Yeast source mucoprotein with moisturizing effect and preparation method thereof

Abstract

The invention relates to the field of biological moisturizing, in particular to yeast-source mucoprotein with a moisturizing effect and a preparation method thereof, and the preparation method comprises a recombinant strain construction method, a fermentation production method and a separation and purification method. The mucoprotein provided by the invention has good moisturizing performance, has large-scale industrial production capacity, and has good application prospects.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to yeast-derived mucin, including its application, and production and purification methods. Background Art

[0002] Mucins are copolymers of proteins and sugars that, at the molecular level, consist of an unstructured polypeptide backbone and dense serine (Ser) and threonine (Thr)-linked O-sugar grafts. Glucan side chains usually account for 50% or more of the molecular weight of glycoproteins and are linear or branched. They are often negatively charged at neutral pH due to being capped with sialic acid or sulfate groups. The special physical properties of mucins arise from their unique molecular and chemical structure. The arranged O-glucans interact strongly with water molecules, allowing mucins to hydrate, lubricate, and protect biological interfaces. In the early evolution of metazoans, mucins became a protective biopolymer between cells and tissues. Secreted and cell surface mucins are primarily responsible for protecting mucosal surfaces from dehydration, mechanical stress, oxidative degradation, and infection by viruses and bacteria.

[0003] Mucins are defined by their proline (Pro), threonine (Thr), and serine (Ser)-rich regions (PTS domains) that are heavily O-glycosylated on these Thr and Ser residues. The PTS domains are usually composed of a variable number of tandem repeats (TRs) that differ in both sequence and length between different mucin family members. For example, most human alleles contain between 20 and 125 repeat copies (each allele can have a unique number of repeats). Typical mucin family members include gel-forming mucins (MUC2, 5AC, 5B, 6, and 19), membrane mucins (MUC1, 3A, 3B, 4, 12, 13, 15, 16, 17, 18, 20, and 21), other secreted mucins (MUC7 and 8), and some incompletely classified family members (MUC9, 14, and 22). In addition to the typical family members, there are a variety of glycoproteins that contain densely O-glycosylated PTS domains. According to our definition of mucin, we include all typical mucin family members, as well as additional glycoproteins containing an O-glycosylation sequence of at least 100 consecutive amino acids with a Pro content of 5% or more and a Ser / Thr content of 20% or more. In this definition, lubricin and densely O-glycosylated transmembrane proteins, such as podocalins, are also classified as mucins.

[0004] Transmembrane mucins are present on the apical side of mucosal epithelial cells and are also found on hematopoietic cells. They play a role in intracellular signaling and are also part of the extracellular glycosylation. Transmembrane mucins consist of a C-terminal cytoplasmic tail, a transmembrane region, and an extracellular part. They are characterized by the SEA (sea urchin sperm protein, enterokinase, and agrin) domain or special variants of the VWD (Von Willebrand factor D) domain, and a repeating domain consisting of tandem repeats rich in the amino acids Pro, threonine, and serine. The serine and threonine in the extracellular region are highly O-glycosylated and are important components of the glycocalyx. The size and number of tandem repeats vary greatly between different mucins. The PTS domain forms a scaffold for dense and heterogeneous O-glycosylation, resulting in a closely packed structure, similar to a bottlebrush. Carbohydrate chains make up 80% of the total mass of mucins and contribute to the special physical properties of mucins, such as high viscosity.

[0005] Gel-forming mucins are structurally similar to transmembrane mucins, but they are secreted rather than membrane-bound. Typical gel-forming mucins consist of an N-terminal cysteine-rich VWD domain, a large PTS domain, and a C-terminal ‘CK’ domain (cysteine ​​knot). The N-terminal region participates in polymerization via intermolecular disulfide bonds, while the C-terminal CK domain participates in the dimerization of monomers. A common feature of gel-forming mucins is the ability of monomers to form a hygroscopic branched network of polymers, which is responsible for the gel properties of the mucus lining. Due to their size and polymeric properties, mucins are thought to be densely packed in secretory granules in a dehydrated state, regulated by acidic pH and calcium-based charge shielding. In vitro studies using parts of the intestinal mucin MUC2 or the respiratory mucin MUC5B proposed a model for the packaging of mucins into secretory granules, emphasizing the importance of pH and calcium. According to one of the studies, MUC2 is thought to assemble into a polygonal ring through dimerization of the termini and calcium-dependent interactions between multiple N-termini, allowing for compaction within secretory granules. The secretion of mucins is accompanied by a rise in pH and removal of calcium ions, leading to rapid unfolding and hydration, causing mucins to expand more than 1000-fold in volume and form higher-order meshwork structures that line the epithelial surface.

[0006] Mucins have an amphiphilic character, which is probably what enables them to act as lubricants on a wide range of surfaces. The hydrophobic ends of the macromolecules allow mucins to bind to hydrophobic surfaces. The polar glycosylated region of mucins has two functions at once: first, this region is thought to promote the adsorption of mucins to polar surfaces; second, the high density of glycans in this region is responsible for the good hydration of mucins, a property that is essential for hydration-lubrication, i.e. the exchange of mucin-bound water with free water due to frictional shear stress. Two other properties of mucus that are closely related to the amphiphilic nature of mucins are gel formation and selective permeability. Through their hydrophobic ends, mucins can reversibly assemble into three-dimensional networks, but the details of this process are still not fully understood and depend on many other factors, including pH and buffer ionic strength. Once a mucin network is formed, it can selectively allow or deny the passage of particles and molecules by employing two different mechanisms: size filtration and interaction filtration. The first mechanism can be understood as a microscopic sieving strategy, in which the spacing between mucin chains defines the maximum diameter of particles that can be transferred through the mucin network. The second mechanism is based on interactions between mucin glycoproteins and solutes in the mucus liquid phase and is conceptually similar to the trapping strategy used by spider webs.

[0007] If a molecule or particle adheres to a mucin, its diffusion is blocked or at least slowed. Electrostatic forces, hydrophobic interactions and specific binding events have been shown to contribute to the selective capture capacity of mucin gels and native mucus samples. Since the molecular interactions for mucoadhesion are diverse, mainly uncharged polar molecules and PEGylated nanoparticles, they seem to diffuse efficiently through mucins. Given the amphipathic structure of mucins, it seems logical that different regions of the mucin glycoprotein are responsible for establishing different variants of mucoadhesion. In fact, the capture capacity of mucins for influenza viruses can be traced back to sialic acid motifs in the glycosylated central region of the glycoprotein, and these glycan residues enable viral binding by targeting its hemagglutinin receptor. However, mucins have a broader antiviral activity and can also inhibit polyomavirus, norovirus and, at least in vitro, human immunodeficiency virus. Since these other types of viruses lack hemagglutinins, it seems unlikely that sialic acid residues are the main active mucin motifs here as well. It remains an open question which parts of the glycoprotein are essential for the broad-spectrum antiviral properties of mucins and how the various glycan motifs function.

[0008] Due to the complex structure and wide range of properties of mucins, characterization of these glycoproteins at the molecular level and on a macroscopic scale (i.e. when studying mucin solutions or gels) requires a large number of different techniques. Classical electrophoretic analysis of mucus samples is very difficult due to the very high molecular weight of mucins; intact mucins do not pass well through polyacrylamide gels. However, gel electrophoresis is very useful for detecting mucin-associated molecules, such as trefoil factor peptides or contaminants generated during the purification process, such as cell debris. If the binding affinity between mucins and other molecules is of interest, microscale thermophoresis is a suitable method and has recently been used to demonstrate the effect of MUC1 glycosylation on the binding efficiency of therapeutic antibodies to mucins. Studying the conformation of mucins requires light scattering techniques or atomic force microscopy (AFM), which can also provide information on the extent of mucin aggregation. On the other hand, fluorescently labeled mucins allow the analysis of their distribution in vitro and in vivo. However, this approach requires mucin-specific staining solutions or the conjugation of purified glycoproteins to appropriate fluorophores.

[0009] As mentioned above, the amphiphilic nature of mucins enables adsorption to various surfaces. Using a quartz crystal microbalance (QCM) it is possible to quantify this adsorption process. If it is also equipped with dissipation monitoring (QCM-D), additional information about the adsorbed mucin layer, such as its viscoelasticity or swelling state, can be obtained. Macroscopically, viscoelasticity can be assessed using shear rheology, a mechanical characterization method that has been widely used to quantify the gel-forming ability of mucins and the efficiency of mucolytic agents and to determine the material properties of cervical mucus, for example during ovulation or as a risk assessment for preterm birth. If local mucus viscoelasticity information is required or when the sample volume is insufficient for macrorheological measurements, microrheological techniques can be used. In this case, tracer particles are embedded in mucus samples or mucin gels and the Brownian motion of these particles is recorded to study their micromechanical environment. Furthermore, if the size of the particles is smaller than the mesh size of the sample, such tracking microscopy experiments can be used to study the permeability of native mucus or mucin gels to nanoparticles and provide important insights into the design of mucus-penetrating drug carriers. However, for the permeation behavior of small molecules into or through mucus gels, this technique cannot be used. Instead, microfluidic experiments have been introduced and used to quantify the diffusion entry and diffusion of protons or peptides into and through mucin gels. In addition, such microfluidic chips can also analyze the stability of mucus plugs and mucus-pathogen interactions.

[0010] Since the main physiological function of mucosal fluids is to act as macromolecular lubricants, there are also technical setups that allow quantifying the lubricity of saliva or other mucin-based fluids. Such tribological setups are available in different configurations, i.e. linear and rotational tribometers as well as fixed and moving contact geometries. In tribological measurements aimed at investigating the molecular principles that impart lubricity to mucin solutions, artificial material pairings, such as Steel-on-PDMS (polydimethylsiloxane) are very suitable. With such material pairings, intermediate levels of lubricity can be easily detected, since the relative difference between the lubricity of water / buffer and mucin solutions is very high. The same material pairing is also suitable for biotribological studies of saliva, since steel mimics the stiff properties of the palate, while PDMS approximates the mechanical properties of the tongue. However, there are also setups where tissue samples or cell monolayers are selected as part of the material pairing. Such semi-biomaterial pairings provide a more realistic assessment of biomimetic lubricants than using pure synthetic materials. After friction experiments on biological or synthetic samples, the amount of surface damage caused by friction stress is also important. Here, optical microscopy methods, especially white light profilometry (a variant of confocal optical microscopy), have proven to be very suitable. Through this technology, it was demonstrated that mucin-based fluids can not only reduce friction on various surfaces, but can also reduce or even completely prevent wear formation.

[0011] For purified mucins to be used in medical products, their biocompatibility needs to be evaluated. Standard tissue culture experiments, such as cell viability / cytotoxicity tests, are a good first step. Simple microbiological tests can also be combined to quantify the antibacterial and antiviral properties of mucins.

[0012] From an application perspective, human interest in mucins dates back to antiquity, when the ancient Greeks reportedly used snail mucus as an anti-inflammatory and anti-aging balm. Until recently, purified mucin products have been used primarily for hydration and lubrication of tissues, including the eyes, cartilage, tendons, mouth, and vocal cords. Over the past decade, interest in mucin biotechnology has surged as it has become increasingly recognized that, in addition to their remarkable physical properties, mucins can possess potent biological activities. Recent studies have demonstrated that mucin O-glucans are involved in the modulation of the immune system and in the phenotype of both commensal and pathogenic microorganisms. For example, mucin O-glycans can inhibit the virulence of Pseudomonas aeruginosa, an opportunistic pathogen that is a common source of nosocomial infections. In addition to saliva and tear film substitutes and lubricants, these larger mucins are gaining attention for a wide range of other applications, including antifouling coatings, anti-aging creams, wound healing agents, antimicrobials, contact lens drops and coatings, advanced biomaterials, and drug delivery agents.

[0013] For shorter mucin fragments, such as small mucin peptides used in anti-tumor vaccines, glycopeptides can be directly synthesized in vitro by chemical and enzymatic methods.

[0014] Currently, larger mucins are usually obtained from natural sources. Since all vertebrates and some invertebrates produce some kind of mucus, in principle there are many crude mucus containing mucins available for purification. However, the traditional commercial method mainly uses bovine submandibular glands and porcine gastric mucosa as mucus raw materials. Porcine gastric mucin (PGM) and bovine submandibular mucin (BSM) have been used in many scenarios, mainly due to the excellent livestock farming industry in the United States and Europe providing abundant and cheap raw materials. In comparison, other important natural mucus sources, such as snails, jellyfish, hagfish and corals, although also widely concerned, are more difficult to cultivate and more challenging to industrialize. Moreover, the mucins from these alternative sources are usually poorly characterized and many properties are unclear, which is also a big problem for more demanding biomedical applications.

[0015] The typical mucin extraction and purification process mainly includes mucus collection, cell removal, mucin separation, buffer exchange and drying. The first step of the purification process is to collect crude materials containing mucin from animal tissues. Different collection techniques are used according to the different sources of mucus: for example, to collect mucus samples from pig stomachs, mucus can be scraped or squeezed out from the inner surface of the stomach that has been dissected and rinsed; solid / liquid / liquid extraction can also be used to obtain mucin from homogenized pig stomachs, and lipids can be removed from crude products at the same time. Electrical stimulation of superficial mucus glands to induce large amounts of mucus secretion is also a common collection method. Crude mucin extracts can be obtained from the surface of living or anesthetized snails and hagfish. Jellyfish mucin can be obtained from the gelatinous layer of sliced ​​jellyfish by precipitation with ethanol and subsequent reconstitution in water, while coral mucus comes from the exudate of inverted corals exposed to air. An inevitable consequence of collecting mucus from animal tissues is that crude mucin products are contaminated by cells, cell fragments and tissue fragments. Therefore, it is necessary to remove the above impurities by centrifugation or filtration, which is usually carried out in an appropriate buffer solution, which often contains a reducing agent or denaturant to ensure the dissolution of mucin oligomers, as well as antibacterial agents and protease inhibitors to prevent bacteria and proteases from degrading mucin. Subsequently, the molecular weight, solubility, charge, thermal stability and other property differences between mucin and other components of mucus can be used to separate and purify by ultrafiltration, ethanol precipitation, isoelectric precipitation, heating and other methods; another method to obtain higher purity mucin is chromatography, which usually uses size exclusion chromatography or ion exchange chromatography to purify mucin, which respectively utilizes the high molecular weight and negative surface charge of mucin. Subsequently, more small molecule impurities can be removed by dialysis or ultrafiltration, and the protein can be stored in a suitable buffer system; freeze-drying or spray-drying can also be selected as needed to obtain mucin powder that is easier to store.

[0016] Despite its great development prospects, its wider application in the biomedical field is currently limited by the reliance on natural sources for the extraction of large molecular weight mucins. It is extremely challenging to purify large quantities of high-quality mucins from natural sources. On the one hand, the amount of mucins secreted by animal organs is limited, and the production process relies on extraction procedures with poor scalability, which greatly limits large-scale production. On the other hand, differences between product batches are almost inevitable, especially when animals are sick or their organs are inflamed. Mucin expression and glycosylation patterns will vary. Animal sources significantly increase the risk of pathogen contamination. Mucins also lack a fully applicable sterilization solution. In addition, electrical stimulation and salt water immersion of live snails and hagfish also greatly violate animal welfare principles. Summary of the invention

[0017] In order to solve the current problems of difficult large-scale production of natural-source mucin, large batch-to-batch differences, high risk of pathogen contamination, and non-compliance with animal welfare principles, and to achieve large-scale industrial production and wide-range application of mucin with moisturizing function, we invented a yeast-derived mucin with moisturizing effect and a preparation method thereof, including construction of a recombinant strain, a fermentation production method, and a separation and purification method.

[0018] The present invention provides a yeast-derived mucin, whose amino acid sequence is shown in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7, and SEQ ID NO: 10; optionally, it also includes a signal peptide and / or a purification tag sequence, more specifically, its signal peptide sequence is a sequence of a mucin self signal peptide or an α-MF signal peptide, and more specifically, its amino acid sequence is shown in SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, and SEQ ID NO: 11.

[0019] The present invention thus provides a gene encoding a yeast-derived mucin, which encodes the yeast-derived mucin as claimed in claim 1. Preferably, the nucleotide sequence thereof is shown in SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, or SEQ ID NO:12.

[0020] Further provided are a recombinant expression vector and a recombinant host cell containing the encoding gene.

[0021] The present invention provides a method for producing yeast-derived mucin, which is characterized by culturing yeast cells into which a recombinant expression vector containing the coding gene is introduced to produce the yeast-derived mucin.

[0022] Specifically, the yeast cell is Pichia pastoris, specifically GS115 or KM71H strain.

[0023] In a specific embodiment, shake flask fermentation or fed-batch fermentation is adopted.

[0024] Furthermore, the method also includes a separation and purification step of yeast-derived mucin, and the specific purification steps are as follows:

[0025] 1) Using ethanol precipitation method to purify yeast fermentation broth, use 40% or more ethanol final concentration to directly precipitate the target protein; or first use 20%-35% ethanol final concentration, let it stand at 4°C for 1-2 hours to precipitate the impurity protein, and then use 40% ethanol final concentration, let it stand at 4°C for 1-2 hours to precipitate the target protein;

[0026] 2) Further comprising: using chromatography to finely purify the target protein, specifically, the selected chromatographic medium is an anion exchange chromatographic medium, including but not limited to strong anion exchange, weak anion exchange, and mixed mode ion exchange, and the selected buffer is a buffer of pH 5.0-7.5, wherein the buffer pair can be a buffer such as citric acid-sodium citrate, Tris-HCl, Bis-Tris-HCl, etc. that can reach the target pH, and NaCl is used for gradient elution to obtain the target protein.

[0027] The present invention also provides the yeast-derived mucin, the encoding gene, and the use of the method in preparing moisturizing products.

[0028] Specifically, the products are cosmetics, eye care products, contact lens care products, oral care products, wound repair products, food preservation products, and pet daily chemical products.

[0029] The present invention provides a yeast-derived mucin with moisturizing effect and a preparation method thereof, including constructing a recombinant strain, a fermentation production method, and a separation and purification method, wherein the mucin has a moisturizing performance equivalent to that of hyaluronic acid. Due to the use of a recombinant strain for production, it is relatively convenient to carry out process amplification and realize large-scale industrial production, so as to solve the current problems of difficult large-scale production of natural-source mucin, large batch differences, high risk of pathogen contamination, and non-compliance with animal welfare principles, and realize the wide-range application of mucin with moisturizing function. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 , Methanol-induced expression detection of mucin expression strains. From left to right, lanes 1 and 2 represent different GS115 transformants and α-MF signal peptide of Ms1-2; lanes 3 and 4 represent different GS115 transformants and self-signal peptide of MS2-1; lanes 5 and 6 represent different GS115 transformants and self-signal peptide of MS2-2.

[0031] Figure 2, detection of protein secretion expression of mucin strains. Among them: M: marker; M left: fermentation supernatant of MS2-1 strain induced at different time; M right: fermentation supernatant of MS2-2 strain induced at different time; 6, 11, 17, 33, 38 represent the duration of methanol induction respectively.

[0032] Figure 3 , Methanol-induced expression detection of Muc mucin KM71H expression strain. Note: From left to right, lanes 1 and 2 represent different KM71H transformants of MS2-1 and their own signal peptides; lanes 3 and 4 represent different KM71H transformants of MS2-2 and their own signal peptides.

[0033] Figure 4 , mucin and most of the miscellaneous proteins precipitate less in the relevant pH environment. Among them, only some pH results are shown, lanes 1-2 are the supernatant and precipitate at pH 2.5, lanes 3-4 are the supernatant and precipitate at pH 4.5, and lane 5 is the mucin fermentation broth.

[0034] Figure 5 , mucin cold ethanol precipitation for 2 hours and then protein electrophoresis detection. Among them, 1, 2: 8% ethanol supernatant, precipitation; 3, 4: 16% ethanol supernatant, precipitation; 5: mucin fermentation broth; 6, 7: 20% ethanol supernatant, precipitation; 8, 9: 40% ethanol supernatant, precipitation.

[0035] Figure 6 , mucin cold ethanol precipitation for 1 hour and then protein electrophoresis detection. Among them, 1, 2: 25% ethanol supernatant, precipitation; 3, 4: 30% ethanol supernatant, precipitation; 5, 6: 33% ethanol supernatant, precipitation; 7, 8: 35% ethanol supernatant, precipitation; 9, 10: 40% ethanol supernatant, precipitation.

[0036] Figure 7 , electrophoresis of anion exchange purified mucin (pH 6.0 bis-Tris-HCl). Among them, lane 1 is the flow-through; lanes 2-3 are purified component 1; lanes 4-5 are purified component 2; lanes 6-9 are purified component 3;

[0037] Figure 8 , electrophoresis of anion exchange purified mucin (citrate-NaOH, pH 5.0). Lane 1 is the fermentation supernatant; lane 2 is the flow-through; lanes 3-5 are purified fraction 1; lanes 6-7 are purified fraction 2; lanes 8-9 are purified fraction 3

[0038] Fig. 9 , mixed anion captoMMA chromatography purification electrophoresis diagram. In the figure, 5.0, 5.5, 6.0, 6.5, 7.0: represent the elution products of different salt ion concentrations at each pH.

[0039] Fig.10 , electrophoresis of anion exchange purified mucin (pH 6.0 20mM bis-Tris-HCl). Among them, lanes 1-2 are 17% B elution fractions; lanes 3-4 are 27% B elution fractions; lanes 5-6 are 100% B elution fractions; lane 7 is flow-through

[0040] Fig.11 , weak anion exchange was used for mucin purification at pH 5.0. In the figure, FT represents the flow-through sample, the numbers represent the ratio of different B phase buffers, and some % are omitted.

[0041] Fig.12 , test the water loss rate of the sample solution.

[0042] Fig.13 , test the moisture absorption of the sample powder (moisture absorption rate change curve within 24 hours). DETAILED DESCRIPTION

[0043] The present invention is described below through specific implementations in order to provide a better understanding of the present invention, but does not constitute a limitation of the present invention.

[0044] Example 1: Identification and analysis of yeast-derived mucin genes

[0045] We identified a Pichia pastoris-derived mucin (XP_002491941.1) from the publicly available Pichia pastoris GS115 genome data. The gene is located at NC_012964.1 (1916362..1918881) on chromosome 2 of Pichia pastoris. It has a typical PTS domain (amino acids 195-332, 503-596), which conforms to the characteristics of generalized mucins. BLAST analysis revealed that it belongs to the FLO11 family and is a GPI-anchored cell surface glycoprotein. The homologous sequence in Saccharomyces cerevisiae has also been reported as a membrane mucin of the MUC1 family.

[0046] To further analyze this mucin sequence, we used signalP 6.0 to predict the signal peptide, and its amino acids 1-22 were identified as signal peptide sequences, and the signal peptide cleavage site was located between amino acids 22 and 23; NetOGlyc-4.0 was used to analyze the O-glycosylation of the sequence, and it was predicted to have up to 206 potential O-glycosylation sites, which were basically located at serine and threonine residues from 175 to 820; it was also found that the gene contained two longer repeat sequences, located at 25-305 and 333-610.

[0047] Example 2: Construction of recombinant strains of yeast-derived mucin and expression in shake flasks

[0048] We tried to obtain the target gene by PCR, and used the primer pairs muc-f / r (atggtttcactgcgatcgatattcacctc ttctatctta\taggaacaatgcattgaagagaagtgcaactgctccg) and muc-afactor-f / r (agctcaggaaagacttgccctactt ctgag\taggaacaatgcattgaagagaagtgcaactgctc) to try to obtain mucins containing and not containing the original signal peptide region (amino acids 1-22). The amplified fragments obtained using the primer pair muc-f / r were cloned into the AOX1 promoter of the pPIC9k vector to obtain an expression vector with the original signal peptide sequence. The fragments obtained using the primer pair muc-afactor-f / r were cloned into the α-MF signal peptide sequence of the pPIC9k vector to obtain an expression vector in which the promucin signal peptide was replaced by the α-secretion factor signal peptide, which is one of the most commonly used secretion signals in Pichia pastoris.

[0049] Although we expected to obtain the full-length target gene, due to the presence of repeating units in the gene, the sequencing results showed that a large part of the amplified fragments had fragment deletions and frameshift mutations. We finally obtained three truncated target genes without frameshift mutations. Two of them used the mucin self-signal peptides, named MS2-1 and MS2-2, respectively, and one was replaced with the sequence of α-MF signal peptide, named MS1-2. The three expression vectors were linearized with SalⅠ restriction endonuclease and electroporated into Pichia pastoris GS115 strain to obtain three mucin expression strains. Since the expression of the target gene may vary among transformants, multiple transformants were selected for further verification of the expression strain of each protein.

[0050] The protein expression of the three strains was verified at the shake flask level. First, the strains were activated overnight in YPD test tubes at 30°C and 220rpm, and then transferred to BMGY shake flasks at a 4% inoculation rate. The cells were cultured for 24 hours, collected by centrifugation, and resuspended in BMMY medium. 1% methanol was added every 24 hours. The fermentation was terminated after methanol induction for 3 days. The supernatant of the fermentation broth was separated by centrifugation, and the protein yield was detected by SDS-PAGE gel electrophoresis ( Figure 1 , only some transformant results are shown).

[0051] It can be found that the strain using the mucin signal peptide has a distinct band detected in the fermentation supernatant, with a molecular weight of about 100 kDa, which is much larger than the relative molecular weight calculated based on the amino acid sequence. This is due to the significant increase in molecular weight caused by a large amount of glycosylation. However, surprisingly, both the MUC1 family mucin and the FLO11 family GPI-anchored cell surface glycoprotein are considered to be fixed on the cell membrane surface, and generally such a large amount of secretory expression is not detected in the fermentation supernatant. It seems that although the complete sequence of mucin recombinant expression was not obtained, the accidentally obtained truncated sequence seems to have changed the cellular localization of mucin, allowing it to be successfully secreted into the culture medium.

[0052] Example 3: Fed-batch fermentation culture of recombinant expression strain

[0053] Since the expression level of MS2-2 strain was poor in the shake flask stage, we also performed fed-batch fermentation tests.

[0054] The strain verified by the shake flask was reactivated on the YPD plate and transferred to the YPD-G418 (2mg / ml) plate. The colonies of MS2-1 and MS2-2 strains were picked and activated to YPD liquid, cultured at 30°C and 220rpm for 24 hours, transferred to 1% BMGY liquid medium, cultured at 30°C and 220rpm for 24 hours, and inoculated into the fermenter at 10%. The fermenter used BSM basal salt medium, and 4.4ml PTM1 trace element mother solution was added per liter. The fermenter was controlled at 30°C and pH 5.5. The speed was linked to control the dissolved oxygen>30%. The culture was cultured until 18h glycerol was exhausted. At this time, OD600 was about 100. Glycerol was fed to control the dissolved oxygen to about 30%. Cultured to OD300, the temperature was lowered to 25°C, alkali was added to adjust the pH to 6.0, and methanol was induced to control the dissolved oxygen to about 25%. The culture was continued until the yield no longer increased. SDS-PAGE gel electrophoresis was used to detect the protein yield of different induction times ( Figure 2 ).

[0055] As can be seen from the figure, with the increase of methanol induction time, the protein yield increased significantly, and the yield of the fermenter after 33 hours of induction was much greater than the yield of the shake flask after 3 days of induction. Finally, the fermenter was induced for 94 hours and the yield was about 2.8g / L.

[0056] Example 4: Testing of other expression strains

[0057] In order to obtain a higher expression yield, we transformed the previously obtained MS2-1 and MS2-1 expression vectors into the KM71H strain for expression level testing (the results are shown in Figure 3 As shown), a higher expression yield was obtained in the shake flask expression stage, and some clones were significantly higher than the expression strain constructed by GS115 strain.

[0058] Although a higher expression yield was obtained in the shake flask, during the fed-batch fermentation process, KM71H failed to obtain a higher fed-batch culture protein yield than GS115 due to its slow methanol utilization.

[0059] Example 5: Isolation and purification of yeast-derived mucin

[0060] Since the properties of MS2-2 and MS2-1 are similar, the purification methods of the two are basically the same. Here, only the mucin separation and purification scheme of MS2-2 is explained.

[0061] The isoelectric precipitation method was used to separate and purify mucin and impurity proteins by taking advantage of their different isoelectric points. The pH of the fermentation broth was adjusted to 4.5, 4.0, 3.5, 3.0, and 2.5 using dilute hydrochloric acid, and the broth was allowed to stand at low temperature for 1 hour. The precipitate was separated by centrifugation, and the precipitate components were analyzed by SDS-PAGE gel electrophoresis. The results showed that mucin and most impurity proteins did not precipitate in the above pH environment and could not be effectively separated ( Figure 4 ).

[0062] The mucin fermentation supernatant was roughly separated by cold ethanol precipitation. Cold ethanol and pre-cooled mucin fermentation supernatant were fully mixed in an ice water bath to make the final ethanol concentration 8%, 16%, 20%, and 40%. The mixture was allowed to stand at low temperature for 1 hour, and the precipitate was fully centrifuged. The protein components in the supernatant and precipitate were analyzed by SDS-PAGE gel electrophoresis. The results showed that mucin and miscellaneous proteins were not precipitated in 8-20% ethanol, and mucin was completely precipitated in 40% ethanol, and miscellaneous proteins were partially precipitated ( Figure 5 ).

[0063] The amount of ethanol added was optimized. Cold ethanol with a final concentration of 25%, 30%, 35%, and 40% was mixed with the mucin fermentation supernatant, and the mixture was allowed to stand at low temperature for 1 hour. The mixture was fully centrifuged to separate the precipitate, and the supernatant and precipitate were analyzed by electrophoresis. The results showed that mucin was not precipitated in 25%, 30%, and 35% ethanol, but some of the impurities were precipitated; in 40% ethanol, all of the mucin was precipitated, and some of the impurities were precipitated; 35% ethanol could be used to remove some impurities, and then the ethanol concentration could be increased to 40% to obtain a crude mucin extract ( Figure 6 ).

[0064] We attempted to purify mucin using chromatography, but neither the transition metal ion affinity chromatography for the His-tag at the C-terminus of mucin nor the affinity chromatography for the modified polysaccharide successfully captured the target protein. We attempted to purify using anion exchange.

[0065] First, pH 7.5 20mM Tris-HCl was used for purification. The protein bound to the Q column well, but the separation degree between the target protein and the impurity protein was not high. After optimizing the pH conditions, pH 6.0 Bis-Tris-HCl and pH 5.0 citric acid-NaOH were used for purification, but the purification results were still not ideal. The purity of the purified mucin was low ( Figure 7 and Figure 8 ).

[0066] Purification was performed using mixed anion chromatography capto MMA, and the pH conditions and salt concentrations were explored. The pH was 5.0, 5.5, 6.0, 6.5, and 7.0, and the salt concentration was 0, 50, 100, 150, and 200 mM. The treated sample was incubated with the MMA filler under the above conditions, and the supernatant was then analyzed. The results are as follows: Fig. 9 As shown, MMA had a low binding capacity and was not suitable for mucin purification.

[0067] First, pH 6.0 20mM bis-Tris-HCl was used for purification. The protein bound well to the DEAE filler. By optimizing the elution gradient, mucin with a purity of about 80% was finally obtained. Fig.10 ).

[0068] The pH conditions were optimized and pH 5.0 20mM bis-Tris-HCl was used for purification. Although the purity of the purified mucin was high, the protein was poorly bound to the DEAE filler during loading, resulting in a large amount of protein loss ( Fig.11 ).

[0069] Different purification methods or a combination of the above methods can be adopted for different demand scenarios. For example, in daily chemical application scenarios, ethanol precipitation can be used to obtain mucin with relatively low purity. For scenarios such as biomedicine, ethanol precipitation can be used and then chromatography can be used for further fine purification.

[0070] Example 6: Mucin Moisturizing Performance Test

[0071] Since MS2-2 and MS2-1 are similar in properties and have basically the same moisturizing properties, we only use MS2-2 as an example to illustrate the test results of mucin moisturizing properties. Since MS2-2 is only a truncated fragment of the original mucin sequence, and the original mucin is composed of two main repeating sequences, we can also believe that the original protein has stronger or equivalent moisturizing properties.

[0072] The moisturizing performance test used hyaluronic acid (HA-LMT) as a control, and tested the water loss rate and hygroscopicity under certain conditions to indirectly evaluate the moisturizing performance. First, the water loss of mucin and hyaluronic acid solutions with concentrations of 0.05%, 0.25%, 0.1%, and 0.5% were tested at a temperature of 20°C and a humidity of 47%, and the water loss rates were tested for 2 hours and 4 hours respectively (the results are shown in Fig.12 ).

[0073] The results in the figure show that when the concentration is 0.5%, the water retention effect of mucin within 8 hours is better than HA, and both are better than glycerol; when the concentration is 0.1%, the results of 2h and 4h both show that the water retention effect of mucin is close to that of HA; when the concentration is 0.25%, the results of 2h and 4h both show that the water retention effect of mucin is worse than that of HA. Overall, mucin has a water loss rate close to that of hyaluronic acid, reflecting similar moisturizing properties.

[0074] The moisture absorption of the sample powder was tested at a temperature of 20°C and a humidity of 84%, and a moisture absorption rate curve was drawn within 24 hours, as shown in Fig.13 shown.

[0075] It can be found that the hygroscopic capacity of mucin and hyaluronic acid is far weaker than glycerol, and the hygroscopicity of hyaluronic acid is slightly stronger than that of mucin. The poor hygroscopicity has two effects. On the one hand, it may indicate that the moisturizing performance of mucin will be slightly weaker than that of hyaluronic acid. On the other hand, in applications in dry environments, mucin will not snatch moisture from the skin compared to hyaluronic acid, and thus play a better role as a moisturizing barrier.

Claims

1. A yeast-derived mucin, whose amino acid sequence is shown in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7, and SEQ ID NO: 10; optionally, it also includes a signal peptide and / or a purification tag sequence, more specifically, its signal peptide sequence is a sequence of a mucin self signal peptide or an α-MF signal peptide, and more preferably, its amino acid sequence is shown in SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, and SEQ ID NO:

11.

2. A gene encoding a yeast-derived mucin, which encodes the yeast-derived mucin according to claim 1.

3. The coding gene according to claim 2, characterized in that Its nucleotide sequences are shown in SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9 and SEQ ID NO:

12.

4. A recombinant expression vector or recombinant host cell containing the coding gene as claimed in claim 2 or 3.

5. A method for producing yeast-derived mucin, characterized in that: The yeast cells into which the recombinant expression vector containing the coding gene according to claim 2 or 3 is introduced are cultured to produce the yeast-derived mucin.

6. The method according to claim 5, characterized in that The yeast cell is Pichia pastoris, specifically GS115 or KM71H strain.

7. The method according to claim 6, characterized in that The fermentation was carried out by shake flask fermentation or fed-batch fermentation.

8. The method according to any one of claims 5 to 7, characterized in that The method also includes the separation and purification steps of yeast-derived mucin, and the specific purification steps are as follows: 1) Use ethanol precipitation method to purify yeast fermentation broth, use 40% or more ethanol final concentration to directly precipitate the target protein; or first use 20%-35% ethanol final concentration, let it stand at 4°C for 1-2 hours to precipitate the impurities, and then use 40% ethanol final concentration, let it stand at 4°C for 1-2 hours to precipitate the target protein; 2) Further comprising: using chromatography to perform fine purification of the target protein, specifically, the selected chromatographic medium is an anion exchange chromatographic medium, including but not limited to strong anion exchange, weak anion exchange, and mixed mode ion exchange, and the selected buffer is a buffer of pH 5.0-7.5, wherein the buffer pair can be a buffer that can reach the target pH, such as citric acid-sodium citrate, Tris-HCl, Bis-Tris-HCl, etc., and NaCl is used for gradient elution to obtain the target protein.

9. The yeast-derived mucin according to claim 1, comprising the coding gene according to claim 2 or 3, and use of the method according to any one of claims 5 to 8 in preparing a moisturizing product.

10. The use according to claim 5, characterized in that The products are cosmetics, eye care products, contact lens care products, oral care products, wound repair products, food preservation products, and pet daily chemical products.

Images