Preparation of Patchouli Flavonoids Nanoliposomes and Their Application in Inhalation Therapy for Acute Lung Injury

By preparing patchouli flavonoids nanoliposomes and using DPPC, cholesterol and mPEG2000-DSPE as membrane materials, they targeted the lungs and inhibited the TLR4-MyD88-NF-κB/MAPK pathway, solving the problem of unclear distribution of patchouli flavonoids in the human body and achieving effective treatment of acute lung injury.

CN119157837BActive Publication Date: 2025-09-19GUANGDONG HOSPITAL OF TRADITIONAL CHINESE MEDICINE +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411093233.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-09
Publication Date
2025-09-19
Estimated Expiration
2044-08-09

AI Technical Summary

Technical Problem

In the existing technology, Patchouli flavonoids, as a hydrophobic monomer, has unclear biological distribution and toxicity in the human body, and there are no reports of its use in treating diseases, especially in the lack of effective drugs for the treatment of acute lung injury.

Method used

Patchouli flavonoids nanoliposomes were prepared using DPPC, cholesterol and mPEG2000-DSPE as membrane materials. They targeted the lungs, inhibited the activation of the TLR4-MyD88-NF-κB/MAPK pathway, exerted anti-inflammatory effects, and thus treated acute lung injury.

Benefits of technology

Patchouli flavonoids nanoliposomes showed good biosafety and compatibility, and could significantly reduce the expression levels of inflammatory factors in mice, relieve inflammation, reduce pulmonary edema, improve lung tissue pathological damage, and achieve significant therapeutic effects on acute lung injury.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119157837B_ABST
    Figure CN119157837B_ABST
Patent Text Reader

Abstract

The present invention discloses the preparation of patchouli flavonoid nanoliposomes and their application in inhalation treatment of acute lung injury, and relates to the field of medical technology. The patchouli flavonoid nanoliposomes provided by the present invention prepare patchouli flavonoids into a liposome dosage form, which has good stability and biocompatibility. The drug is administered to mice with acute lung injury, so that patchouli flavonoids can act on the mouse lungs in a targeted manner, reduce the expression of inflammatory factors such as IL-6, IL-1β and TNF-α in the mouse lungs to relieve inflammation, improve pulmonary edema, and reduce lung tissue damage, while increasing the levels of tight junction factors such as ZO-1, VE-Cadherin, E-Cadherin and Claudin5 to repair lung barrier damage. The present invention is expected to provide an effective strategy for the treatment of acute lung injury.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the preparation of patchouli flavonoids nanoliposomes and application of inhalation in treating acute lung injury, and relates to the technical field of medicine. Background Art

[0002] Acute lung injury (ALI) is a common clinical syndrome of diffuse pulmonary inflammation. Specifically, it refers to the acute hypoxemic respiratory insufficiency or respiratory failure caused by diffuse interstitial and alveolar edema resulting from damage to pulmonary capillary endothelial cells and alveolar epithelial cells during non-cardiac diseases such as severe infection, shock, trauma, and burns. The disease is characterized by reduced lung volume, decreased lung compliance, and severe ventilation / perfusion imbalance. Clinically, it presents as progressive hypoxemia and respiratory distress, with lung imaging demonstrating heterogeneous exudative lesions. When ALI patients have a certain degree of lung damage, they are prone to acute respiratory distress syndrome (ARDS).

[0003] Studies have shown that inflammation and oxidative stress are involved in the pathogenesis of ALI, and natural flavonoids have shown promising results in the prevention and treatment of diseases, particularly those associated with oxidative stress-mediated inflammation, such as acute lung injury, radiation-induced lung injury, and intestinal injury. Patchouli flavonol, a flavonoid extracted from patchouli, has been reported to have anti-inflammatory properties. However, as a hydrophobic monomer, its toxicity and biodistribution in the human body remain unclear, and therefore, there are currently no reports of its use in the treatment of diseases. Summary of the Invention

[0004] According to one aspect of the present invention, a patchouli flavonoids nanoliposome is provided, comprising a membrane material and a core material, wherein the core material is patchouli flavonoids, and the membrane material is prepared from DPPC, cholesterol and mPEG2000-DSPE; the molar ratio of DPPC, cholesterol and mPEG2000-DSPE in the membrane material is (25-35):(10-20):1, and the drug loading capacity of the patchouli flavonoids nanoliposome is 1-4%.

[0005] Patchouli flavonoids are hydrophobic. The present invention uses DPPC (dipalmitoylphosphatidylcholine), cholesterol and mPEG2000-DSPE (polyethylene glycol monomethyl ether-2000-dioctadecylphosphatidylethanolamine, CAS147867-65-0) as membrane materials to form a liposome dosage form with a drug loading of 1 to 4% (i.e., the ratio of the mass of the core material Patchouli flavonoids in the liposome to the total mass of the liposome) for administration. Patchouli flavonoids can be targeted to the lungs, inhibit the activation of the TLR4-MyD88-NF-κB / MAPK pathway, exert an anti-inflammatory effect, and thus play a therapeutic role in acute lung injury. At the same time, the liposome dosage form has good biosafety and compatibility, and has little effect on cell viability in the human body. It should be noted that the molar ratio of DPPC, cholesterol and mPEG2000-DSPE in the membrane material is basically determined by the dosage during the liposome preparation process, that is, the molar ratio of each component in the membrane material is basically consistent with the molar ratio of each component added when preparing the liposome, and this molar ratio will affect the structure of the liposome, and then affect the encapsulation efficiency of flavonoids in the liposome and its drug loading capacity.

[0006] In some embodiments, the encapsulation efficiency of Patchouli Flavonoids in Patchouli Flavonoids nanoliposomes is 50-56%.

[0007] In some embodiments, the Patchouli flavonoids nanoliposomes are spherical, and the average diameter of the spheres is 115-120 nm.

[0008] In some embodiments, the zeta potential of the Patchouli flavonoids nanoliposomes is -5 to -9 mV.

[0009] According to another aspect of the present invention, a method for preparing Patchouli flavonoids nanoliposomes is provided, comprising the following steps:

[0010] S1. DPPC, cholesterol, mPEG2000-DSPE, and Patchouli flavonol were dissolved in a solvent and mixed uniformly. The solvent was removed by rotary evaporation to form a thin film.

[0011] S2. Add an aqueous medium to the film formed in step S1 to hydrate and peel off the film to obtain a suspension, and then ultrasonically disperse it to obtain Patchouli flavonoid liposomes.

[0012] In some embodiments, the molar ratio of DPPC, cholesterol, and mPEG2000-DSPE in step S1 is (25-35):(10-20):1.

[0013] In some embodiments, the solvent used in step S1 may be chloroform.

[0014] In some embodiments, the method of removing the solvent by rotary evaporation to form a thin film in step S1 can be to perform rotary evaporation under the condition of 230 mbar.

[0015] In some embodiments, the aqueous medium used in step S2 may be PBS buffer.

[0016] In some embodiments, the operation of fully hydrating and shedding the thin film in step S2 may be to stir the reaction system after adding the aqueous medium at a rotation speed of 300 r / min and a stirring time of 30 min.

[0017] In some embodiments, the ultrasonic dispersion operation in step S2 is as follows: placing the suspension obtained by hydration and shedding of the thin film on ice, performing ultrasonication, and ultrasonicating at a power of 20%. The ultrasonic mode is to ultrasonicate for 15 seconds, pause for 15 seconds, and end the ultrasonication after a cycle of 30 minutes to obtain a suspension after ultrasonic dispersion.

[0018] In some embodiments, after ultrasonic dispersion in step S2, the steps of filtration, ultrafiltration, and constant volume are further included.

[0019] In some embodiments, the filtering operation is: filtering the suspension after ultrasonic dispersion through a 0.22 μm filter to obtain a filtrate.

[0020] In some embodiments, the ultrafiltration operation is: centrifuging the filtrate at a speed of 3000 r / min for 1 hour to obtain purified liposomes.

[0021] The purpose of ultrafiltration in step S2 of the present invention is to remove excess liposomes and free Patchouli flavonoids monomers.

[0022] In some embodiments, the operation of fixing the volume for standby use is: fixing the volume of the purified liposomes with PBS buffer to 3 mL for standby use.

[0023] In some embodiments, the molar ratio of Patchouli Flavonoids to DPPC in step S1 is 1:(5-10).

[0024] Controlling the ratio of core material Patchouli flavonoids and membrane material components can improve the encapsulation efficiency of Patchouli flavonoids in liposomes and the drug loading capacity of liposomes.

[0025] In some embodiments, the temperature for fully hydrating and shedding the film in step S2 is 50-70°C.

[0026] The film hydration temperature is the reaction temperature when stirring after adding PBS buffer. The film hydration temperature is controlled to be 50-70°C, that is, the temperature when stirring after adding PBS buffer is controlled.

[0027] According to another aspect of the present invention, there is also provided the use of Patchouli flavonoids nanoliposomes in a medicine for treating acute lung injury.

[0028] In some embodiments, the drug for treating acute lung injury is administered by aerosol inhalation.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The patchouli flavonoids nanoliposomes provided by the present invention have good biosafety and compatibility, and can target the lungs, inhibit the activation of the TLR4-MyD88-NF-κB / MAPK pathway, reduce the expression levels of inflammatory factors such as IL6, IL-1β and TNF-α in mice, and relieve inflammation; reduce pulmonary edema; improve lung tissue pathological damage; and at the same time increase the expression levels of proteins such as ZO-1, VE-Cadherin, E-Cadherin and Claudin5, alleviate damage to the lung barrier, and achieve the treatment of mice with acute lung injury, and the therapeutic effect is significantly better than that of free patchouli flavonoids monomers. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram showing the comparison of particle sizes of Patchouli flavonoids liposomes in Example 1 of the present invention and liposomes in Comparative Example 1;

[0032] Figure 2 TEM images of the Patchouli flavonoids liposomes in Example 1 of the present invention and the liposomes in Comparative Example 1;

[0033] Figure 3 Schematic diagram comparing the zeta potential of the Patchouli flavonoids liposomes in Example 1 of the present invention and the liposomes in Comparative Example 1;

[0034] Figure 4 The effects of different groups of the present invention on HUVECs live / dead cell double staining;

[0035] Figure 5 The effects of different concentrations of Patchouli flavonoids liposomes in Example 1 of the present invention, liposomes and free Patchouli flavonoids monomers in Comparative Example 1 on the viability of RAW264.7 cells are shown;

[0036] Figure 6 The effects of different concentrations of Patchouli flavonoids liposomes in Example 1 of the present invention, liposomes and free Patchouli flavonoids monomers in Comparative Example 1 on HUVECs cell viability are shown;

[0037] Figure 7 Schematic diagram of the compatibility of different concentrations of Patchouli flavonoids liposomes and free Patchouli flavonoids monomers with blood in Example 1 of the present invention;

[0038] Figure 8 The effects of different groups of the present invention on the mRNA expression of pro-inflammatory factors IL6, IL-1β and TNF-α in LPS-induced RAW264.7 inflammatory cells;

[0039] Figure 9 The effects of different groups of the present invention on the fluorescence intensity and distribution of ZO-1, an indicator of barrier function of HUVECs and MLE-12 cells induced by LPS;

[0040] Figure 10 The effects of different groups of the present invention on the expression of ZO-1 protein, an indicator of barrier function of HUVECs and MLE-12 cells induced by LPS;

[0041] Figure 11 This is a statistical diagram of the results of the expression of ZO-1 protein, a barrier function indicator of HUVECs and MLE-12 cells induced by LPS, in different groups of the present invention;

[0042] Figure 12 The effects of different groups of the present invention on the lung index of ALI mice induced by LPS;

[0043] Figure 13 The effect of different groups of the present invention on the total cell number in the alveolar lavage fluid of LPS-induced ALI mice;

[0044] Figure 14 The effect of different groups of the present invention on the total protein concentration in the bronchoalveolar lavage fluid of ALI mice induced by LPS;

[0045] Figure 15 The effects of different groups of the present invention on the pathological damage of lung tissue in ALI mice induced by LPS;

[0046] Figure 16 The effects of different groups of the present invention on the mRNA expression of pro-inflammatory factors IL6, IL-1β and TNF-α in the lung tissue of mice induced by LPS;

[0047] Figure 17 The effects of different groups of the present invention on the fluorescence expression intensity and distribution of lung barrier indicators ZO-1, VE-Cadherin, E-Cadherin and Claudin5;

[0048] Figure 18 The effects of different groups of the present invention on the mRNA expression of lung barrier indicators ZO-1, VE-Cadherin, E-Cadherin and Claudin5;

[0049] Figure 19The effects of different groups of the present invention on the expression of lung barrier indicators ZO-1, VE-Cadherin, E-Cadherin and Claudin5 proteins;

[0050] Figure 20 This is a statistical diagram of the expression results of lung barrier indicators ZO-1, VE-Cadherin, E-Cadherin and Claudin5 proteins in different groups of the present invention;

[0051] Figure 21 This is the effect of different groups of the present invention on the expression of related proteins in the TLR4-MyD88-NF-κB / MAPK pathway. DETAILED DESCRIPTION

[0052] The present invention will be described in further detail below with reference to the examples and accompanying drawings, but the present invention is not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples were purchased from the market unless otherwise specified.

[0053] Example 1

[0054] A method for preparing patchouli flavonoids nanoliposomes comprises the following steps:

[0055] S1. Dissolve DPPC, cholesterol, mPEG2000-DSPE, and Patchouli flavonol in 5 mL of chloroform (the molar ratio of DPPC, cholesterol, and mPEG2000-DSPE is 29:14:1). Add 10 mg of Patchouli flavonol, and achieve a molar ratio of Patchouli flavonol to DPPC of 1:7.41. After thorough mixing, remove the chloroform by rotary evaporation at 230 mbar to form a thin film.

[0056] S2. Add 5 mL of PBS buffer to the film formed in step S1, stir the reaction system at 60°C at a speed of 300 r / min for 30 min. After stirring, the film can be fully hydrated and fall off. After obtaining the suspension, place it on ice and perform ultrasound. The ultrasound power is 20%. The ultrasound mode is 15 s per ultrasound, 15 s pause, and the ultrasound is terminated after 30 min of circulation. Use a 0.22 μm filter to filter the suspension after ultrasound dispersion, and then centrifuge the filtrate at a speed of 3000 r / min for 1 h. After the centrifugation is completed, purified liposomes are obtained. Use PBS buffer to make the volume of the purified liposomes constant to 3 mL for standby use.

[0057] The patchouli flavonoids nanoliposomes in this embodiment, denoted as Pac-lipo, include a membrane material and a core material, wherein the core material is patchouli flavonoids, and the membrane material is prepared from DPPC, cholesterol and mPEG2000-DSPE; the molar ratio of DPPC, cholesterol and mPEG2000-DSPE in the core material is 29:14:1.

[0058] The Patchouli flavonol liposomes of this embodiment were characterized, and the drug loading of the Patchouli flavonol nanoliposomes was 2.61%, and the encapsulation efficiency of Patchouli flavonol nanoliposomes for Patchouli flavonol was 53.71%; Figures 1 to 3 As shown, the Patchouli flavonoids nanoliposomes are spherical, with an average diameter of 117.3 nm and a Zeta potential of -7.24 mV.

[0059] Comparative Example 1

[0060] A method for preparing nanoliposomes is carried out according to Example 1, wherein the difference from Example 1 is:

[0061] In step S1, Patchouli flavonol is not added.

[0062] In this comparative example, the nanoliposomes are denoted as Lipo, which only include the membrane material and are prepared from DPPC, cholesterol and mPEG2000-DSPE; the molar ratio of DPPC, cholesterol and mPEG2000-DSPE in the membrane material is 29:14:1.

[0063] The liposomes obtained in Example 1 and Comparative Example 1 were characterized, and the experimental results are shown in FIG. Figures 1 to 3 As shown, the liposomes obtained in Comparative Example 1 ranged in size from 30-470 nm, while the Patchouli flavonol liposomes obtained in Example 1 ranged in size from 40-300 nm, with average sizes of approximately 116.1 nm and 117.3 nm, respectively. Zeta potential revealed that both the Lipo liposomes obtained in Comparative Example 1 and the Pac-lipo liposomes obtained in Example 1 were negatively charged, with average potentials of -9.06 mV and -7.24 mV, respectively. Transmission electron microscopy revealed that both the Lipo liposomes obtained in Comparative Example 1 and the Pac-lipo liposomes obtained in Example 1 had a regular, uniformly distributed spherical morphology.

[0064] Comparative Example 2

[0065] A method for preparing Patchouli flavonoid nanoliposomes is carried out according to Example 1, wherein the method differs from Example 1 in that:

[0066] In step S1, the molar ratio of Patchouli flavonol to DPPC is 1:20, and the molar ratio of DPPC, cholesterol and mPEG2000-DSPE is 26:7:1.

[0067] The patchouli flavonoids nanoliposomes in this comparative example, denoted as Pac-lipo-2, include a membrane material and a core material, wherein the core material is patchouli flavonoids, and the membrane material is prepared from DPPC, cholesterol and mPEG2000-DSPE; the molar ratio of DPPC, cholesterol and mPEG2000-DSPE in the core material is 26:7:1.

[0068] The patchouli flavonol liposomes in this comparative example were characterized, and it was found that the drug loading capacity of the patchouli flavonol nanoliposomes Pac-lipo-2 was 0.63%, and the encapsulation efficiency of the patchouli flavonol nanoliposomes Pac-lipo-2 for patchouli flavonol was 40%.

[0069] Experimental study on the pharmacological effects of Pac-lipo

[0070] Next, cell and animal experiments were conducted using the Patchouli flavonol liposomes Pac-lipo prepared in Example 1, the liposomes Lipo in Comparative Example 1, the Patchouli flavonol nanoliposomes Pac-lipo-2 prepared in Comparative Example 2, the liposomes Lipo-2 in Comparative Example 2, and the free Patchouli flavonol monomer Pachypodol to explore their pharmacological effects.

[0071] 1. Cell experiments and related index determination

[0072] 1. Effect of Pac-lipo on Live / Dead Double Staining of HUVECs

[0073] HUVECs were double-stained for live / dead cells using the Calcein / PI Cytotoxicity Detection Kit (Biyuntian, C2015S). HUVECs were seeded in 12-well culture plates. When the cells reached 60%-70% confluency, culture medium containing 8 μM Pachypodol, Pac-lipo, and Lipo was added. In the control group, an equal volume of PBS buffer was used instead of Pac-lipo for 12 and 24 hours, respectively. The cells were then washed with PBS buffer, stained for live cells with Calcein AM, and for dead cells with Propidium Iodide (PI). The cells were incubated at 37°C for 30 minutes, washed again, and observed and photographed under an inverted fluorescence microscope.

[0074] Figure 4 The results showed that compared with the control group, the growth status of cells in each group was normal and there were fewer dead cells after intervention with Lipo, Pachypodol and Pac-lipo for 12 hours and 24 hours, respectively. This shows that the Pac-lipo of the present invention does not destroy the growth status of cells and has good biosafety.

[0075] 2. Effects of different concentrations of Pac-lipo on RAW264.7 cell viability

[0076] The cytotoxicity of drugs was determined using Cell Counting Kit-8 (CCK-8) reagent (DOJINDO, CK04). RAW264.7 cells were cultured at 1×10 4 / well were seeded in a 96-well culture plate and cultured for 24 hours. The cells were treated with DMEM culture medium containing different concentration gradients of Lipo, Pachypodol and Pac-lipo. In the control group, the culture medium used an equal volume of PBS buffer instead of Pac-lipo. After 24 hours, the supernatant was discarded, 10 μL of CCK-8 solution and 100 μL of complete culture medium were added to each well, and the plates were incubated at 37°C in the dark for 1-2 hours. Finally, the absorbance of each well was measured at a wavelength of 450 nm.

[0077] Figure 5 The results showed that within the concentration range of 0.5-8 μM, Pac-lipo of the present invention had almost no effect on the viability of RAW264.7 cells, and at 8 μM, the cell viability was better than that of the free monomeric Pachypodol group, indicating that at a concentration of 8 μM, the effect of Pac-lipo on the viability of RAW264.7 cells was less than that of monomeric Pachypodol.

[0078] 3. Effects of different concentrations of Pac-lipo on HUVECs cell viability

[0079] CCK-8 reagent was used to determine the cytotoxicity of drugs. HUVECs cells were cultured at 5×10 3 Cells were seeded at a density of 100 μg / well in a 96-well culture plate and cultured for 24 h. The cells were treated with DMEM medium containing different concentration gradients of Lipo, Pachypodol and Pac-lipo. In the control group, the culture medium used an equal volume of PBS buffer instead of Pac-lipo. After 24 h, the supernatant was discarded, 10 μL of CCK-8 solution and 100 μL of complete culture medium were added to each well, and the plates were incubated at 37°C in the dark for 1-2 h. Finally, the absorbance of each well was measured at a wavelength of 450 nm.

[0080] Figure 6 The results showed that within the concentration range of 0.5-8 μM, the Pac-lipo of the present invention had little effect on the viability of HUVECs cells.

[0081] according to Figure 5 and Figure 6 Taking into account the results, a concentration of 8 μM was selected for Pac-lipo intervention in cells and animals.

[0082] 4. Schematic diagram of the compatibility of Pac-lipo with blood at different concentrations

[0083] Take 2mL of normal mouse whole blood, add 1000U / mL heparin sodium solution and centrifuge (5000r / min, 5min, room temperature), discard the upper plasma, dilute and resuspend the precipitate with an appropriate amount of normal saline, and wash 3 times until the supernatant is bloodless. Take an appropriate amount of red blood cells from the lower layer into a centrifuge tube, add normal saline to prepare a 2% red blood cell solution, and then add different concentration gradients of Lipo, Pachypodol and Pac-lipo. Add equal volumes of pure water and PBS buffer to serve as the positive control group and negative control group respectively. After standing at room temperature for 3h, centrifuge at 1000r / min for 5min and take pictures and record. Then aspirate the supernatant and detect it on a microplate reader at 540nm to calculate the hemolysis rate. Hemolysis rate = (Aa-A0) / (Ab-A0)×100%. (Aa, A0 and Ab are the absorbance of the experimental group, negative control group and positive control group respectively)

[0084] Figure 7 The results showed that the Pac-lipo of the present invention is incompatible with blood and has good biocompatibility.

[0085] 5. Effect of Pac-lipo on the mRNA expression of proinflammatory cytokines IL-6, IL-1β, and TNF-α in LPS-induced RAW264.7 cells

[0086] RAW264.7 cells were seeded in 12-well plates. When the cells reached a density of 60%-70%, serum-free medium was replaced with culture medium. Pachypodol, Pac-lipo, and Lipo were added to a concentration of 8 μM. A control group received PBS buffer (equal volume to Pac-lipo). After 12 hours, the serum-free medium was replaced again, and 100 ng / mL LPS was added for 4 hours. Fresh serum-free medium was then replaced, and drug treatment was continued for 6 hours. After the experimental treatment, cells were harvested for RNA extraction. Total RNA from RAW264.7 cells was extracted using an RNA extraction kit (Tiangen Bio, DP419) according to the manufacturer's instructions. The purity and concentration of the extracted RNA were determined using Nanodrop. Next, mRNA was reverse transcribed into cDNA using the PrimeScript RT Kit (Takara, RR047B). mRNA expression of target genes (IL-6, IL-1β, TNF-α, and Tubulin) was analyzed by qRT-PCR using the cDNA from each sample as a template. After the reaction, Tubulin was used as the internal reference gene and 2 -ΔΔCT Methods The relative expression levels of each gene were calculated.

[0087] The primer sequences are:

[0088] TNF-α-F:TTGTCTACTCCCAGGTTCTCT;

[0089] TNF-α-R:GAGGTTGACTTTCTCCTGGTATG;

[0090] IL-1β-F:GGTGTGGTGACGTTCCCATTA;

[0091] IL-1β-R:ATTGAGGTGGAGAGCTTTCAG;

[0092] IL-6-F:CTTCCATCCAGTTGCCTTCT;

[0093] IL-6-R:CTCCGACTTGTGAAGTGGTATAG;

[0094] Tubulin-F:AGCAGCTACTTTGTGGAGTG;

[0095] Tubulin-R:TCGGAGATGCGCTTGAATAG.

[0096] Figure 8 The results of A showed that Pac-lipo of the present invention could significantly reduce the increase in mRNA levels of pro-inflammatory factors IL-6, IL-1β and TNF-α caused by LPS stimulation, and reduce the inflammatory level of RAW264.7 cells.

[0097] Figure 8 B The results showed that Pac-lipo-2 had no significant anti-inflammatory effect.

[0098] In the figure, * indicates that the group has a significant difference from the control group in the significance test, P < 0.05; # indicates that the group has a significant difference from the model group in the significance test, P < 0.05; Indicates that there is a significant difference between the two groups in the significance test, P < 0.05.

[0099] 6. Effects of Pac-lipo on the fluorescence intensity and distribution of ZO-1, a barrier function marker, in LPS-induced HUVECs and MLE-12 cells

[0100] HUVECs and MLE-12 cells were seeded in 0.17 mm glass-bottomed culture dishes. When the cell density reached 100%, the cells were stimulated with 1 μg / mL LPS for 24 hours. In the control group, PBS was used instead of LPS. Except for the control and model groups, the other three experimental groups were treated with pachypodol, Pac-lipo, and Lipo (8 μmol / L) at the same concentration in the culture dish. After 24 hours, immunofluorescence staining was performed as follows: cells were removed, fixed with 4% paraformaldehyde for 10 minutes, permeabilized with 0.5% Triton X-100 in PBS buffer for 10 minutes, and blocked with 5% BSA in PBS buffer for 1 hour. Immunoblotting was then performed with ZO-1 (21773-1-AP, provided by Proteintech, diluted 1:500) and incubated with the primary antibody diluent overnight at 4°C. The next day, the cells were incubated with the corresponding Cy3 fluorescent secondary antibody (406402 provided by Biolegend was used for immunoblotting experiments at a dilution of 1:200) at room temperature in the dark for 1 h. DAPI (4',6-diamidino-2-phenylindole) was used to counterstain the cell nuclei for 20 min. The cells were photographed using a Zeiss laser confocal microscope at 63× oil immersion.

[0101] Figure 9 The results showed that compared with the control group, the model group had significantly reduced expression of the tight junction protein ZO-1, and the tight junctions between cells were severely damaged. However, compared with the model group, the expression of ZO-1 in the Pac-lipo group was significantly increased. This indicates that the Pac-lipo of the present invention can improve the damage to the barrier of HUVECs and MLE-12 cells caused by LPS.

[0102] In the figure, * indicates that the group has a significant difference from the control group in the significance test, P < 0.05; # indicates that the group has a significant difference from the model group in the significance test, P < 0.05; Indicates that there is a significant difference between the two groups in the significance test, P < 0.05.

[0103] 7. Effect of Pac-lipo on LPS-induced protein expression of ZO-1, a barrier function marker in HUVECs and MLE-12 cells

[0104] HUVECs and MLE-12 cells were seeded in 6-well plates and stimulated with 1 μg / mL LPS when cells reached 100% density. In the control group, PBS was used instead of LPS. Pachypodol, Pac-lipo, and Lipo were added to the treatment groups to a drug concentration of 8 μmol / L. Cells were harvested after 24 hours of treatment. A mixture of RIPA buffer (RadioImmunoprecipitation Assay Lysis Buffer; Beyotime), 1 mmol / L PMSF (phenylmethylsulfonyl fluoride; Sangon), and 1 mmol / L phosphatase inhibitor (Congwei Century) at a volume ratio of 100:1:1 was added to the cells. The cells were shaken on ice for 30 minutes and centrifuged at 12,000 rpm for 10 minutes at 4°C. The supernatant was collected and protein concentration was measured using a BCA kit. The cell protein sample of the measured concentration was added to 5× SDS-PAGE protein loading buffer and boiled at 95°C for 10 minutes. The sample was then loaded onto a pre-prepared gel and separated by SDS-PAGE electrophoresis at 80V for 30 minutes and 120V for 1.5 hours. The membrane was then transferred to a 5% skim milk powder in a Petri dish and blocked on a shaker for 2 hours. The membrane was then incubated with ZO-1 antibody (Proteintech, 21773-1-AP, 1:5000) overnight at 4°C. The membrane was then incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody for 1 hour at room temperature. Finally, the protein bands on the membrane were imaged using a chemiluminescence imaging system.

[0105] Figures 10-11 The results showed that the expression of protein bands in LPS-stimulated HUVECs cells was reduced compared with that in the control group, while the intensity of the protein bands increased significantly after Pac-lipo treatment. The increasing effect of the Pac-lipo group was more obvious than that of free Pachypodol. The bands of MLE-12 cells also showed the same trend. From the protein level, it was shown that Pac-lipo of the present invention can improve the damage to the lung barrier of HUVECs and MLE-12 cells caused by LPS.

[0106] In the figure, * indicates that the group has a significant difference from the control group in the significance test, P < 0.05; # indicates that the group has a significant difference from the model group in the significance test, P < 0.05; Indicates that there is a significant difference between the two groups in the significance test, P < 0.05.

[0107] 2. Animal Experiments and Determination of Related Indicators

[0108] 1. Effect of Pac-lipo on LPS-treated mouse lung index

[0109] After anesthesia, the mice were injected with 5 mg / kg LPS intratracheally to induce modeling on day 0. The control group used PBS with the same volume as LPS instead. After that, the mice inhaled 8μM Pachypodol, 8μM Pac-lipo and Lipo (drug-free, so the volume was the same as Pac-lipo) twice a day, 6 ml each time for 20 minutes; the control group and the model group inhaled PBS with the same volume as Pac-lipo for the same time. On the third day after modeling, the mice were killed and the whole fresh lung tissue of each mouse was collected and weighed (W1). The weight of the mice was recorded at the time of sacrifice (W2). The lung coefficient was calculated according to the formula: W1 / W2×100%.

[0110] Figure 12 The results showed that the Pac-lipo of the present invention significantly reduced the lung index of mice with acute lung injury caused by LPS and alleviated lung edema.

[0111] In the figure, * indicates that the group has a significant difference from the control group in the significance test, P < 0.05; # indicates that the group has a significant difference from the model group in the significance test, P < 0.05; Indicates that there is a significant difference between the two groups in the significance test, P < 0.05.

[0112] 2. Effect of Pac-lipo on total cell count and total protein in bronchoalveolar lavage fluid of LPS-induced ALI mice

[0113] On the third day after modeling, mice were anesthetized with 3% chloral hydrate, their limbs were fixed, and a catheter was inserted into the mouse trachea through a small incision in the neck and fixed. The mouse trachea was lavaged with pre-cooled sterile saline or PBS, 0.7 mL each time, and repeated three times. The collected lavage fluid was centrifuged at 4°C and 3000 r / min for 10 min for the detection of total protein concentration and total cell count.

[0114] Figure 13 and Figure 14 The results showed that compared with the LPS-induced model group, the Pac-lipo of the present invention significantly reduced the total cell count and total protein concentration in the alveolar lavage fluid of ALI model mice and enhanced the permeability of the lungs.

[0115] In the figure, * indicates that the group has a significant difference from the control group in the significance test, P < 0.05; # indicates that the group has a significant difference from the model group in the significance test, P < 0.05; Indicates that there is a significant difference between the two groups in the significance test, P < 0.05.

[0116] 3. Effect of Pac-lipo on LPS-induced ALI mouse lung pathological damage

[0117] Fresh lung tissue was fixed in 4% paraformaldehyde for 24 hours, then embedded in paraffin and sectioned to 4 μm thickness. The sections were removed using glass slides and dried, then stained with hematoxylin and eosin (HE) according to the protocol. The stained slides were dried, mounted, and photographed under a light microscope.

[0118] Figure 15 The results showed that Pac-lipo of the present invention significantly improved lung pathological damage caused by LPS stimulation, such as inflammatory cell infiltration of lung tissue, alveolar wall thickening, alveolar structural destruction, and inflammatory exudate.

[0119] Effect of Pac-lipo on the mRNA expression of proinflammatory cytokines IL-6, IL-1β, and TNF-α in the lung tissue of LPS-induced ALI mice

[0120] Total RNA was extracted from lung tissue according to the instructions of the RNA extraction kit (Tiangen Biotechnology, DP419). The extracted RNA content was determined by Nanodrop, and the PrimeScript RT kit (Takara, RR047B) was used to reverse transcribe the mRNA into cDNA. The target genes (IL6, IL-1β, TNF-α, and Tubulin) were amplified by qRT-PCR using the cDNA of each sample as a template to analyze the mRNA expression of each target gene. Tubulin was used as an internal reference gene after the reaction. -ΔΔCT Methods The relative expression of each gene was calculated. (Primer sequences:

[0121] TNF-α-F:TTGTCTACTCCCAGGTTCTCT;

[0122] TNF-α-R:GAGGTTGACTTTCTCCTGGTATG;

[0123] IL-1β-F:GGTGTGGTGACGTTCCCATTA;

[0124] IL-1β-R:ATTGAGGTGGAGAGCTTTCAG;

[0125] IL-6-F:CTTCCATCCAGTTGCCTTCT;

[0126] IL-6-R:CTCCGACTTGTGAAGTGGTATAG;

[0127] Tubulin-F:AGCAGCTACTTTGTGGAGTG;

[0128] Tubulin-R:TCGGAGATGCGCTTGAATAG)

[0129] Figure 16 The results showed that the Pac-lipo of the present invention can significantly reduce the mRNA levels of proinflammatory factors IL-6, IL-1β and TNF-α in ALI mice induced by LPS, and its anti-inflammatory effect is better than that of monomeric Pachypodol.

[0130] In the figure, * indicates that the group has a significant difference from the control group in the significance test, P < 0.05; # indicates that the group has a significant difference from the model group in the significance test, P < 0.05; Indicates that there is a significant difference between the two groups in the significance test, P < 0.05.

[0131] 5. Effects of Pac-lipo on the fluorescence expression and distribution of lung tissue barrier function indicators ZO-1, VE-Cadherin, E-Cadherin and Claudin5

[0132] First, antigen retrieval was performed on paraffin-embedded lung sections, followed by immunofluorescence staining according to the cell-based immunofluorescence staining protocol. Antibodies used included the endothelial barrier marker VE-cadherin (detected using sc-9989 provided by Santa Cruz, at a dilution of 1:100), claudin 5 (Proteintech, 29767-1-AP, 1:500), the epithelial tight junction marker E-cadherin (Proteintech, 20874-1-AP, 1:500), and ZO-1 (Proteintech, 21773-1-AP, 1:500), which is expressed in endothelial and epithelial cells. Corresponding fluorescent secondary antibodies used included donkey anti-rabbit Cy3 (Biolegend, 406402, 1:200) and goat anti-mouse Cy3 (Biolegend, 405309, 1:200). Finally, sections were mounted and photographed under a 40× oil immersion confocal microscope.

[0133] Figure 17 The results showed that the Pac-lipo of the present invention can increase the levels of tight junction protein molecules ZO-1, VE-Cadherin, E-Cadherin and Claudin5 that were originally reduced in the lung tissue of LPS-induced ALI mice, and alleviate lung barrier damage.

[0134] 6. Effects of Pac-lipo on the mRNA expression of lung barrier markers ZO-1, VE-Cadherin, E-Cadherin, and Claudin5

[0135] Total RNA was extracted from lung tissue according to the instructions of the RNA extraction kit (Tiangen Biotechnology, DP419). The extracted RNA content was determined by Nanodrop, and the mRNA was reverse transcribed into cDNA using the PrimeScript RT kit (Takara, RR047B). The target genes (ZO-1, VE-Cadherin, E-Cadherin, and Claudin5) were amplified and analyzed by qRT-PCR using the cDNA of each sample as a template. Tubulin was used as an internal reference gene after the reaction. -ΔΔCT Methods The relative expression levels of each gene were calculated.

[0136] The primer sequences are:

[0137] ZO-1-F:ACTCCCACTTCCCCAAAAAC;

[0138] ZO-1-R:CCACAGCTGAAGGACTCACA;

[0139] VE-Cadherin-F:ACTCCCACTTCCCCAAAAAC;

[0140] VE-Cadherin-R:CCACAGCTGAAGGACTCACA;

[0141] E-Cadherin-F:GATCCTGACCAGCAGTTCGTT;

[0142] E-Cadherin-R:CCTCAAAGGGGTTCCTCGTTC;

[0143] Claudin5-F:ACTGCCTTCCTGGACCACAAC;

[0144] Claudin5-R:CGCCAGCACAGATTCATACACCT;

[0145] Tubulin-F:AGCAGCTACTTTGTGGAGTG;

[0146] Tubulin-R:TCGGAGATGCGCTTGAATAG.

[0147] Figure 18 The results showed that the Pac-lipo of the present invention significantly alleviated the lung barrier function of the lung tissue of ALI mice caused by LPS.

[0148] 7. Effects of Pac-lipo on the protein expression of lung barrier markers ZO-1, VE-Cadherin, E-Cadherin, and Claudin5

[0149] 50 mg of lung tissue was placed in a centrifuge tube. A protein lysis buffer containing RIPA, PMSF, and a phosphatase inhibitor was added at a ratio of 100:1:1. Magnetic beads were then added to homogenize the tissue. The mixture was then centrifuged at 4°C and 12,000 rpm for 10 minutes. The supernatant was collected and the protein concentration was measured using a BCA kit. The lung tissue protein sample with the measured concentration was added with 5× SDS-PAGE protein loading buffer, boiled at 95°C for 10 minutes, and loaded onto a pre-prepared gel for SDS-PAGE separation at 80V for 30 minutes and 120V for 1.5 hours. After electrophoresis, the membrane was transferred at 250 mA for 2 hours. After transfer, the membrane was transferred to a culture dish containing 5% skim milk powder and blocked on a shaker for 2 hours. The membrane was then incubated overnight at 4°C with primary antibodies against ZO-1 (Proteintech, 21773-1-AP, 1:5000), VE-Cadherin (Santa Cruz, sc-9989, 1:500), E-Cadherin (Proteintech, 20874-1-AP, 1:20000), and Claudin5 (Proteintech, 29767-1-AP, 1:5000). The membrane was then incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody for 1 hour at room temperature. Finally, protein bands on the membrane were visualized using a chemiluminescence imaging system.

[0150] Figure 19 and Figure 20 The results showed that compared with the model group, the protein band intensities of ZO-1, VE-Cadherin, E-Cadherin and Claudin5 in the Pac-lipo group of the present invention were significantly increased, indicating that Pac-lipo significantly improved the barrier function of lung tissue.

[0151] In the figure, * indicates that the group has a significant difference from the control group in the significance test, P < 0.05; # indicates that the group has a significant difference from the model group in the significance test, P < 0.05; Indicates that there is a significant difference between the two groups in the significance test, P < 0.05.

[0152] 8. Inhibitory effect of Pac-lipo on activation of the pro-inflammatory signaling TLR4-MyD88-NF-κB / MAPK pathway

[0153] 50 mg of lung tissue was placed in a centrifuge tube. A protein lysis buffer containing RIPA, PMSF, and a phosphatase inhibitor was added at a ratio of 100:1:1. Magnetic beads were then added to homogenize the tissue. The mixture was then centrifuged at 4°C and 12,000 rpm for 10 minutes. The supernatant was collected and the protein concentration was measured using a BCA kit. The lung tissue protein sample with the measured concentration was added with 5× SDS-PAGE protein loading buffer, boiled at 95°C for 10 minutes, and loaded onto a pre-prepared gel for SDS-PAGE separation at 80V for 30 minutes and 120V for 1.5 hours. After electrophoresis, the membrane was transferred at 250 mA for 2 hours. After the transfer was completed, the membrane was transferred to a culture dish containing 5% skim milk powder and blocked on a shaker for 2 h. Then, the membrane was incubated at 4°C with TLR4 (Santa Cruz, sc-293072, 1:500), MyD88 (Santa Cruz, sc-74532, 1:500), p-IκBα (Santa Cruz, sc-8404, 1:500), IκBα (Santa Cruz, sc-1643, 1:500), p-NF-κB p65 (Santa Cruz, sc-166748, 1:500), NF-κB p65 (Santa Cruz, sc-8008, 1:500), p-p38 MAPK14 (Santa Cruz, sc-7973, 1:500), and p-p38 MAPK14 (Santa Cruz, sc-8404, 1:500). The membrane was incubated overnight with primary antibodies (Proteintech, sc-81621, 1:500), p-ERK1 / 2 (Santa Cruz, sc-81492, 1:500), ERK1 / 2 (Santa Cruz, sc-514302, 1:500), ZO-1 (Proteintech, 21773-1-AP, 1:5000), VE-Cadherin (Santa Cruz, sc-9989, 1:500), Claudin 5 (Proteintech, 29767-1-AP, 1:5000), and E-Cadherin (Proteintech, 20874-1-AP, 1:5000). The membrane was then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hour at room temperature. Finally, protein bands on the membrane were visualized using a chemiluminescent imaging system.

[0154] Figure 21 The results showed that Pac-lipo could inhibit the expression of TLR4 and MyD88, downregulate the phosphorylation levels of IκBα, NF-κB p65, p38MAPK14, and ERK1 / 2, and inhibit the activation of the TLR4-MyD88-NF-κB / MAPK pathway, thereby exerting an anti-inflammatory effect, and its effect was significantly better than that of monomeric Pachypodol.

[0155] In the figure, * indicates that the group has a significant difference from the control group in the significance test, P < 0.05; # indicates that the group has a significant difference from the model group in the significance test, P < 0.05; Indicates that there is a significant difference between the two groups in the significance test, P < 0.05.

[0156] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the inventive concept of the present invention, which all fall within the scope of protection of the present invention.

Claims

1. A Patchouli flavonoids nanoliposome, comprising a membrane material and a core material, characterized in that: The core material is Patchouli flavonoids, and the membrane material is prepared from DPPC, cholesterol and mPEG2000-DSPE; the molar ratio of DPPC, cholesterol and mPEG2000-DSPE in the membrane material is (25-35): (10-20): 1, the molar ratio of Patchouli flavonoids to DPPC is 1: (5-10), and the drug loading capacity of the Patchouli flavonoids nanoliposomes is 1-4%.

2. The Patchouli flavonoids nanoliposome according to claim 1, characterized in that The encapsulation efficiency of the Patchouli flavonoids nanoliposomes for Patchouli flavonoids is 50-56%.

3. The Patchouli flavonoids nanoliposome according to claim 1, characterized in that The Patchouli flavonoids nanoliposomes are spherical, and the average diameter of the spheres is 115-120 nm.

4. The Patchouli flavonoids nanoliposome according to claim 1, characterized in that The zeta potential of the Patchouli flavonoids nanoliposomes is -5 to -9 mV.

5. A method for preparing the Patchouli flavonoids nanoliposomes according to any one of claims 1 to 4, characterized in that: The steps include: S1. DPPC, cholesterol, mPEG2000-DSPE, and Patchouli flavonol were dissolved in a solvent and mixed uniformly. The solvent was removed by rotary evaporation to form a thin film. S2. Add an aqueous medium to the film formed in step S1 to hydrate and peel off the film to obtain a suspension, and then ultrasonically disperse it to obtain Patchouli flavonoid liposomes.

6. The preparation method according to claim 5, characterized in that The temperature for fully hydrating and shedding the film in step S2 is 50-70°C.

7. Use of the Patchouli flavonoids nanoliposomes according to any one of claims 1 to 4 in the preparation of a medicament for treating acute lung injury.

8. The use according to claim 7, characterized in that The administration method of the medicine for treating acute lung injury is aerosol inhalation administration.

Citation Information

Patent Citations

  • Selaginella doederleinii hieron total biflavone proliposome and preparation method thereof

    CN110478379A

  • Aerosol inhalation nano-liposome composition for treating pulmonary fibrosis as well as preparation method and application of aerosol inhalation nano-liposome composition

    CN118236357A