Chinese bee intestinal fungus ZFCZ33 and application thereof
By isolating and identifying the intestinal fungus of Chinese bee and its crude fermentation extract, combined with materials such as glycerol and sodium alginate, the problem of insufficient research on the antibacterial activity of insect intestinal fungi is solved, and the stability and dispersion of the drug are improved. , effectively inhibiting a variety of bacteria and providing new ways to develop antibacterial drugs.
Patent Information
- Application Number
- CN202411569501.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-05
- Publication Date
- 2024-12-20
AI Technical Summary
In the prior art, there are few studies on the antibacterial activity of insect intestinal fungi, especially the isolation of intestinal fungi in Chinese bee and the antibacterial activity of crude fermentation extracts, which leads to challenges in the development of antibacterial drugs.
The Chinese honeybee intestinal fungus ZFCZ33 was isolated and identified. Its fermentation broth extract has antibacterial activity against bacteria such as Staphylococcus aureus, E. coli, Pseudomonas syringae kiwi fruit pathogenic variants, and it is also used to glycerol, vegetable oil and seaweed. The combination of sodium acid and other materials improves the stability and dispersion of the crude extract of fermentation broth and forms a sustained release effect.
It effectively improves the stability and dispersion of bacterial active drugs, achieves effective inhibition of target bacteria, and provides new ways to develop antibacterial drugs.
Smart Images
Figure CN119162003A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of microbial engineering, and in particular to Chinese honey bee intestinal fungus ZFCZ33 and application thereof. Background Art
[0002] Pathogenic bacteria can cause diseases in humans, animals and plants, thus causing great harm to people's lives and production, such as the zoonotic bacteria Staphylococcus aureus and the pathogenic variants of Pseudomonas syringae, the pathogen of kiwifruit canker.
[0003] In order to inhibit the pathogenicity of pathogenic bacteria, people invented antimicrobial drugs, but with the continuous development of antimicrobial resistance and the reduction of new antimicrobial drugs, people began to look for microorganisms from other habitats, such as insects and plants. However, compared with soil and plant-derived microorganisms, insect-derived microorganisms show significant antimicrobial activity, especially insect intestinal fungi.
[0004] In addition, studies have found that insect gut fungi have become an important source of new microbial resources and new natural products. Therefore, studying insect gut fungi plays an important role in our development of new antibacterial drugs. In addition, as a type of microorganism that has been less studied, insect gut fungi have also attracted widespread attention and in-depth research.
[0005] As a social insect, honey bees are the world's most important pollinators and play an irreplaceable role in ecosystems and agricultural development. The Southern Anhui Chinese honey bee is an ecological type formed by the long-term adaptation of the Chinese honey bee in the southern Anhui mountainous area of Anhui Province. It is an excellent local variety. The bee intestine is an important organ in the bee's body and the main part of its digestion and processing of food and nutrient metabolism.
[0006] However, the understanding of the species and biological activities of intestinal fungi in southern Anhui honey bees is still limited, especially there are no reports on the isolation of intestinal fungi in southern Anhui honey bees and the antibacterial activity of crude extracts of fermentation broth. Summary of the invention
[0007] The purpose of the present invention is to solve the shortcomings of the prior art and to propose the Chinese honey bee intestinal fungus ZFCZ33 and its application.
[0008] The Chinese honey bee intestinal fungus ZFCZ33 is Aspergillus subramanianii of the genus Aspergillus, which is deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC 64870.
[0009] Preferably, the colonies of the Chinese honey bee intestinal fungus ZFCZ33 are dark green, with white hyphae and spherical conidia, 3.5-3.8 μm.
[0010] The above-mentioned method for cultivating the Chinese honey bee intestinal fungus ZFCZ33 comprises the following steps:
[0011] (1) On a sterile workbench, select the collected Anhui honey bee samples and place them in a 50 mL centrifuge tube, add 30 mL of 75% ethanol and soak for 2 min, then rinse three times with 30 mL of sterile water;
[0012] The intestine of the above-mentioned southern Anhui honey bee was clamped with sterile tweezers and placed in a sterile mortar, and 5 mL of sterile water was added to grind it, and the mixture was allowed to stand to obtain a supernatant;
[0013] (2) Use a pipette to draw 1 mL of the supernatant to obtain the stock solution, and then add the resulting stock solution according to 10 -1 , 10 -2 , 10 -3 The concentration gradient was diluted, and 100 μL of each gradient dilution solution was dropped on a culture dish containing a solid separation medium containing a bacterial inhibitor, and evenly spread using a coating rod. Each group was repeated 3 times, and finally the coated culture dish was sealed with a sealing film, and inverted culture was carried out in a constant temperature incubator at 26-29°C for 7-10 days;
[0014] A single colony was inoculated onto a culture dish containing potato dextrose agar and cultured for 3-5 days.
[0015] Preferably, the bacterial inhibitor is ampicillin and streptomycin sulfate, the concentration of ampicillin is 45-55 μg / mL, and the concentration of streptomycin sulfate is 40-60 μg / mL.
[0016] Preferably, the solid separation medium is one of potato dextrose agar medium, malt extract agar medium, and Sabouraud dextrose agar medium.
[0017] The method for preparing the crude extract of the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 comprises the following steps:
[0018] In the clean bench, use an inoculation needle to pick up a 0.5 cm × 0.5 cm colony of the Chinese honey bee intestinal fungus ZFCZ33 and place it in a potato glucose liquid culture medium, and culture it in a constant temperature shaking incubator at 26-29°C for 6-8 days;
[0019] After the cultivation, the fermentation liquid was filtered through 4 layers of gauze, and the filtrate and ethyl acetate were mixed in equal volumes and placed in a separatory funnel. After standing and stratification, the ethyl acetate layers were combined, concentrated and evaporated to dryness by a rotary evaporator, and the extraction was repeated 3 times.
[0020] A crude extract of fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 is prepared by adopting the method for preparing the crude extract of fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33.
[0021] The application of the crude extract of fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 in the preparation of drugs with inhibitory activity against bacteria.
[0022] Preferably, the bacterium is Staphylococcus aureus, Escherichia coli, Pseudomonas syringae pv. kiwifruit or Bacillus thuringiensis.
[0023] Preferably, the diameter of the inhibition zone of Staphylococcus aureus is 24.33±0.47 mm, the diameter of the inhibition zone of Escherichia coli is 17.00±0.82 mm, the diameter of the inhibition zone of Pseudomonas syringae pv. actinidia is 25.33±0.47 mm, and the diameter of the inhibition zone of Bacillus thuringiensis is 15.50±0.50 mm.
[0024] A drug for inhibiting bacterial activity, comprising: a crude extract of fermentation liquid of the above-mentioned Chinese honey bee intestinal fungus ZFCZ33.
[0025] Preferably, the above-mentioned antibacterial active pharmaceutical raw materials include, by mass: 10-20 parts of the crude extract of the fermentation broth of the above-mentioned Chinese honey bee intestinal fungus ZFCZ33, 10-30 parts of glycerol, 1-5 parts of vegetable oil, 1-5 parts of sodium alginate, 1-2 parts of terminal carboxyl polyamidoamine, and 0.1-3 parts of calcium chloride.
[0026] The method for preparing the above-mentioned drug for inhibiting bacterial activity comprises the following steps:
[0027] S1. Mix the crude extract of the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33, glycerin and vegetable oil, stir at 50-60° C. for 5-10 min, add sodium hydroxide solution dropwise thereto under stirring, continue stirring for 10-30 min, adjust the pH value of the system to 7.2-7.6, and obtain an extract mixture;
[0028] S2, adding sodium alginate and carboxyl-terminated polyamidoamine into water and stirring evenly to obtain a composite sodium alginate solution;
[0029] S3. Add the extract mixture dropwise into the composite sodium alginate solution, stir for 10-30 minutes, freeze-dry, add into a calcium chloride solution with a mass fraction of 0.1-1%, let stand for 5-10 minutes, wash, and freeze-dry.
[0030] Preferably, in S1, the concentration of the sodium hydroxide solution is 1-2 mol / L.
[0031] Preferably, in S1, the concentration of hydrochloric acid is 0.5-1.2 mol / L.
[0032] Preferably, in S3, the vegetable oil is at least one of peanut oil, rapeseed oil, soybean oil, corn oil, camellia oil, walnut oil, olive oil, palm oil, grapeseed oil and sunflower oil.
[0033] Beneficial effects of the present invention:
[0034] The present invention obtains the Aspergillus subramanianii ZFCZ33 strain by separating and screening the intestinal fungi of Chinese honey bees. Through experiments, it is found that the crude extract of ZFCZ33 fermentation liquid has good antibacterial activity against bacteria such as Staphylococcus aureus, Escherichia coli, Pseudomonas syringae pv. kiwifruit and Bacillus thuringiensis, providing a new way for researching and developing new antibacterial drugs.
[0035] However, the obtained crude extract of fermented broth has poor stability, is difficult to dissolve in water, and has poor dispersibility in water, which makes it difficult to use in actual production and life. The present invention adopts glycerol and vegetable oil to cooperate with the crude extract of fermented broth, which not only has good affinity and good mutual dispersion uniformity, but also effectively stabilizes the oil-water phase after being treated with sodium hydroxide, and then is coated with a composite sodium alginate solution, and can provide a dense protective layer for the crude extract of fermented broth after solidification. At the same time, sodium alginate is combined with carboxyl-terminated polyamide amine, which has a highly symmetrical core branching structure to form a cavity, has high stability for extract coating, and has excellent dispersibility. In addition, when combined with sodium alginate, the surface hydrophilicity of the stabilized extract can be significantly enhanced, and the dispersion effect of the antibacterial active drug in water can be effectively improved.
[0036] The invention effectively improves the stability of the antibacterial active drug in water, realizes the controllability of the release of internal substances, and achieves a sustained-release effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 This is the colony morphology of the intestinal fungus ZFCZ33 of the Chinese honey bee.
[0038] Figure 2 This is the microscopic morphology of mycelium of the intestinal fungus ZFCZ33 of the Chinese honey bee.
[0039] Figure 3 This is the phylogenetic tree of the intestinal fungus ZFCZ33 of the Chinese honey bee.
[0040] Figure 4 This is a graph showing the antibacterial activity of the Chinese honey bee intestinal fungus ZFCZ33 against Staphylococcus aureus; wherein a represents the experimental group, and b, c, d, e, and f represent the control group.
[0041] Figure 5 This is a graph showing the antibacterial activity of the Chinese honey bee intestinal fungus ZFCZ33 against Escherichia coli; wherein a represents the experimental group, and b, c, d, e, and f represent the control group.
[0042] Figure 6This is the antibacterial activity of the intestinal fungus ZFCZ33 of the Chinese honey bee against the kiwifruit pathogenic variant of Pseudomonas syringae; among them, a represents the experimental group, and b, c, d, e, and f represent the control group.
[0043] Figure 7 This is a graph showing the antibacterial activity of the Chinese honey bee intestinal fungus ZFCZ33 against Bacillus thuringiensis; wherein a represents the experimental group, and b, c, d, e, and f represent the control group.
[0044] Figure 8 This is a comparison chart of the particle size and polydispersity index of the aqueous dispersion of the antibacterial active drug obtained in Example 6 and the aqueous dispersion of the antibacterial active drug obtained in the comparative example.
[0045] Fig. 9 This is a comparison chart of the absolute values of the Zeta potential of the aqueous dispersion of the antibacterial active drug obtained in Example 6 and the aqueous dispersion of the antibacterial active drug obtained in the comparative example.
[0046] Fig.10 This is a comparison chart of the initial inhibition rate and 7d inhibition rate of the crude aqueous extract of the fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, the aqueous dispersion of the antibacterial active drug obtained in Example 6, and the aqueous dispersion of the antibacterial active drug obtained in the comparative example against the kiwifruit pathogenic variant of Pseudomonas syringae. DETAILED DESCRIPTION
[0047] The present invention will be further explained below in conjunction with specific embodiments.
[0048] Example 1
[0049] This strain was isolated and collected by Cui Pu from the intestines of the Chinese bee in southern Anhui in Xiuning County, Huangshan City, Anhui Province, China in November 2023.
[0050] Isolation and purification of strains:
[0051] (1) In a sterile workbench, select 7 collected samples of southern Anhui honey bees and place them in a 50 mL centrifuge tube, add 30 mL of 75% ethanol to soak for 2 min, and then rinse with 30 mL of sterile water for 3 times; then use sterile tweezers to clamp the intestinal samples of 7 bees in a sterile mortar, add 5 mL of sterile water to grind, and let it stand to obtain the supernatant;
[0052] (2) Use a pipette to draw 1 mL of the supernatant to obtain the stock solution, and then add the resulting stock solution according to 10 -1 , 10 -2 , 10 -3The concentration gradient was diluted, and 100 μL of each gradient dilution was dropped on a culture dish of potato dextrose agar medium containing 50 μg / mL ampicillin and 50 μg / mL streptomycin sulfate bacterial inhibitor, and evenly spread with a spreading rod. Each group was repeated 3 times, and finally the coated culture dish was sealed with a sealing film, and inverted culture was carried out in a constant temperature incubator at 28°C for 7-10 days; after the culture, the single colony was transferred to the culture dish of potato dextrose agar medium and cultured for 3-5 days.
[0053] The intestinal fungus ZFCZ33 of Apis cerana cerana was identified by morphological observation and molecular biology.
[0054] Colony morphology of the intestinal fungus ZFCZ33 of the Chinese honey bee Figure 1 As shown, the microscopic morphology of conidia is as follows Figure 2 As shown in the figure, the colony of the Chinese honey bee intestinal fungus ZFCZ33 is dark green, with white hyphae and spherical conidia, 3.5-3.8μm. With reference to the "Handbook of Fungal Identification" and other literature, the fungus was preliminarily identified as Aspergillus.
[0055] Take 20 μL of lysis buffer (Lysis Buffer for Microorganism to Direct PCR) in a sterilized 1.5 mL centrifuge tube, pick a small amount of mycelium of the Chinese honey bee intestinal fungus ZFCZ33 and place it in a 1.5 mL centrifuge tube. After heat denaturation at 80°C for 15 minutes, centrifuge at 10,000 r / min for 10 minutes. The supernatant was used as a PCR reaction template, and PCR amplification was performed with ITS1 and ITS4 as primers. Nanjing Qingke Biotechnology Co., Ltd. was commissioned to sequence the 5.8S rDNA of the Chinese honey bee intestinal fungus ZFCZ33, and a 5.8S rDNA sequence with a length of 581 bp was obtained.
[0056] The 5.8S rDNA sequence is as follows:
[0057] GCGGAAGGATCATTACTGAGTGAGGGTCCCTCGGGGCCCA
[0058] ACCTCCCACCCGTGTATACCGTACCTTGTTGCTTCGGCGGGCCC
[0059] GCCGCGCAAGCGGCCGCCGGGGGGGGCGTCAAACCCCCCTCC
[0060] CTAGGCGAGCGCCCGCCGGAGACACCAACGTGAACACTGTCTG
[0061] AAGTTTTGTTGTCTGAGTTCGATTGTATCGCAATCAGTTAAAAC
[0062] TTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCA
[0063] GCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCA
[0064] TCGAGTCTTTGAACGCACATTGCACCCCCTGGTATTCCGGGGGG
[0065] TATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTG
[0066] TGTTGGGTCGTCGTCCCCCCGGGGACGGGCCCGAAAGGCAGCG
[0067] GCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACC
[0068] CGCTCTTGTAGGCCCGGCCGGCGCTGGCCGACGCTGAAAAGCA
[0069] ACCAACTATTTCTCCAGGTTGACCTCGGATCAGGTAGGGATACC
[0070] CGCTGAACTTAAGCATAT
[0071] The 5.8S rDNA sequencing results of the intestinal fungus ZFCZ33 of the Chinese honey bee were submitted to the NCBI database for BLAST analysis, and the phylogenetic tree of the intestinal fungus ZFCZ33 of the Chinese honey bee was constructed using MEGA 5.1 software. Figure 3 As shown, the similarity between the Chinese honey bee intestinal fungus ZFCZ33 and Aspergillus subramanianii OL711825 reached 100%. Based on the morphological results, the Chinese honey bee intestinal fungus ZFCZ33 was identified as Aspergillus subramanianii in the genus Aspergillus.
[0072] The Chinese honey bee intestinal fungus ZFCZ33 was deposited in the Guangdong Provincial Microbiological Culture Collection Center (5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province) on July 15, 2024, with the deposited name Aspergillus subramanianii ZFCZ33 (Aspergillus subramanianii ZFCZ33) and the deposited number GDMCC 64870.
[0073] Example 2
[0074] The method for preparing the crude extract of the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 comprises the following steps:
[0075] In the clean bench, an inoculation needle was used to pick up a 0.5 cm × 0.5 cm block of the above-mentioned Chinese honey bee intestinal fungus ZFCZ33 colony and placed it in a potato glucose liquid culture medium (200 g potato, 20 g glucose, add water to make up to 1000 mL), 175 mL per bottle, a total of 3 bottles, and cultured in a constant temperature shaking incubator at 28°C for 7 days to obtain a fermentation liquid.
[0076] After the cultivation, the fermentation liquid was filtered through 4 layers of gauze, and the filtrate and ethyl acetate were mixed in equal volumes and placed in a separatory funnel. After standing and stratification, the ethyl acetate layers were combined, concentrated and evaporated to dryness by a rotary evaporator, and the extraction was repeated 3 times.
[0077] Example 3
[0078] (1) Activation of test strains: The test bacteria include Escherichia coli, Staphylococcus aureus, Pseudomonas syringae pv. kiwifruit, Bacillus thuringiensis, Pseudomonas aeruginosa, and Bacillus subtilis. Use an inoculation loop to inoculate the 7 test bacteria into LB solid culture medium and place it in a 37°C constant temperature incubator for 24 hours for activation. Then take 4mL of LB liquid into a 10mL shaking tube, use an inoculation loop to dip a small amount of bacteria into the LB liquid shaking tube and mix evenly. After incubating in a shaker at 37°C and 180r / min for 8-10 hours, use a pipette to draw 200μL of bacterial suspension and add it to 175mL of 50-60°C LB culture medium, mix evenly, and pour into a culture dish.
[0079] (2) Filtration of the crude extract: The crude extract of the fermentation broth obtained in Example 2 and the crude extracts of the fermentation broth of the fungi Aspergillus fijiensis ZFCZ12, Aspergillus oryzae ZFCZ26, and Aspergillus flavus ZFCZ34 isolated and identified from the intestine of the Chinese honey bee were dissolved in methanol to prepare a solution with a concentration of 10 mg / mL. Methanol and a 10 mg / mL gentamicin sulfate solution were used as negative and positive controls, and the solution was sterilized by filtration using a sterile organic phase microporous filter membrane with a diameter of 0.22 μm.
[0080] (3) Measurement of inhibition zone: Use a single-hole puncher with a hole diameter of 6 mm to punch the filter paper into several circular filter paper pieces, sterilize and dry them for later use. Paste the sterile filter paper pieces on the solidified LB culture plate containing bacteria, add 5 μL of crude extract methanol solution, gentamicin sulfate solution or methanol to each filter paper piece, and finally incubate the culture plate in a 37°C incubator for 24-36 hours. Finally, use the cross method to measure the diameter of the inhibition zone (in mm) to evaluate the antibacterial activity, with 3 replicates per group.
[0081] like Figure 4-Figure 7 As shown in Table 1, the above-mentioned Chinese honey bee intestinal fungus ZFCZ33 (Aspergillus subramanianii), the crude extract of the fermentation liquid of the strain has good antibacterial activity against pathogenic bacteria such as Staphylococcus aureus, Bacillus subtilis and Pseudomonas syringae pv. kiwifruit, among which the diameter of the inhibition zone for Staphylococcus aureus is 24.33±0.47mm, the diameter of the inhibition zone for Escherichia coli is 17.00±0.82mm, the diameter of the inhibition zone for Pseudomonas syringae pv. kiwifruit is 25.33±0.47mm, and the diameter of the inhibition zone for Bacillus thuringiensis is 15.50±0.50mm. It has broad application prospects in the preparation of new antibacterial drugs / biopesticides.
[0082] Table 1 Antibacterial activity results of the crude extract of the fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 against 6 kinds of bacteria (mm)
[0083]
[0084]
[0085] Example 4
[0086] A drug for inhibiting bacterial activity, the raw materials of which include: 100g of crude extract of fermentation broth of Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, 100g of glycerol, 10g of vegetable oil, 10g of sodium alginate, 10g of 1.5-generation carboxyl-terminated polyamidoamine, and 1g of calcium chloride.
[0087] The method for preparing the above-mentioned drug for inhibiting bacterial activity comprises the following steps:
[0088] S1. The crude extract of the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, glycerin and vegetable oil were mixed, stirred at a temperature of 50° C. for 5 min, 50 g of a 1 mol / L sodium hydroxide solution was added dropwise thereto under stirring, and stirring was continued for 10 min. The pH value of the system was adjusted to 7.2-7.6 with 0.5 mol / L hydrochloric acid to obtain an extract mixture;
[0089] S2, adding sodium alginate and carboxyl-terminated polyamidoamine to 1000 g of water and stirring evenly to obtain a composite sodium alginate solution;
[0090] S3. Add the extract mixture dropwise into the composite sodium alginate solution, stir at a speed of 1000 r / min for 10 min, freeze-dry, add into a 0.1% calcium chloride solution, let stand for 5 min, wash with ethanol and water in turn, and freeze-dry.
[0091] Example 5
[0092] A drug for inhibiting bacterial activity, the raw materials of which include: 200g of crude fermentation extract of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, 300g of glycerol, 50g of vegetable oil, 50g of sodium alginate, 20g of 1.5-generation carboxyl-terminated polyamidoamine, and 30g of calcium chloride.
[0093] The method for preparing the above-mentioned drug for inhibiting bacterial activity comprises the following steps:
[0094] S1. The crude extract of the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, glycerin and vegetable oil were mixed, stirred at a temperature of 60° C. for 10 min, 100 g of a 2 mol / L sodium hydroxide solution was added dropwise thereto under stirring, and stirring was continued for 30 min. The pH value of the system was adjusted to 7.2-7.6 with a concentration of 1.2 mol / L hydrochloric acid to obtain an extract mixture;
[0095] S2, adding sodium alginate and carboxyl-terminated polyamidoamine to 2000 g of water and stirring evenly to obtain a composite sodium alginate solution;
[0096] S3. Add the extract mixture dropwise into the composite sodium alginate solution, stir at a speed of 2000 r / min for 30 min, freeze-dry, add into a 1% calcium chloride solution, let stand for 10 min, wash with ethanol and water in turn, and freeze-dry.
[0097] Example 6
[0098] A drug for inhibiting bacterial activity, the raw materials of which include: 150g of crude fermentation broth extract of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, 200g of glycerol, 30g of vegetable oil, 30g of sodium alginate, 15g of 1.5-generation carboxyl-terminated polyamidoamine, and 15g of calcium chloride.
[0099] The method for preparing the above-mentioned drug for inhibiting bacterial activity comprises the following steps:
[0100] S1. The crude extract of the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, glycerin and vegetable oil were mixed, stirred at a temperature of 55° C. for 8 min, 80 g of a 1.5 mol / L sodium hydroxide solution was added dropwise thereto under stirring, and stirring was continued for 20 min. The pH value of the system was adjusted to 7.2-7.6 with 0.8 mol / L hydrochloric acid to obtain an extract mixture;
[0101] S2, adding sodium alginate and carboxyl-terminated polyamidoamine to 1500 g of water and stirring evenly to obtain a composite sodium alginate solution;
[0102] S3. Add the extract mixture dropwise into the composite sodium alginate solution, stir at a speed of 1500 r / min for 20 min, freeze-dry, add into a 0.5% calcium chloride solution, let stand for 8 min, wash with ethanol and water in turn, and freeze-dry.
[0103] Comparative Example
[0104] A drug for inhibiting bacterial activity, the raw materials of which include: 150g of crude extract of fermentation liquid of Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, 200g of glycerol, 30g of vegetable oil, 30g of sodium alginate, and 15g of calcium chloride.
[0105] The method for preparing the above-mentioned drug for inhibiting bacterial activity comprises the following steps:
[0106] S1. The crude extract of the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, glycerin and vegetable oil were mixed, stirred at a temperature of 55° C. for 8 min, 80 g of a 1.5 mol / L sodium hydroxide solution was added dropwise thereto under stirring, and stirring was continued for 20 min. The pH value of the system was adjusted to 7.2-7.6 with 0.8 mol / L hydrochloric acid to obtain an extract mixture;
[0107] S2, adding sodium alginate to 1500g of water and stirring evenly to obtain a sodium alginate solution;
[0108] S3. Add the extract mixture dropwise into the sodium alginate solution, stir at a speed of 1500 r / min for 20 min, freeze-dry, add into a 0.5% calcium chloride solution, let stand for 8 min, wash with ethanol and water in turn, and freeze-dry.
[0109] The crude extract of the fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, the antibacterial active drug obtained in Example 6 and the antibacterial active drug obtained in the comparative example were added into ultrapure water and mixed thoroughly, and then allowed to stand for 24 hours to observe whether stratification occurs.
[0110] The aqueous dispersion of the antibacterial active drug obtained in Example 6 and the aqueous dispersion of the antibacterial active drug obtained in the comparative example did not stratify, while the aqueous dispersion of the crude extract of the fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2 showed stratified precipitation.
[0111] The particle size and distribution of the unstratified aqueous dispersion of the antibacterial active drug obtained in Example 6 and the aqueous dispersion of the antibacterial active drug obtained in the comparative example were further detected by a particle size analyzer, and the polydispersity index (PDI) was calculated; and the Zeta potential of the two was detected by a Zeta potential meter (Zeta potential reflects the charge of the particle surface to a certain extent and can be used to characterize the stability of the aqueous dispersion; the larger the absolute value of the Zeta potential, the more stable the system).
[0112] like Figure 8 As shown, the particle size of the aqueous dispersion of the antibacterial active drug obtained in Example 6 is smaller, and the polydispersity index is also smaller, indicating that the dispersion system formed by the antibacterial active drug obtained in Example 6 in water has higher uniformity.
[0113] like Fig. 9 As shown, the absolute value of the Zeta potential of the aqueous dispersion of the antibacterial active drug obtained in Example 6 is larger, which proves that the aqueous dispersion of the antibacterial active drug obtained in Example 6 is more stable.
[0114] The kiwifruit pathogenic variant of Pseudomonas syringae was inoculated on LB medium for activation culture, and then expanded. After that, the well-cultured pathogen was diluted with sterile water, adjusted to zero with sterile water, and the absorbance of the bacterial suspension was measured at a wavelength of 600nm using an ultraviolet spectrophotometer. The absorbance value was within the range of 0.3-0.4 (OD 600 = 0.3-0.4, the concentration of bacteria is about 2×10 8 CFU / mL).
[0115] The crude extract of fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2, the antibacterial active drug obtained in Example 6 and the antibacterial active drug obtained in the comparative example were added into ultrapure water and mixed thoroughly to obtain an aqueous dispersion diluted to 200 times.
[0116] The Oxford cup horizontal diffusion method was used. On the clean bench, 25 mL of solid LB medium that had been melted and cooled to 60°C was poured into a 9 cm diameter culture dish, and 100 mL of the prepared bacterial suspension was added to the culture medium with a pipette. Before the culture medium solidified, the two were quickly shaken thoroughly to make a bacterial plate. Use sterilized tweezers to clamp an Oxford cup with an inner diameter of 6 mm in the above plate, and make the bottom of the Oxford cup completely fit the culture medium. Place 1 or 3 Oxford cups on each plate, and then use a pipette to measure 100 mL of each group of water dispersion into the Oxford cup. Repeat 3 times for each group, using sterile water as a control, and culture in a 25°C incubator.
[0117] After 24 hours, observe whether there is an obvious antibacterial zone around the Oxford cup. After the agent in the Oxford cup has completely diffused, remove the Oxford cup with tweezers and measure the diameter of the antibacterial zone with a ruler. Measure continuously for 7 days, record the diameter of the antibacterial zone, and calculate the inhibition rate.
[0118] Inhibition rate = (treated colony diameter - control colony diameter) ÷ treated colony diameter × 100% Fig.10 As shown, the initial inhibition rate of the aqueous dispersion of the crude extract of the fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2 was better than that of Example 6 and the comparative example, but the inhibition rate of the aqueous dispersion of the crude extract of the fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2 was the lowest after 7 days. This is because the crude extract of the fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 obtained in Example 2 has poor dispersibility in water and no sustained-release effect, which causes the kiwifruit pathogenic variant of Pseudomonas syringae to grow again in the later stage.
[0119] The inhibition rate of the antibacterial active drug aqueous dispersion obtained in Example 6 and the comparative example can still be maintained above 70% after 7 days, because both have a sustained release effect and can inhibit the growth of the kiwifruit pathogenic variant of Pseudomonas syringae for a long time. By comparing the two, it can be found that the sustained release effect of the antibacterial active drug obtained in Example 6 is the best.
[0120] The applicant believes that the reason for the above results is that the present invention obtains the Aspergillus subramanianii ZFCZ33 strain by separating and screening the intestinal fungi of Chinese honey bees, and the crude extract of its fermentation broth has good antibacterial activity against bacteria such as Staphylococcus aureus, Escherichia coli, Pseudomonas syringae pv. kiwifruit and Bacillus thuringiensis, providing a new way for the research and development of new antibacterial drugs. Glycerol and vegetable oil are used to match the crude extract of the fermentation broth, which not only has good affinity and good mutual dispersion uniformity, but also effectively stabilizes the oil-water phase after being treated with sodium hydroxide, and then is coated with a composite sodium alginate solution, which can provide a dense protective layer for the crude extract of the fermentation broth after solidification, and at the same time, sodium alginate is matched with carboxyl-terminated polyamide amine, which has a highly symmetrical nuclear branching structure to form a cavity, has high stability for extract coating, excellent dispersibility, and can significantly enhance the hydrophilicity of the surface of the stabilized extract when matched with sodium alginate, effectively improving the dispersion effect of the antibacterial active drug in water. The invention effectively improves the stability of the antibacterial active drug in water, realizes the controllability of the release of internal substances, and achieves a sustained-release effect.
[0121] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.
Claims
1. Chinese honey bee intestinal fungus ZFCZ33, characterized in that It belongs to Aspergillus subramanianii, which is deposited in Guangdong Microbiological Culture Collection Center with the deposit number GDMCC 64870.
2. The Chinese honey bee intestinal fungus ZFCZ33 according to claim 1, characterized in that: Its colonies are dark green, with white hyphae and spherical conidia.
3. A method for culturing the Chinese honey bee intestinal fungus ZFCZ33 as claimed in claim 1 or 2, characterized in that: The steps include: (1) Wet-grind the intestine of southern Anhui honey bee, let it stand, and collect the supernatant; (2) The supernatant is diluted and evenly spread on the surface of a solid separation medium containing a bacterial inhibitor, and cultured in an inverted manner at 26-29°C for 7-10 days. The resulting single colony is then inoculated onto a potato dextrose agar medium and cultured for another 3-5 days.
4. The method for cultivating the Chinese honey bee intestinal fungus ZFCZ33 according to claim 3, characterized in that: The bacterial inhibitors were ampicillin and streptomycin sulfate, with the concentration of ampicillin at 45-55 μg / mL and the concentration of streptomycin sulfate at 40-60 μg / mL; The solid separation medium is one of potato dextrose agar medium, malt extract agar medium and Sabouraud dextrose agar medium.
5. A method for preparing a crude extract of fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 as claimed in claim 1 or 2, characterized in that: The method comprises the following steps: placing the colony of the Chinese honey bee intestinal fungus ZFCZ33 as claimed in claim 1 or 2 in a potato glucose liquid culture medium, culturing at a constant temperature of 26-29° C. for 6-8 days, filtering the fermentation liquid, mixing the filtrate with ethyl acetate, standing for stratification, and taking the ethyl acetate layer for vacuum concentration.
6. A crude extract of fermentation liquid of the intestinal fungus ZFCZ33 of Apis cerana, characterized in that: The crude extract is prepared by the method for preparing the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 as described in claim 5.
7. Use of the crude extract of the fermentation broth of the Chinese honey bee intestinal fungus ZFCZ33 as claimed in claim 6 in the preparation of drugs with antibacterial activity.
8. A drug for inhibiting bacterial activity, characterized in that: include: The crude extract of fermentation broth of Chinese honey bee intestinal fungus ZFCZ33 as claimed in claim 6.
9. The drug for inhibiting bacterial activity according to claim 8, characterized in that: The raw materials include, by mass: 10-20 parts of crude fermentation extract of the Chinese honey bee intestinal fungus ZFCZ33 as claimed in claim 6, 10-30 parts of glycerol, 1-5 parts of vegetable oil, 1-5 parts of sodium alginate, 1-2 parts of terminal carboxyl polyamidoamine, and 0.1-3 parts of calcium chloride.
10. A method for preparing a drug having antibacterial activity as claimed in claim 9, characterized in that: The steps include: S1. Mix the crude extract of the fermentation liquid of the Chinese honey bee intestinal fungus ZFCZ33 as claimed in claim 6, glycerin and vegetable oil, stir at 50-60° C. for 5-10 min, add sodium hydroxide solution dropwise thereto under stirring, continue stirring for 10-30 min, adjust the pH value of the system to 7.2-7.6, and obtain an extract mixture; S2, adding sodium alginate and carboxyl-terminated polyamidoamine into water and stirring evenly to obtain a composite sodium alginate solution; S3. Add the extract mixture dropwise into the composite sodium alginate solution, stir for 10-30 minutes, freeze-dry, add into a calcium chloride solution with a mass fraction of 0.1-1%, let stand for 5-10 minutes, wash, and freeze-dry.