Irpex lacteus GJ243 and application thereof

Abstract

The invention provides an irpex lacteus GJ243 strain and application thereof, the preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) NO: 41281, and the preservation date is April 7, 2024. The strain has a degradation effect on cellulose, lignin and hemicellulose. Compared with the prior art, the Irpex lacteus GJ243 disclosed by the invention has the advantages that ligninase and cellulase generated by the Irpex lacteus GJ243 are relatively high in activity, and the Irpex lacteus GJ243 is high in degradation capacity on lignin, cellulose and hemicellulose. Meanwhile, 15% of Irpex lacteus GJ243 is added, so that degradation of lignocellulose of the rape straw is facilitated, the content of humus in soil is increased, and the method has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of environmental microbial engineering technology, and more specifically, particularly relates to a strain of Irpex lacteus GJ243 for efficiently degrading lignocellulose and its application. Background Art

[0002] Agricultural organic solid waste is one of the most abundant renewable resources in the world, with an annual output of up to 140 billion tons, rich in lignocellulose. Crop straw occupies a major position in the field of organic solid waste. Promoting the comprehensive utilization of crop straw is a concrete measure to improve the quality of cultivated land, improve the ecological environment of agriculture and rural areas, and accelerate the green and low-carbon development of agriculture. However, the lignocellulose in crop straw is difficult to degrade, which has become a major obstacle to the utilization of agricultural organic solid waste resources.

[0003] The existing methods for treating agricultural organic solid waste include physical, chemical, physical-chemical and biological methods, but physical and chemical methods are limited by high energy consumption, high cost and possible environmental pollution. In contrast, biological methods stand out due to their economy and environmental protection. Using efficient degradable microorganisms to degrade lignocellulose not only has the advantages of universality, low cost and low pollution, but also promotes the continuous decomposition of straw, releases mineral nutrients, and promotes the growth and yield of crops.

[0004] The structure of lignin is mainly composed of three monomers: syringyl (S), p-hydroxyphenyl (H) and guaiacyl (g), which are connected by CC, COC and other bonds to form a water-soluble, irregularly arranged and complex polymer compound. Lignin is tightly bound to hemicellulose through covalent bonds, ester bonds and hydrogen bonds, thereby hindering the contact between cellulose and cellulase and reducing the efficiency of enzymatic hydrolysis. Cellulose is composed of microfibrils arranged in bundles, each of which is composed of hundreds or thousands of D-pyranose rings connected to each other by β-1,4-glycosidic bonds. It has a very complex structure and is difficult to degrade. Among them, lignin degrading enzymes (such as laccase, lignin peroxidase, etc.) and cellulases (including exo- and endo-β-glucanases, etc.) play a key role in the degradation process. However, there are currently few efficient enzyme-producing strains suitable for agricultural waste, and functional strains have problems such as poor enzyme activity, single enzyme production, harsh growth conditions, and poor colonization ability. According to research, some fungi can produce lignin-degrading enzymes and cellulose-degrading enzymes at the same time, and their degradation ability is better than that of actinomycetes and bacteria. Therefore, there is an urgent need to screen more fungal lignocellulose-degrading microorganisms with high enzyme activity, stability and a wider range of action from the natural environment to promote the resource utilization of agricultural organic solid waste. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a strain of White Capsule Rhacophyton GJ243 and its application, which is a functional strain for degrading cellulose isolated from corrupt straw, and the enzyme production ability of the strain is evaluated, and the liquid bacterial agent is prepared and applied to the degradation process of rape straw-derived cellulose, which has good degradation effect, effectively solves the above-mentioned technical problems, and has good promotion value.

[0006] The purpose and efficacy of the white capsule rake tooth fungus GJ243 and its application of the present invention are achieved by the following specific technical means:

[0007] A strain of White Capsule Rake Tooth Fungus GJ243, the strain preservation number is: CGMCC NO:41281, and the preservation date is: April 7, 2024.

[0008] The invention discloses an application of a GJ243 strain of the white capsule rake tooth fungus, which has the effect of degrading cellulose, lignin and hemicellulose.

[0009] A method for preparing a liquid bacterial agent of the white capsule rake tooth fungus GJ243 is provided. The method comprises the following steps: inoculating the white capsule rake tooth fungus GJ243 strain into a PDA liquid culture medium, and culturing the culture medium in a constant temperature oscillator at 30°C and 180 rpm / min for 5 days to obtain the liquid bacterial agent.

[0010] The present invention has at least the following beneficial effects:

[0011] Compared with the prior art, the invention has the advantages that the ligninase and cellulase produced by the white capsule rake tooth fungus (Irpex lacteus) GJ243 of the invention have high activity and strong ability to degrade lignin, cellulose and hemicellulose. At the same time, the invention adds 15% of white capsule rake tooth fungus (Irpex lacteus) GJ243 to help degrade rape straw lignocellulose and increase soil humus content, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 It is the Congo red decolorization result diagram and the guaiacol color development diagram of the present invention;

[0013] Figure 2 It is the morphological picture of the present invention;

[0014] Figure 3 It is a phylogenetic tree picture of the present invention;

[0015] Figure 4 It is the glucose standard curve diagram of the present invention;

[0016] Figure 5 is a growth curve diagram of the present invention;

[0017] Figure 6 It is a schematic diagram of the ligninase activity of the present invention;

[0018] Figure 7 It is a schematic diagram of cellulase activity of the present invention;

[0019] Figure 8 This is a schematic diagram of the change of lignin content in the present invention;

[0020] Fig. 9 It is a schematic diagram of the change of cellulose content of the present invention;

[0021] Fig.10 It is a schematic diagram of the change of hemicellulose content of the present invention;

[0022] Fig.11 This is the intention of the present invention to change the humus content. DETAILED DESCRIPTION

[0023] The following examples are used to further describe the embodiments of the present invention. The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0024] In the description of the present invention, unless otherwise specified, "multiple" means two or more; the terms "coaxial", "bottom", "one end", "top", "middle", "other end", "upper", "one side", "top", "inside", "front", "center", "two ends", etc. indicate the orientation or position relationship based on the orientation or position relationship shown in the drawings, which is only for the convenience of describing the present invention and simplifying the description, and does not indicate or imply that the device or element referred to must have a specific orientation, be constructed and operate in a specific orientation, and therefore cannot be understood as limiting the present invention. In addition, the terms "first", "second", "third", etc. are used for descriptive purposes only and cannot be understood as indicating or implying relative importance.

[0025] In the description of the present invention, it should be noted that, unless otherwise clearly stipulated and limited, terms such as "installation", "setting", "connection", "fixation" and "screw-on" should be understood in a broad sense. For example, it can be a fixed connection, a detachable connection, or an integrated connection; it can be a mechanical connection or an electrical connection; it can be a direct connection or an indirect connection through an intermediate medium, it can be the internal connection of two elements or the interaction relationship between two elements. Unless otherwise clearly defined, ordinary technicians in this field can understand the specific meanings of the above terms in the present invention according to the specific circumstances.

[0026] Example:

[0027] The present invention provides a strain of Irpex lacteus GJ243 and its application. The strain of Irpex lacteus GJ243 is obtained from rotten straw in the field of Gui'an New District, Guiyang City, Guizhou Province through primary screening and secondary screening. The strain can produce ligninase, cellulase and reduce

[0028] The strain grew rapidly, and could cover a 9-cm-diameter plate on PDA medium in 5 days. The colony was chrysanthemum-shaped, flat, uniform in thickness, white, with entire margins and white back. The vegetative hyphae were well developed and white and flocculent.

[0029] The main culture medium involved in the present invention comprises:

[0030] 1. Sodium carboxymethyl cellulose liquid culture medium: sodium carboxymethyl cellulose 10.0 g, potassium dihydrogen phosphate 2.0 g, ammonium sulfate 4.0 g, magnesium sulfate 0.244 g, peptone 1.0 g, ultrapure water 1.0 L, pH 7.0-7.5, sterilize at 121°C for 20 min.

[0031] 2. Sodium carboxymethyl cellulose solid culture medium: sodium carboxymethyl cellulose 10.0 g, potassium dihydrogen phosphate 2.0 g, ammonium sulfate 4.0 g, magnesium sulfate 0.244 g, peptone 1.0 g, agar 20.0 g, ultrapure water 1.0 L, pH 7.0-7.5, sterilize at 121°C for 20 min.

[0032] 3. Sodium carboxymethyl cellulose enzyme production medium: 20.0g sodium carboxymethyl cellulose, 2.0g ammonium sulfate, 0.3g magnesium sulfate, 0.3g sodium chloride, 3.0g peptone, 4.0g potassium dihydrogen phosphate, dissolved in 1L distilled water, pH = 7.0-7.5, sterilized at 121℃ for 20min.

[0033] 4.PDA liquid culture medium: 200.0g fresh potato extract, 20.0g glucose, 1.0L ultrapure water, natural pH, sterilized at 121℃ for 20min.

[0034] 5.PDA solid culture medium: 200.0g fresh potato extract, 20.0g glucose, 1.0L ultrapure water, 20.0g agar, natural pH, sterilized at 121℃ for 20min.

[0035] 6.PDA-guaiacol agar medium: 1000 mL of 200.0 g potato extract, 10.0 g / L glucose, 0.04% (w / v) guaiacol, 1.5 g / L MgSO4, 3.0 g / L KH2PO4, 0.05 g / L VB, 20.0 g / L agar, pH 7.0-7.2.

[0036] 1. Isolation and purification of Irpex lacteus GJ243 strain

[0037] 1. Acclimation: Collect rotten straw samples from Gui'an New District, Guiyang City, Guizhou Province. Weigh 10.0 g of the rotten straw samples and add them into a 250 mL Erlenmeyer flask containing 90 mL of sodium carboxymethyl cellulose liquid culture medium. Culture at 30 °C and 150 r / min for 48 h.

[0038] 2. Isolation and purification: The separation is carried out by the dilution and plate coating method. After the acclimation, the culture solution is diluted with sterile water to a concentration of 10-5 to 10-8, and 200 μL is taken and coated on the sodium carboxymethyl cellulose solid culture medium, and inverted in a 30°C constant temperature incubator for 4 days. Observe the colonies grown on the culture medium, and pick the larger single colonies according to the color, size, edge regularity, and surface decoration of the colonies. After multiple plate streaking culture on PDA solid culture medium, it is purified repeatedly for 4-6 generations until a single colony appears, and the target single strain is screened.

[0039] 2. Screening of Irpex lacteus GJ243 strain

[0040] The pure colonies obtained in step 1 were inoculated on PDA-Congo red agar medium, PDA-aniline blue agar medium and PDA-guaiacol agar medium, respectively, and cultured in a 30°C constant temperature incubator for 3 days. The diameter of the decolorization zone of the pure colonies on the Congo red medium and the diameter of the coloration zone on the guaiacol medium were measured and recorded respectively. The decolorization zone diameter and the coloration zone diameter were used to preliminarily judge the lignocellulose degradation ability of the strain. The results are shown in Table 1, Figure 1 As shown, the diameter of the Congo red hydrolysis zone of GJ243 is 4.2 cm, and the diameter of the guaiacol color development zone is 5.05 cm.

[0041] Table 1 Color reaction of GJ243 strain

[0042]

[0043] 3. Identification of Irpex lacteus GJ243 strain

[0044] (1) Morphological identification: A single colony of the strain GJ243 obtained above was inoculated onto a PDA agar medium, and then the PDA agar medium was inverted and placed in a 30°C constant temperature incubator for 3 days to observe the morphology of the colonies. The strain grew rapidly on the PDA agar medium. Figure 2 It can be seen that the colony is milky white and uniform, flat, with congruent circles, and the hyphae are obviously divergent in shape similar to chrysanthemums.

[0045] (2) Phylogenetic tree analysis of strains

[0046] The genomic DNA of strain GJ243 was extracted, and PCR gene amplification was performed using the fungal ITS universal primers ITS1 (TCCGTAGGTGAACCTGCC) and ITS4 (TCCTCCGCTTATTGATATGC). The PCR products were identified by 1% agarose gel electrophoresis, and the PCR products were directly sequenced using PCR primers. The measured sequences were aligned and homology analyzed using the Basic Local Alignment Search Tool (BLAST) at NCBI to determine the accuracy of the sequencing results. After confirming that the sequence was correct, the required reference strain sequences were downloaded, and a phylogenetic tree was constructed using the Maximum Likelihood method using MEGA 7.0 software, and 1000 Bootstrap tests were performed to complete the phylogenetic analysis. The results showed that GJ243 formed a clear branch with Irpex lacteus (attached Figure 3 ). ITS rDNA sequence alignment and results further verified GJ234 as Irpex lacteus at the molecular biological level.

[0047] 4. Determination of lignin-degrading enzyme activity produced by Irpex lacteus GJ243 strain

[0048] (1) Drawing of glucose standard curve

[0049] Accurately measure 0mL, 0.2mL, 0.4mL, 0.6mL, 0.8mL, 1.0mL, 1.2mL, 1.4mL, 1.6mL and 1.8mL of 1mg / mL glucose standard solution in 25mL colorimetric tubes, add ultrapure water to 2mL, mix the two thoroughly, add 3mL DNS reagent to each colorimetric tube, boil in boiling water for 5min, cool quickly and make up to 25mL with ultrapure water, measure the absorbance of the sample in a 540nm wavelength ultraviolet spectrophotometer, and draw a standard curve based on the recorded data with glucose content as the abscissa and absorbance as the ordinate. The results are shown in Figure 4 shown.

[0050] (2) Plotting of strain growth curve

[0051] The Irpex lacteus GJ243 obtained in step 1 was inoculated into 100 mL of PDA liquid culture medium after high temperature sterilization, and cultured in a constant temperature oscillator at 30°C and 150 r / min. The bacterial solution was taken every 12 hours and the absorbance was measured at 520 nm using an ultraviolet spectrophotometer. The growth curve of the strain was drawn with the culture time t as the horizontal axis and the turbidity OD520 of the culture solution as the vertical axis to observe its growth cycle and determine the logarithmic growth period of each bacteria. The results are as follows: Figure 5 shown.

[0052] (3) Preparation of crude enzyme solution

[0053] The strain was cultured in PDA liquid medium until the logarithmic growth phase, which was used as the seed liquid for the next bacterial enzyme production culture. The bacterial liquid was inoculated into 100 mL of enzyme production fermentation medium at a 5% (v / v) inoculation amount, and cultured continuously for one week at 30°C and 180r / min. 5 mL of the fermentation liquid was taken every 12 hours, and centrifuged at 4°C and 10000r / min for 10 minutes. The supernatant was the crude enzyme liquid.

[0054] (4) Enzyme activity assay

[0055] Laccase activity determination method: ABTS method was used. ABTS was used as the reaction substrate. First, 2 ml of 0.1 mol / L acetic acid-sodium acetate buffer (pH 4.5) was added, followed by 0.5 mL of 0.5 mmol / L ABTS solution, and then 200 uL of crude enzyme solution was added. The mixture was mixed and kept in a 30°C water bath for 3 minutes. After adjusting the absorbance value to zero with distilled water, the change in absorbance was measured at 420 nm. The amount of enzyme required to oxidize 1 umol ABTS per minute was one enzyme activity unit (U).

[0056] Manganese peroxidase activity determination method: MnSO4 method is used. MnSO4 is the reaction substrate. First, add 2.5mL50mmol / L succinic acid-sodium succinate buffer (pH 4.5), then add 0.4mL 1.6mmol / L MnSO4 solution, then add 1mL crude enzyme solution, then add 100uL10 mmol / L H2O2 solution to start the reaction, mix well, keep warm in a 37℃ water bath for 3min, and then measure the change in absorbance at 240nm. The amount of enzyme required to oxidize 1umol Mn2+ to Mn* per minute is one enzyme activity unit (U).

[0057] Method for determining the activity of lignin peroxidase: VA (resveratrol) method was used. Resveratrol was used as the reaction substrate. First, 2.5 mL of 250 mmol / L tartaric acid-sodium tartrate buffer (pH 3.0) was added, followed by 0.4 mL of 10 mmol / L resveratrol, followed by 1 mL of crude enzyme solution, followed by 100 uL of 10 mmol / L H2O2 solution to start the reaction, mixed well, and kept warm in a 30°C water bath for 3 minutes, and then the change in absorbance was measured at 310 nm. The amount of enzyme required to oxidize 1 umol of resveratrol per minute was one enzyme activity unit (U).

[0058]

[0059] Where:

[0060] ΔOD is the change in absorbance within time t

[0061] b is the thickness of the cuvette (cm)

[0062] Δt is the reaction time (min)

[0063] Vtotal is the volume of the reaction system (mL)

[0064] Venzyme is the volume of enzyme solution in the reaction (mL)

[0065] The results of ligninase activity changes are as follows Figure 6 As shown, after 2 days, the manganese peroxidase (Mnp) and lignin peroxidase (Lip) activities of the crude enzyme solution produced by GJ243 were the highest, which were 54.77 U / mL and 18.06 U / mL; after 5 days, the laccase (Lac) activity of the crude enzyme solution produced by it was the highest, which was 0.13 U / mL.

[0066] 5. Determination of cellulose-degrading enzyme activity produced by Irpex lacteus GJ243 strain

[0067] (1) Filter paper enzyme activity assay

[0068] Filter paper enzyme activity refers to the total activity of cellulase displayed by cellulase consumption of filter paper, which reflects the total effect of the synergistic action of cellulase components in the sample tested. The higher the filter paper enzyme activity, the higher the total cellulase activity.

[0069] Prepare crude enzyme solution according to step 4 (4), add 1×6cm filter paper strips, 1.5mL sodium citrate buffer solution and 0.5mL crude enzyme solution to colorimetric tubes respectively, and use enzyme solution inactivated by boiling for 10min as control. After 1h in a 50℃ water bath, add 3mL DNS reagent to each test tube, boil in a boiling water bath for 5min, take out, immediately cool to room temperature with running water, dilute to 20mL, and measure absorbance at a wavelength of 540nm on an ultraviolet spectrophotometer. Find the reducing sugar content on the glucose standard curve and convert the enzyme activity value by the formula.

[0070] (2) Determination of endo-β-glucanase activity

[0071] Prepare crude enzyme solution according to step 4 (4). After obtaining crude enzyme solution, add 1 mL of 1% sodium carboxymethyl cellulose to the colorimetric tubes. The subsequent experimental steps are the same as the above (1) filter paper enzyme activity determination. Calculation of cellulase activity: 1 mL of crude enzyme solution hydrolyzes the substrate to produce 1 μg of glucose within 1 min as one enzyme activity unit, expressed as U / mL. The enzyme activity calculation formula is as follows:

[0072] X=(A×N) / (V×T)

[0073] Where:

[0074] X——enzyme activity, U / mL

[0075] A——Glucose content obtained based on absorbance on glucose standard curve

[0076] N——Dilution multiple of enzyme solution

[0077] V——the amount of enzyme solution added, i.e. 0.5mL

[0078] T——enzymatic reaction time, i.e. 60min

[0079] The results of cellulase activity changes are as follows Figure 7 As shown, the filter paper enzyme activity (FPA) of GJ243 was the highest, reaching 17.60 U / mL on the 6th day, and the endo-β-glucanase activity (Cen) was the highest on the 6th day, reaching 29.67 U / mL.

[0080] VI. Preparation of liquid inoculum of Irpex lacteus GJ243

[0081] The strain was inoculated into a PDA liquid culture medium and cultured in a constant temperature oscillator at 30°C and 150 r / min until the growth logarithmic phase to obtain an Irpex lacteus GJ243 liquid inoculum.

[0082] VII. Degradation effect of Irpex lacteus GJ243 on cellulose from rapeseed straw

[0083] The liquid inoculum of Irpex lacteus GJ243 obtained in step six was applied to the degradation of cellulose from rape straw. The rape straw was harvested and naturally air-dried, then crushed to 1-2 cm, and 100 g of crushed rape straw sample was weighed into a fermentation bag. The rape straw was soaked in sterile water and evenly mixed with 5%, 10%, and 15% bacterial solution, and cultured at 30°C for 14 days. An equal amount of sterile water was used as a blank control group, and the straw on the 0th, 7th, and 14th days was taken as samples. After the culture was completed, the samples were sent to measure the changes in the content of lignin, cellulose, hemicellulose, and humus in the rape straw before and after degradation. At the end of degradation, the lignin degradation rates of rapeseed straw in the control group and the 5%, 10% and 15% bacterial solution treatment groups were 38.13%, 63.23%, 66.23% and 73.74%, respectively; the cellulose degradation rates were 15.49%, 33.50%, 40.41% and 44.34%, respectively; and the hemicellulose degradation rates were 34.45%, 43.23%, 54.90% and 74.67%, respectively.

[0084] like Figure 8 As shown in the figure, the lignin content of rapeseed straw in the control group and the 5%, 10%, and 15% bacterial solution treatment groups were 61.87%, 36.77%, 33.77%, and 26.26%, respectively; Fig. 9 As shown in the figure, the cellulose contents of rapeseed straw in the control group and the 5%, 10%, and 15% bacterial solution treatment groups were 84.51%, 66.50%, 59.59%, and 55.66%, respectively; Fig.10 As shown in the figure, the hemicellulose contents of rapeseed straw in the control group and the 5%, 10%, and 15% bacterial solution treatment groups were 65.54%, 56.77%, 45.10%, and 25.33%, respectively; Fig.11 As shown, the humus contents of rapeseed straw in the control group and the 5%, 10%, and 15% bacterial solution treatment groups were 381.04 g / kg, 433.05 g / kg, 449.40 g / kg, and 500.74 g / kg, respectively.

[0085] Obviously, the Irpex lacteus GJ243 obtained in this example can degrade the lignin and cellulose components in rape straw, and has the potential to be applied to straw biodegradation.

[0086] Seq No.1 sequence list:

[0087] ITS sequence of Leucospermum erythrorhizium GJ243

[0088] SEQUENCE LISTING

[0089] <110> Guizhou University

[0090] <120> The GJ243 is the source of the GJ243

[0091] <130> 2024

[0092] <160> 1

[0093] <170> PatentIn version 3.5

[0094] <210> 1

[0095] <211> 648

[0096] <212> DNA

[0097] <213> Irpex lacteus

[0098] <400> 1

[0099] cctgcggaag gatcattatc gagttttgaa cgggttgtag ctggcctttc acgaggcatg 60

[0100] tgcacgcctg gctcatccac tcttaacctc tgtgcacttt atgtaagaga aaaaaatggt 120

[0101] ggaagcttcc aggatctcgc gagaggtctt cggttgaaca agccgttttt cttcttatg 180

[0102] ttttactaca aacgcttcag ttatagaatg tcaactgtgt ataacacatt tatatacaac 240

[0103] tttcagcaac ggatctcttg gctctcgcat cgatgaagaa cgcagcgaaa tgcgataagt 300

[0104] aatgtgaatt gcagaattca gtgaatcatc gaatctttga acgcaccttg cactccttgg 360

[0105] tattccgagg agtatgcctg tttgagtctc atggtattct caacccctaa atttttgtaa 420

[0106] tgaaggttta gcgggcttgg acttggaggt tgtgtcggcc cttgtcggtc gactcctctg 480

[0107] aaatgcatta gcgtgaatct tacggatcgc cttcagtgtg ataattatct gcgctgtggt 540

[0108] gttgaagtat ttatggtgtt catgcttcga accgtctcct tgccgagaca atcatttgac 600

[0109] aatctgagct caaatcaggt aggactaccc gctgaactta agcatatc 648

[0110] The matters not described in detail in the present invention are all known technologies to those skilled in the art.

[0111] The embodiments of the present invention are given for the purpose of illustration and description, and are not intended to be exhaustive or to limit the invention to the disclosed forms. Many modifications and variations will be apparent to those of ordinary skill in the art. The embodiments are selected and described in order to better illustrate the principles and practical applications of the present invention and to enable those of ordinary skill in the art to understand the present invention and thereby design various embodiments with various modifications suitable for specific uses.

Claims

1. A strain of Pseudomonas aeruginosa GJ243, characterized in that: The strain preservation number is: CGMCC NO:41281, and the preservation date is: April 7, 2024.

2. Use of the strain of the white capsule rake tooth fungus GJ243 according to claim 1, characterized in that: The strain has a degrading effect on cellulose, lignin and hemicellulose.

3. The method for preparing the liquid inoculum of White Capsule Rake Tooth Fungus GJ243 according to claim 1, characterized in that: The method comprises the following steps: inoculating the white capsule rake tooth fungus GJ243 strain into a PDA liquid culture medium, and culturing the culture medium in a constant temperature oscillator at 30° C. and 180 rpm / min for 5 days to obtain a liquid bacterial agent.

Images