of Dali Agricultural Science Extension Institute, and Hua No. 30 is a fine barley variety jointly bred by the Institute of Biotechnology of Shanghai Academy of Agricultural Sciences and Jiaxing Academy of Agricultural Sciences of Zhejiang Province. The seeds of the two varieties are preserved by the Cell Engineering Laboratory of Shanghai Academy of Agricultural Sciences.

[0061] Fengdamai No. 7 and Hua 30 were planted in the field. When the plants were heading, they were hybridized with Hua 30 as the female parent and Fengdamai No. 7 as the male parent to harvest F1 hybrid seeds.

[0062] F1 seeds were planted in the field according to single ear to obtain the F2 generation trait segregation population. Diseases occurred naturally in the field during the adult stage, and the disease resistance of powdery mildew plants was identified. 30 plants with high resistance to powdery mildew and 30 plants with high sensitivity to powdery mildew were selected. The plants with high resistance to powdery mildew and the plants with high sensitivity to powdery mildew were mixed, and DNA was extracted for BSA analysis.

[0063] The evaluation criteria for barley disease resistance are as follows:

[0064] Level 0: Highly resistant, no disease spots on the whole plant;

[0065] Level 1: Highly resistant, with a few lesions on the leaves in the first section (lesions occupy less than 2% of the leaf area);

[0066] Level 2: Highly resistant, with a few lesions on the leaves in the second section, and mild disease on the leaves in the first section (lesions occupy 3% to 10% of the leaf area);

[0067] Level 3: Moderate resistance, with mild disease on the third section of leaves, moderate disease on the second section of leaves (lesions occupy 11% to 25% of the leaf area), and severe disease on the first section of leaves (lesions occupy more than 25% of the leaf area);

[0068] Level 4: Moderately resistant, with mild disease on the fourth segment of leaves, and moderate to severe disease on the third segment and below;

[0069] Level 5: Moderately affected, with mild disease on the fifth segment of leaves, and moderate to severe disease on the fourth segment and below;

[0070] Level 6: Moderately affected, with mild disease on the sixth segment of leaves, and moderate to severe disease on the fifth segment and below;

[0071] Level 7: Highly susceptible, with mild disease on the seventh segment of leaves, moderate to severe disease on the sixth segment and below, and sometimes a few spots on the flag leaf;

[0072] Level 8: Highly susceptible, with mild or moderate disease on the flag leaf and moderate to severe disease on leaves below the flag leaf;

[0073] Level 9: Extremely susceptible, with severe disease on the entire leaf blade and varying degrees of disease on the panicle.

[0074] The analysis results are as follows Figure 1 As shown in the figure, the horizontal axis represents the barley chromosome, which is obtained using the MorexV3_pseudomolecules_assembly genome database. The vertical axis of the SNP-index graph represents the read ratio calculated for each SNP site, and the vertical axis of the Δ(SNP-index) graph represents the difference in SNP-index between two mixed pools. The larger the absolute value of Δ(SNP-index), the more significant the site associated with the extreme trait. Figure 1 It can be seen that there is a significant peak on the barley chromosome 4H, indicating that the powdery mildew resistance gene is located on the chromosome 4H of Fengmai No. 7.

[0075] Example 2 Development of SNP molecular markers for chromosomes where powdery mildew resistance genes are located

[0076] According to the BSA analysis results in Example 1, the position of the peak where the powdery mildew resistance gene is located is determined to be the barley 4H chromosome genome interval 536183004-609483089, and the SNP mutation in this region is found according to the genome sequences of Fengdamai No. 7 and Hua 30 in the BSA sequencing results, and a SNP primer pair containing the SNP mutation is designed, including an upstream primer P1 and a downstream primer P2, the nucleotide sequence of the upstream primer P1 is shown in SEQ ID No. 1, SEQ ID No. 1 is: CGAACTGAAAGAAGACGGAGAC, and the nucleotide sequence of the downstream primer P2 is shown in SEQ ID No. 2, SEQ ID No. 2 is: GGCTAATAATCCTGCCGTGTTG. SNP primers were used to amplify the DNA of Fengdamai No. 7 and Hua 30 plants. The PCR reaction was amplified and fluorescence was detected on a real-time fluorescence quantitative PCR instrument. The PCR reaction system was 20 μL, specifically 10 μL of 2×SYBR Green PCR MasterMix, 4 μL of upstream primer P1 with an initial concentration of 0.4 nmol / μL, and 4 μL of downstream primer P2 with an initial concentration of 0.4 nmol / μL, and 2 μL of DNA template. The amplification parameters were 95°C for 3 min, then 95°C for 15 s, 56°C for 30 s, and 72°C for 1 min, for a total of 40 cycles, and finally 72°C for 5 min. After the amplification reaction was completed, the melting curve was analyzed using a real-time fluorescence quantitative PCR instrument.

[0077] The results are as follows Figure 2 As shown, the green curve in the figure represents Fengdamai No. 7, and the blue curve represents Hua 30. Figure 2 It can be seen that the SNP primer pair can distinguish Fengdamai No. 7 and Hua 30 plants.

[0078] Example 3 Method for rapidly obtaining pure-line barley plants resistant to powdery mildew

[0079] (1) Planting Feng Damai No. 7, which is highly resistant to powdery mildew, and Hua No. 30, which is highly susceptible to powdery mildew, in a field, and hybridizing them with Damai No. 7 as the male parent and Hua No. 30 as the female parent when the plants are heading, to harvest F1 hybrid seeds;

[0080] (2) Plant F1 seeds to obtain F1 plants. When the F1 plants grow to the heading stage, select young spikelets in the early mononuclear stage of microspore development, cut off the excess leaves, retain the 1.5 cm base of the two upper leaves, wrap them with clean wet gauze, put them in a fresh-keeping bag to keep them moist, indicate the date and quantity of the sample, and put them in a 4°C refrigerator for 3 weeks of low-temperature pretreatment. Remove the flower buds from the young spikelets that have been pretreated at low temperatures, put them in a test tube, and add 12 mL of the extract (the extract consists of mannitol, CaCl 2 , MES and colchicine, pH 5.8, mannitol final concentration 60g / L, CaCl 2The final concentration of the extract was 1.1 g / L, the final concentration of MES was 0.976 g / L, and the final concentration of colchicine was 20 mg / L). Then, a high-speed disperser was used for ultra-speed rotary cutting. The rotary cut suspension was filtered with a 300-mesh screen. The filtrate was centrifuged at a speed of 700 rpm for 5 min. This was repeated 3 times to obtain microspores. The obtained microspores were placed in an extract solution and treated in the dark at 25°C for 2 days. Then, the microspores were inoculated into an induction medium and prepared to a concentration of 1×10 5 / mL microspore suspension;

[0081] (3) Take the concentration as 1×10 5 1.5 mL of microspore suspension with 1000 μg / mL was inoculated into a culture dish, which was sealed with Parafilm and cultured in the dark at 25°C for 21 days to obtain callus tissue;

[0082] (4) transferring the callus tissue to a differentiation medium for differentiation culture until the bud length reaches 3 cm to obtain differentiated buds;

[0083] (5) transferring the differentiated buds to a seedling medium for seedling cultivation until the seedlings are 8 cm long, and then opening the cover to harden the seedlings for 2 days to obtain regenerated plantlets;

[0084] (6) Cut leaves of different regenerated plant seedlings, extract DNA using a DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), amplify DNA of regenerated plant seedlings using the primer pair of Example 2, amplify and detect fluorescence on a real-time fluorescence quantitative PCR instrument, and the PCR reaction system is 20 μL, specifically 10 μL of 2×SYBR Green PCRMasterMix, 4 μL of upstream primer P1 with an initial concentration of 0.4 nmol / μL and 4 μL of downstream primer P2 with an initial concentration of 0.4 nmol / μL, and 2 μL of DNA template. The amplification parameters are 95°C for 3 min, then 95°C for 15 s, 56°C for 30 s, and 72°C for 60 s, for a total of 40 cycles, and finally 72°C for 5 min. After the amplification reaction is completed, the melting curve of the amplified product is analyzed using a real-time fluorescence quantitative PCR instrument to identify whether the regenerated plant seedling contains the chromosome of the powdery mildew resistance gene.

[0085] The melting curve of the amplified product is shown in Figure 3 As shown, according to Figure 3 It can be seen that the regenerated plant seedlings obtained by the above microspore culture all contain the chromosome containing the powdery mildew resistance gene in Fengdamai No. 7, indicating that the regenerated plant seedlings obtained by microspore culture are pure lines of powdery mildew resistance barley plants.

[0086] Among them, the induction medium is a medium based on N6 medium, and the following components are added at final concentrations: 27.8 mg / L ferrous sulfate, 90 g / L maltose, 0.5 mg / L kinetin, 1 mg / L 2,4-dichlorophenoxyacetic acid, 0.976 g / L fatty acid methyl ester sulfonate, 400 mg / L hydrolyzed casein and 1600 mg / L glutamine, with a pH of 5.8; the differentiation medium is a medium based on MS medium, and the following components are added at final concentrations: 20 g / L maltose, 0.03 mg / L 6-benzylaminopurine, 1 mg / L kinetin, 0.03 mg / L 1-naphthaleneacetic acid, and 3.5 g / L agar, with a pH of 5.8; the seedling medium is a medium based on MS medium, and the following components are added at final concentrations: 15 g / L sucrose, 0.025 mg / L 1-naphthaleneacetic acid, 2 mg / L paclobutrazol, and 2.75 g / L agar, with a pH of 5.8.

[0087] Example 4 Powdery mildew resistance identification of regenerated plants

[0088] The seedlings of Fengdamai No. 7, Hua 30 and the regenerated plants obtained in Example 3 were planted in a greenhouse, and a mixed powdery mildew fungus was collected from the fields in Shanghai. The mixed powdery mildew fungus was inoculated on the leaves of the plants at the seedling stage and the adult stage, respectively, to identify the powdery mildew resistance.

[0089] The results are shown in Table 1, where 1 to 7 are the regenerated plant seedlings obtained in Example 3, Fengdamai No. 7 is the disease-resistant control, and Hua 30 is the disease-susceptible control. According to Table 1, Hua 30 is highly susceptible; Fengdamai No. 7 and the regenerated plant seedlings obtained in Example 3 are both highly resistant. The results of the in vitro identification of powdery mildew resistance in the seedling stage and the adult stage are consistent. It shows that the use of microspore culture technology combined with SNP molecular marker screening successfully obtained pure lines of barley plants resistant to powdery mildew.

[0090] Table 1 Powdery mildew resistance identification of different plants at seedling and adult stages

[0091]

[0092] As can be seen from the above embodiments, the present invention provides a method and application for quickly obtaining pure-line barley plants resistant to powdery mildew. The present invention uses the high-resistance to powdery mildew variety Fengdamai No. 7 and the high-susceptibility to powdery mildew variety Hua 30 to hybridize, construct an F2 segregation population, select the high-resistance and high-susceptibility to powdery mildew plants in the F2 population for BSA mixed pool analysis, locate the powdery mildew resistance gene, and design SNP primers related to the powdery mildew resistance gene locus. Use the F1 generation plants of Fengdamai No. 7 and Hua 30 to hybridize for microspore culture to obtain regenerated plants, and then use the SNP molecular markers related to the powdery mildew resistance gene to identify the regenerated plants in the seedling stage, and quickly obtain the powdery mildew resistance pure-line barley breeding materials, which provides a more efficient method for barley powdery mildew resistance breeding, which saves time and effort compared to conventional hybrid breeding, and can greatly improve the breeding efficiency.

[0093] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for rapidly obtaining pure-line barley plants resistant to powdery mildew, characterized in that: The following steps are involved: (1) selecting a male barley with high resistance to powdery mildew and a female barley with high sensitivity to powdery mildew to hybridize to obtain F1 generation seeds; (2) planting F1 generation seeds to obtain F1 generation plants, taking young panicles of the F1 generation plants at the heading stage, extracting microspores, and inoculating the microspores into an induction medium to obtain a microspore suspension; (3) culturing the microspore suspension obtained in step (2) in the dark at 23-27° C. for 19-23 days to obtain callus tissue; (4) transferring the callus obtained in step (3) to a differentiation medium and culturing the callus until the buds are 2 to 4 cm long to obtain differentiated buds; (5) transferring the differentiated buds obtained in step (4) to a seedling medium and culturing them until the seedlings are 6 to 10 cm long to obtain regenerated plantlets; (6) extracting DNA from the regenerated plant seedlings obtained in step (5), designing amplification primer pairs for molecular markers of powdery mildew resistance, using the amplification primer pairs to perform PCR amplification on the DNA of the regenerated plant seedlings, and screening the regenerated plant seedlings whose DNA can be amplified by the amplification primer pairs as pure lines of barley plants resistant to powdery mildew.

2. The method according to claim 1, characterized in that The microspores extracted in step (2) are mononuclear early or middle stage microspores.

3. The method according to claim 1, characterized in that The induction medium in step (2) is N6 medium as the basal medium, and the following components are added at final concentrations: ferrous sulfate 26.8-28.8 mg / L, maltose 85-95 g / L, kinetin 0.3-0.7 mg / L, 2,4-dichlorophenoxyacetic acid 0.8-1.2 mg / L, fatty acid methyl ester sulfonate 0.966-0.986 g / L, hydrolyzed casein 350-450 mg / L and glutamine 1500-1700 mg / L; The pH of the induction medium is 5.6-6.

4. The method according to claim 1, characterized in that The concentration of the microspore suspension in step (2) is 0.5 to 1.5×10 5 Pieces / mL.

5. The method according to claim 1, characterized in that The differentiation medium in step (4) is a MS medium as a base medium, and the following components are added at final concentrations: 18-22 g / L maltose, 0.02-0.04 mg / L 6-benzylaminopurine, 0.5-1.5 mg / L kinetin, 0.02-0.04 mg / L 1-naphthylacetic acid, and 3-4 g / L agar; The pH of the differentiation medium is 5.6-6.

6. The method according to claim 1, characterized in that The seedling medium in step (5) is a basal medium of MS medium, and the following components are added at final concentrations: sucrose 13-17 g / L, 1-naphthylacetic acid 0.02-0.03 mg / L, paclobutrazol 1.0-3.0 mg / L, and agar 2.5-3.0 g / L; The pH of the seedling-strengthening culture medium is 5.6-6.

7. The method according to claim 1, characterized in that The PCR amplification system includes the following components: 9-11 μL of 2×SYBR Green PCR MasterMix, 3-5 μL of upstream primers with a concentration of 0.2-0.6 nmol / μL, 3-5 μL of downstream primers with a concentration of 0.2-0.6 nmol / μL, and 1-3 μL of DNA template.

8. The method according to claim 1, characterized in that The PCR amplification parameters are 95° C. for 2 to 3 min, then 95° C. for 10 to 20 s, 56° C. for 25 to 35 s, and 72° C. for 55 to 65 s, for 40 cycles, and finally extension at 72° C. for 4 to 6 min.

9. Use of the method according to any one of claims 1 to 8 in breeding pure-line barley plants resistant to powdery mildew.

Images