Beauveria bassiana HCSF-Bb001 for controlling solenopsis invicta and application of Beauveria bassiana HCSF-Bb001

Abstract

The invention discloses Beauveria bassiana HCSF-Bb001 for preventing and treating solenopsis invicta, and relates to the technical field of microorganisms, and the preservation number of the Beauveria bassiana HCSF-Bb001 is GDMCCNO: 64626. The beauveria bassiana HCSF-Bb001 provided by the invention is high in growth speed and sporulation quantity, and is a strain with relatively strong pathogenicity to red imported fire ant worker ants, larvae and pupae, so that the pathogenicity to the larvae is the most prominent, the larvae are the pupae, and the larvae are the worker ants. The strain is a biocontrol strain with a good application prospect in sustainable prevention and control of solenopsis invicta, and can be widely used for biological prevention and control of solenopsis invicta.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and more particularly to a strain of Beauveria bassiana HCSF-Bb001 for preventing and controlling red imported fire ants and an application thereof. Background Art

[0002] The red fire ant Solenopsis invicta Buren belongs to the order Hymenoptera and the family Formicidae. It is a quarantine pest for agriculture, forestry and imported plants, and is also recognized as one of the 100 most dangerous invasive species in the world. It is not only destructive to the environment and facilities such as farmland, parks and roads, but also bites animals and humans, and in severe cases can cause death.

[0003] At present, the main means of preventing and controlling red fire ants is chemical control, but the use of chemical drugs to kill red fire ants has caused problems such as drug resistance, environmental pollution, and destruction of the ecosystem, which are becoming increasingly serious. Pest biological control is a sustainable prevention and control measure that uses natural enemies and specialized pathogens of pests to control pest populations. Among them, the use of environmentally friendly insect pathogenic fungi to prevent and control red fire ants has become a research and development trend, and is an important means of sustainable control of red fire ants, because insect pathogenic fungi have strong selectivity, pests are not easy to develop resistance, do not pollute the environment, and are harmless to humans and animals.

[0004] Therefore, providing more biological control products and / or methods for red imported fire ants is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a Beauveria bassiana HCSF-Bb001 for controlling red fire ants and an application thereof, wherein the conidia thereof have strong pathogenicity to worker ants, larvae and pupae of red fire ants, are environmentally friendly and pollution-free, and are not prone to drug resistance. The present invention is a biocontrol strain with good application prospects in the sustainable prevention and control of red fire ants, and can be widely used in the biological control of red fire ants.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A Beauveria bassiana HCSF-Bb001 strain for controlling red fire ants has a deposit number of GDMCC NO: 64626.

[0008] Another object of the present invention is to provide a microbial agent, comprising the above-mentioned Beauveria bassiana HCSF-Bb001.

[0009] Another object of the present invention is to provide the use of the above-mentioned Beauveria bassiana HCSF-Bb001 or the above-mentioned microbial agent in the preparation of red fire ant control products or in the control of red fire ants.

[0010] Another object of the present invention is a method for preventing and controlling red fire ants, which comprises spraying red fire ants or watering ant nests with the bacterial suspension of the above-mentioned Beauveria bassiana HCSF-Bb001 or the above-mentioned microbial agent.

[0011] As a preferred solution, the application concentration of Beauveria bassiana HCSF-Bb001 is 1×10 7 ~1×10 8 Spores / mL.

[0012] Beneficial effects: The present invention provides a strain of Beauveria bassiana HCSF-Bb001, which has a fast growth rate and high spore production. It has strong pathogenicity to worker ants, larvae and pupae of red fire ants, with the most prominent pathogenicity to larvae, followed by pupae and then worker ants. The strain is a biocontrol strain with good application prospects in the sustainable prevention and control of red fire ants and can be widely used in the biological control of red fire ants. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0014] Figure 1 The figure is a colony diagram of Beauveria bassiana HCSF-Bb001 of the present invention.

[0015] Figure 2 This is a conidia diagram of Beauveria bassiana HCSF-Bb001 of the present invention.

[0016] Figure 3 These are the symptoms of the red imported fire ants worker ants infected by Beauveria bassiana HCSF-Bb001.

[0017] Figure 4 These are the symptoms of the red fire ant pupae infected by Beauveria bassiana HCSF-Bb001.

[0018] Figure 5 These are the symptoms of the red imported fire ant larvae infected by Beauveria bassiana HCSF-Bb001.

[0019] Figure 6 The results are the toxicity test results of Beauveria bassiana HCSF-Bb001 of the present invention on red imported fire ants.

[0020] Figure 7 The results are the toxicity test results of Beauveria bassiana HCSF-Bb001 of the present invention on red imported fire ant larvae.

[0021] Figure 8 The results are the toxicity test results of Beauveria bassiana HCSF-Bb001 of the present invention on red imported fire ant pupae. DETAILED DESCRIPTION

[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0024] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0025] Example 1 Isolation, identification and preservation of strain HCSF-Bb001

[0026] 1. Isolation of strains

[0027] The strain HCSF-Bb001 was isolated and purified from sugarcane turtles collected from sugarcane fields in Guohua Town, Pingguo City, Baise City, Guangxi Zhuang Autonomous Region.

[0028] 2. Identification of strains

[0029] The obtained strain was cultured on PDA medium at 26±1℃. The colonies were white in the early stage and had a fluffy surface. The colonies began to produce spores after 3 days of culture on PDA medium. The colony diameter was about 75mm on the 15th day. The colonies were flat and powdery, with a white surface and a light yellow back (see Appendix Figure 1 ). The hyphae are colorless, smooth, septate, and 2.0-3.2 μm wide; conidiophores are produced from vegetative hyphae, solitary or branched, short cylindrical or long bottle-shaped, with multiple spore-forming cells at the top or side; the spore-forming cells are cylindrical or bottle-shaped; conidia are colorless, single spores, spherical or nearly spherical, with a smooth surface and a diameter of 2.0-3.0 μm, and are attached to the "Z"-shaped structure formed by the extension of the spore-forming cells (see Appendix Figure 2 ) and was identified as Beauveria bassiana.

[0030] PCR was used to amplify the rDNA-ITS sequence fragment of the HCSF-Bb001 strain, and the fragment was subjected to nucleotide sequence detection. The sequence was compared by Blast in the NCBI database. The results showed that the HCSF-Bb001 strain was 100% consistent with Beauveria bassiana, and its taxonomic status was Deuteromycota, Hyphomycetes, Moniliales, Moniliaceae, and Beauveria.

[0031] The ITS sequence of strain HCSF-Bb001 is as follows:

[0032] TTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCC

[0033] AGCCCGGACGCGGACTGGACCAGGCGCCCGCCGGGGACCTCA

[0034] AACTCTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAA

[0035] ACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGG

[0036] CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT

[0037] TGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCG

[0038] CCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTC

[0039] AACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGC

[0040] AGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCG

[0041] GCGACCTCTGCGTAGTAATACAGCTCGCACCGGAACCCCGACG

[0042] CGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGA

[0043] ATCAGGTAGGACTACCCGCTGAACTTAAGCATATC, such as SEQ ID NO: 1.

[0044] 3. Preservation of strains

[0045] Beauveria bassiana HCSF-Bb001 is deposited in Guangdong Microbial Culture Collection Center with the deposit number GDMCC NO: 64626, the classification name Beauveria bassiana, the deposit date May 16, 2024, and the deposit address is Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0046] Example 2 Biological characteristics of Beauveria bassiana HCSF-Bb001

[0047] Determination of colony growth rate and spore production: Beauveria bassiana HCSF-Bb001 was inoculated in the center of the PDA plate medium by the drop method, and placed in a constant temperature incubator with a temperature of (26±1)℃, a photoperiod of L:D=12h:12h, and a relative humidity of 80%. The colony diameter was measured every day by the cross method. Five replicates were set for each treatment, and a total of 10 days were observed. At the same time, the time of starting spore production was recorded. From the beginning of spore production, the spores were washed off with a sterile 0.05% Tween-80 aqueous solution every day, and diluted to an appropriate multiple. The spore concentration was then determined by a hemocytometer and converted into the spore production per unit area. The experiment was repeated 3 times.

[0048] The growth rate and conidia production of Beauveria bassiana HCSF-Bb001 on PDA medium are shown in Tables 1 and 2, respectively.

[0049] Table 1 Growth rate of Beauveria bassiana HCSF-Bb001 on PDA medium

[0050]

[0051] Table 2 Conidia production of Beauveria bassiana HCSF-Bb001 on PDA medium

[0052]

[0053]

[0054] Note: The data in the table are mean ± standard deviation; different lowercase letters in the table indicate significant differences (P < 0.05).

[0055] As shown in Table 1, Beauveria bassiana HCSF-Bb001 grew well and quickly on PDA medium at 26±1℃. Its colony growth rate was slow during 1-2 days of culture; on the 3rd day, its colony growth rate was fast, which was 0.71cm / d; and the average colony growth rate from the 4th to the 10th day was 0.46-0.52cm / d.

[0056] As shown in Table 2, Beauveria bassiana HCSF-Bb001 began to produce spores on the second day after being cultured on PDA medium, with a spore production of 0.20×10 8 Spores / cm 2 ; Then the spore production gradually increased and reached the maximum on the 7th day, which was 2.90×10 8 Spores / cm 2 .

[0057] The above results show that the strain HCSF-Bb001 of the present invention has good biological characteristics, fast growth rate and high spore production.

[0058] Example 3 Determination of the toxicity of Beauveria bassiana HCSF-Bb001 to red imported fire ants

[0059] Source of test insects: The nests of red fire ants were collected from the scientific research and experimental base of Guangxi Zhuang Autonomous Region Academy of Agricultural Sciences in Xixiangtang District, Nanning City, Guangxi Zhuang Autonomous Region. The nests were dug out with a shovel, put into a large storage box and transported back to the laboratory. After standing for 2 days for the ant colonies to rebuild their nests, the red fire ant colonies were separated by the dripping method and transferred to a plastic box with a Teflon-coated inner wall (40 cm long, 30 cm wide, and 20 cm high). Water test tubes, 10% sucrose water test tubes and mealworms were placed in the breeding box. After being raised in the laboratory for 1 to 2 weeks, healthy worker ants, larvae and pupae of basically the same size were picked for biological testing.

[0060] Experimental treatment: Conidia of Beauveria bassiana HCSF-Bb001 were scraped from PDA plates and prepared into 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 and 1×10 8spores / mL spore suspension for later use. Put the worker ants, larvae and pupae of the red fire ant into the prepared spore suspension, soak for 5 seconds and take them out, put them on sterile filter paper to absorb the excess water on the insect body surface, put the worker ants, larvae and pupae into plastic bowls padded with moist filter paper, and put 30 test insects into each bowl. A layer of Teflon was coated around the bowl mouth to prevent the red fire ants from escaping. A cotton ball containing sterile water and 10% sucrose water was placed in the bowl. A sterile 0.05% Tween-80 aqueous solution was used as a control. For each treatment of 30 test insects, the experiment was repeated in 3 ant nests, and each ant nest was repeated 3 times. For the larvae and pupae after the immersion treatment, 30 untreated red fire ant workers from the same nest were added to the plastic bowl as brooding ants. The experimental temperature was 26-28℃, and the relative humidity was 70%±10%. After treatment, the number of dead test insects was observed and recorded every day, and they were picked up and placed in a culture dish covered with moist filter paper for moisturizing culture to confirm whether they were infected with the test strain and died. The mortality rate and dead insect rate were counted. The data were sorted in Excel and processed and analyzed using SPSS17.0 software.

[0061] The symptoms of worker ants, larvae and pupae of red imported fire ants infected with Beauveria bassiana HCSF-Bb001 are shown in the attached figure. Figure 3 , Attachment Figure 4 and attached Figure 5 shown.

[0062] The results of toxicity test showed that Beauveria bassiana HCSF-Bb001 had high toxicity to workers, larvae and pupae of red fire ants. With the increase of spore concentration and the passage of treatment time, the mortality rate of workers, larvae and pupae of red fire ants gradually increased (see Appendix Figure 6 , Figure 7 and Figure 8 ). On the 10th day after treatment, different concentrations of spore suspension (1×10 4 ~1×10 8 The mortality rates of workers, larvae and pupae of red fire ants treated with spore suspension (1×10 7 , 1×10 8 The pathogenicity of the spores to red fire ants was strong. The cumulative mortality of red fire ant workers, larvae and pupae reached 95.93% to 100% on the 10th day after treatment.

[0063] The Probit model was used to obtain the regression equation of the pathogenicity of Beauveria bassiana HCSF-Bb001 to red imported fire ants on the 10th day: y = -3.83 + 0.80x (χ 2 =2.73, P=0.44), LC 50 6.05×10 4 spores / mL, 95% confidence interval is 4.02×104 ~8.72×10 4 Spores / mL; The pathogenicity regression equation of red fire ant larvae is y=-2.19+0.53x(χ 2 =24.12, P=0.00), LC 50 1.26×10 4 spores / mL, 95% confidence interval was 72.27~7.43×10 4 Spores / mL; The pathogenicity regression equation of red fire ant pupae is y=-2.59+0.62x(χ 2 =7.05, P=0.07), LC 50 1.44×10 4 Spores / mL, 95% confidence interval is 3.41×10 3 ~3.61×10 4 The results showed that Beauveria bassiana HCSF-Bb001 had strong pathogenicity to workers, larvae and pupae of red imported fire ants.

[0064] The results of the above examples 2 and 3 show that Beauveria bassiana HCSF-Bb001, CGMCC No. 40929 is a strain isolated from naturally infected scarab beetles that has strong pathogenicity to red fire ant workers, larvae and pupae, and has the strongest pathogenicity to red fire ant larvae, followed by red fire ant pupae, and then red fire ant workers. The strain is suitable for growth on PDA medium at a temperature of 26±1°C, has a fast growth rate, a fast spore production rate and a large spore production amount, and has a good insecticidal effect. It is a biocontrol strain with good application prospects in the sustainable prevention and control of red fire ants and can be widely used in the biological control of red fire ants.

[0065] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0066] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of Beauveria bassiana HCSF-Bb001 for controlling red fire ants, It is characterized in that The deposit number is GDMCC NO:64626.

2. A microbial agent, It is characterized in that It comprises the Beauveria bassiana HCSF-Bb001 described in claim 1.

3. Use of the Beauveria bassiana HCSF-Bb001 according to claim 1 or the microbial agent according to claim 2 in preparing a product for controlling red imported fire ants or controlling red imported fire ants.

4. A method for preventing and controlling red fire ants, It is characterized in that The bacterial suspension of Beauveria bassiana HCSF-Bb001 according to claim 1 or the microbial agent according to claim 2 is used to spray red imported fire ants or water ant nests.

5. The method for controlling red imported fire ants according to claim 4, It is characterized in that The application concentration of Beauveria bassiana HCSF-Bb001 was 1×10 7 ~1×10 8 Spores / mL.

Images